Chapter 12 - useful links

advertisement
College Biology – Honors
Chapter 12
The History of DNA
o Fred Griffith’s experiments inferred that genetic information could be
transformed or transferred from one bacterium to another. circa 1928
o Erwin Chargaff showed that the % of nitrogen bases cytosine/guanine, and
adenine/thymine, were approximately equal in number.
o Oswald Avery discovered that DNA is the nucleic acid that stores and transmits
information from one generation to the next. A team of scientists working with
him determines that genes are made of DNA. circa 1944
o Hershey and Chase discovered that bacteriophages (viruses that infect bacteria)
use DNA to infect their host, not protein. circa 1951
o Ros Franklin working with Mo Wilkins studied DNA using x-ray crystallography or
x-ray diffraction, and actually provided a picture of the molecule. Franklin
determines from the pictures that DNA is a helix. circa 1952
o Watson and Crick develop a model of DNA that is a double helix, in which two
strands are wrapped around each other. Their model looked like a twisted ladder.
They quickly determine the method by which DNA copies itself. april 1953
The Structure of DNA
DNA is a double helix macromolecule, that is a polymer composed of many stacks of
nucleotides. A nucleotide is made of a nitrogen base, a 5-carbon sugar, and a phosphate
group. Let’s see what is needed to make a nucleotide.
Choose one from Column A, one from Column B, and one from Column C
Column A
Column B
Column C
Deoxyribose
O
O
Phosphate
Ribose
O
O
Purines = Adenine, Guanine
Pyrimidines = Cytosine, Thymine, Uracil
o Nitrogen base pairing in DNA = 1 Purine with 1 Pyrimidine joined by Hydrogen
bonds.
o Each nucleotide monomer is held together by what is called a sugar phosphate
backbone.
o Each DNA molecule has 2 sugar phosphate backbones, each of which is a helix.
o DNA would look something like this, only much longer and twisted or spiraled:
Deoxy ribose
Deoxy ribose
Guanine
Cy tosine
PO4
PO4
Deoxy ribose
Deoxy ribose
Thy mine
Adenine
PO4
PO4
Deoxy ribose
Deoxy ribose
Cy tosine
Guanine
PO4
PO4
Deoxy ribose
Deoxy ribose
Adenine
PO4
Thy mine
PO4
So a single DNA molecule can have several million base pairs and can be over a meter
long if stretched out. Don’t forget the DNA molecule will coil and wrap itself around
protein spools called histones. These coils of DNA become super coils which when
bunched together become a visible chromosome, during a cell division. What is truly
amazing is that these long complicated strands of DNA will actually go through a
replication process millions of times throughout the life cycle of an organism, and rarely
if ever, get tangled or confused.
DNA Replication
Replication is carried out with the help of enzymes, those biological facilitators. First
the two strands are separated like a zipper or unzipped. Then the complimentary bases
on both sides of the DNA strands are filled in. You gotta see page 298.
The construction (polymerization) of 2 new DNA molecules from 2 single strands is
attributed to the enzyme called DNA polymerase. This enzyme polymerizes individual
nucleotides to produce complete DNA.
RNA – As you know, RNA is a single strand of stacked nucleotides, with Ribose as the
5-carbon sugar, and the nitrogen base Uracil (a pyrimidine) takes the place of Thymine.
There are 3 known forms of RNA. m-RNA, t-RNA, and r-RNA
Research the name, shape, and function of each type of RNA
m-RNA –
t-RNA –
r-RNA –
Transcription
RNA is formed in the process of transcription, which is similar to replication. Instead
of a complimentary strand of DNA being formed, a strand of complimentary RNA
nucleotides is polymerized. RNA polymerase binds to DNA and separates the DNA
strands. RNA polymerase uses one strand of DNA as a template from which the
nucleotides are assembled into a strand of RNA.
Where does transcription take place?
How does RNA polymerase know where to start this process and where it should end it?
What are introns and exons?
Protein Synthesis
The DNA molecule is coded information. This information is used to build proteins.
Proteins as you know, are made of amino acids that are linked together in long chains.
There are many different protein structures, and each is based on the particular
configuration of the amino acids. Some organisms have tens of thousands of different
proteins. So this is where the genetic code of the DNA molecule is used, to synthesize
proteins. DNA transcribes mRNA that migrates out of the nucleus to the site of a
ribosome. The mRNA is carrying a protein blueprint message. That message consists
of a long strand of codons; a codon is 3 consecutive nucleotides that call for a specific
building block or amino acid. See page 303 in your text. The specific amino acid is
carried to the site of protein synthesis by tRNA. The tRNA has a site called the anticodon (complimentary bases) that docks with the codon. While the codon and anticodon are linked, the amino acid is fastened (via a peptide bond) to another amino acid
forming a chain. The tRNA releases, and moves back to the cytoplasm to pick up
another amino acid. This process of reading the coded message and assembling a
polypeptide chain (protein), is called translation. Study carefully the diagrams on pages
304 & 305. The following web sites provide excellent activities to help us understand
Replication, Transcription, and Translation.
http://gslc.genetics.utah.edu/basic/builddna.html
http://gslc.genetics.utah.edu/basic/dogma/nf1dna.html
Compare the different roles played by DNA and RNA.
Why is the nucleus of a cell considered the brains of the operation of that cell?
So genes, which are responsible for inheritance, are nothing more than information used to assemble
proteins. Every physical aspect and characteristic of an organism is determined by its particular
proteins. And proteins are determined by DNA with the help of RNA. Heavy!
Mutations – are changes in the DNA sequence that affect the genetic information.
Point mutations occur at a single point in the nucleotide sequence. Usually one
nucleotide is substituted another. That would produce only one different amino acid.
That’s a small change. Check this out! This is a frame shift mutation.
THECATATETHEDOG!
If this is a message in codons, it would read, THE CAT ATE THE DOG !
If a frame shift mutation occurred and the first T was eliminated, the message would
read, HEC ATA TET HED OG! which doesn’t make sense. Look at this!
Here is a sequence of codons on DNA:
TAC GCA TGG AAT CCG
This is the mRNA sequence:
AUG CGU ACC UUA GGC
The resulting amino acid sequence: Methionine-Ariginine-Threonine-Leucine-Glycine
If the first base is removed. We have: DNA ACG CAT GGA ATC CG
The mRNA would be UGC GUA CCU UAG
The amino acid sequence - Cysteine-Valine-Proline-Stop (big difference)
Chromosomal mutations involve changes in chromosome structure or number. Describe
the following examples of chromosomal mutations:
Deletion –
Duplication –
Inversion –
Translocation –
Gene Regulation
All the information found in genes is not always used, and if it is used, it is not
always used to synthesize polypeptide chains. Some of the genes found in a
chromosome are recessive and may not be expressed. Because of the presence of
certain repressors or activators, mRNA may or may not be transcribed.
Some of the information is used to direct operations or provide specific
instructions like “start here” or “stop here”. Some areas of the gene provide a site
for attachment of enzymes such as RNA polymerase. Scientists ,particularly molecular
biologists are still finding out about the many complexities of DNA and the genes it
makes up. We’ve come a long way since the days of Gregor Mendel’s garden pea
experiments.
Did you know that some genes turn on and turn off together in groups? They are
known as operons. Sections of these genes, called operators , bind with repressors
(that act like brakes), when an operon is turned off. Operators remind me of chocks.
Some genes, called hox genes, (master control genes) are responsible for the
development of organs and tissues in various parts of the embryo. Now that’s
responsibility. They can also be responsible for body plans. Can you imagine a mutation
that occurs to the hox gene responsible for development of the brain or nervous tissue
of an organism? Geneticists have fiddled with fruit fly hox genes, and have developed
fruit flies with eyes on their legs instead of in the head region.
Don’t forget, experimentation leads to new information and new questions!
o What are some differences between prokaryotic genes and eukaryotic genes?
o What will the amino acid sequence be if a section of DNA to be transcribed is
TTAGGCAGTTGGAACCCGCTAGCTATCAGG?
Download