Name_____________________________________
Characteristics of Life Stations Lab
In this lab, you will visit 8 stations that demonstrate the characteristics of living things. At each station you will
be asked to collaborate with your partners or to work independently to complete the activity. Make sure that
you complete all of the parts of each station.
Station #1: Universal Genetic Code
Individually or together with your group members, read the brief article on the lab table at this station
about the universal genetic code. When you are done, answer the following questions with your station
group members.
1. Why do scientists say that the genetic code is “universal”?
2. After reading the article, what question(s) do you still have about the universal
genetic code?

Humans and gorillas appear to be so different. Gorillas are covered in hair, they cannot walk
upright, and they do not have a complex language just to name a few differences. But, are
they really that different? Check out the DNA sequence for a protein common in humans
and gorillas.
Human: CAATAGATTCATTTCACTGAGGGAGGCAAAGGGCTGGTCAATAGA
Gorilla: CAATAGATTCATTTCACTAAGAGAGGCAAAGGGCTGGTCAATGGA
1. Circle the differences in the sequence of DNA between a gorilla and a human. How
many differences are present?
2. How are the sequences similar? (Hint: What letters are found in both sequences?)
* Key Idea: All living things—from humans and gorillas to trees to mushrooms to
protists to bacteria— are based on a universal genetic code. All organisms have nucleic
acids (DNA & RNA) which stores information they need to live, grow, & reproduce.
Station #2: Response and Homeostasis
Work with your partners to collect data about your body’s response to environmental changes. You will
each perform the experiment one tow at a time so the others can record the information.

Determine the normal condition
1. Record your test subject’s heart rate and record it in the chart. Find your heart beat by placing
two fingers on your wrist. Ask for assistance if you experience any difficulty with this task. 2.
Count each thump as one beat. 3. Sit in your chair. Have your partner time you for ten
seconds as you count the number of beats. 4. Multiply the number of beats by six. This is how
much your heart beats in a minute while you are resting (your resting heart rate). 5. Record
the number of beats in the data table
 Response to environmental change
1. Stand up and have your partner time you for one minute as you run to the stop sign and back.
Count the number of beats for ten seconds. Multiply the number of beats by six to determine
the number of heart beats in a minute while walking (your walking heart rate). Record the
data in the data table Submerse one arm in a tub of water containing ice for 1-2 minutes.
Subject’s Name:

Resting heart Rate
Running Heart
rate
Explaining your results
1. Compare the resting and running heart rate for each experiment. Describe what
happened in each environmental condition.
2.
Talk to your test subject and find out how his or her body responded to each
environmental condition? Hint: breathing? Shaking?
3.
All living things must be able to maintain a stable internal balance called
homeostasis. Research “How the body responds to temperature changes.” In the
chart below, list ways that your body physically responds to hot or cold to maintain
homeostasis.
Response to Heat
Response to Cold
1.
2.
3.
*Key Idea: All living things respond to signals from their environment called STIMULI.
Living things must also keep conditions inside themselves as constant as possible even when
the environment changes. This is called HOMEOSTASIS!
Station #3: Cells
This station contains a variety of examples of cells. Please complete the steps below to view the cells
and answer the questions:

Examining Plant Cells:
1. A slide of an Euglena leaf has been prepared.
2. Beginning at low power, examine the Euglena under the compound light microscope.
Once in focus, switch to higher power.
3. Draw a quick sketch of one cell.

Examining Animal Cells:
1. Using the laptop at this station, go to the following website: http://www.nrccnrc.gc.ca/eng/education/biology/gallery/index.html
2. Click on the “Nerve” link under the “Plant and Animal Cells” heading on the right
hand side of the screen to view a microscopic image of a typical animal nerve cell.
OR you can view one of the animal slides (lung, skin)
3. Draw a quick sketch of the cell.

Examining Bacteria Cells:
1. Using the laptop at this station, go to the following website: http://www.nrccnrc.gc.ca/eng/education/biology/gallery/index.html
2. Click on the “Campylobacter” link under the “Bacteria” heading on the right hand
side of the screen to view a microscopic image of campylobacter, a common cause of
foodborne illness in North America. Draw a quick sketch of a single bacterial cell.
3. Bacteria come in a variety of shapes and sizes. If time permits, take a few moments
to click on the other images of bacteria.

Cell Station Questions:
1. How are the images of a plant cell, an animal cell, and a bacteria cell different?
2. How are they similar?
* Key Idea: Cells come in a variety of shapes and sizes. They look different. But, all
living things are made up of cells!!
Station #4: Reproduction
At this station you will explore different modes of reproduction and watch the development of an
embryo.

Defining Reproduction:
1. In the chart below, write a best guess definition of asexual and sexual reproduction.
There is a diagram at your station that may help you!
Asexual Reproduction:
Organisms:
Sexual Reproduction:
Organisms:
 Flashcard Sort:
1. Using the flashcards at your station, work with your group to sort the organisms into
two piles based on whether they reproduce asexually or sexually. Write the names of
the organisms in the appropriate column of your chart.

In asexual reproduction, one individual produces offspring that are exactly the same as
itself. There are many invertebrates, including star fish and flat worms for example, that can
reproduce by asexual reproduction.

In sexual reproduction, cells from two parents unite to form the first cell of a new organism.
The combination of information from two different parents results in the diversity we see
within a single species of organism.
1. Refer to your chart of sorted organisms, and list the organisms that you and your
group members are unsure about:
1. Using the computer at your station, watch the movie by Dr. Mark Hill at the
University of New South Wales:
http://embryology.med.unsw.edu.au/Movies/Growth.mov
2. What animal do you think is shown here?
3. Describe what is happening to the embryo throughout the course of the video. Give 4
specific examples of change. Use the slider control on the video to look m ore closely.
*Key Idea: All living things make new similar living things using sexual reproduction,
asexual reproduction, or both!
Station #5: Energy

Briefly discuss the following questions with your station group members and down your ideas in the
space below:
1. How do you obtain food? How does a plant obtain food?
2. What do you do that requires energy? What does a plant do that requires energy?

Autotrophs are organisms that can make their own food. Heterotrophs are organisms that
obtain food by consuming other living things.
1. Based on the definitions given above, are you a heterotroph or an autotroph?
2. Based on the definitions given above, is a plant a heterotroph or an autotroph?

Autotrophs are able to make their own food because they are able to capture energy from
sunlight or chemicals and use this energy to produce their own food from inorganic
compounds. Photoautotrophs use sunlight to make food. Chemoautotrophs use chemicals
such as iron and sulfur as their energy.
1. List 3 common photoautotrophs. You may need to research this.
2. When you think of autotrophs, images of photoautotrophs probably come to mind.
But, there are also other types of autotrophs! One type of chemoautotrophs lives
deep down in oceans along hydrothermal vents. To find out more about this type,
go to the following link. Click play and watch until “Vent Waters” appears
on the screen.
http://www.montereyinstitute.org/noaa/lesson05.html
What did you notice about the video?
* Key Idea: Living things obtain and use material and energy. The combination of
chemical reactions through which an organism builds up or breaks down materials is
called metabolism!
Station #6: Evolution
Individually or together with your group members, read the brief article at this station entitled “Between
a rock and a wet place.” When you are done, answer the following questions with your station group
members.
1.
What challenges do the climbing goby face as they return to their breeding areas?
2.
Goby’s from the same species can be short and squat or long and thin. According to the
article, why does this variation in size exist?
3.
In the last paragraph the author states that natural selection is helping to shape the bodies of
the gobies’ in different environments. How does natural selection work?
*Key Idea: Over generations, groups of living things evolve, or change over time!
Enrichment: Viruses- Are they alive?
In this activity, you have been able to examine the characteristics of living
things. But, what about viruses? Are they alive or not? This is still a
question debated by scientists today. Read the excerpt below to find out
more…
Are viruses qualified as living? This is a very interesting question
which has instigated many heated debates in scientific circles. Why are
viruses such a big deal? Well, viruses are interesting because they are neither
inanimate nor living; a virus is "midway between brute matter and living
organism" (Wolfhard Weidel). Because of this ambiguity, it is difficult to
define and classify viruses. Although viruses are not composed of cells, they possess all the other characteristics
of living things. They replicate, require energy (from living cells), adapt, respond to stimuli and display
heredity. Because viruses satisfy six of the seven characteristics of living things, they are on the verge of being
classified as a living organism. Perhaps the haziness surrounding our very definition of "living" is at fault for
not including viruses as a form of life. As scientist Wolfhard Weidel once said, "nothing brings us so close to
the riddle of Life - and to its solution - as viruses".
The above excerpt on viruses was taken from the Astrobiology website http://library.thinkquest.org/C003763/index.php?page=origin06
Station #7: Response to the Environment
Individually or together with your group members, read the brief article at this station entitled “Environmental
Change and Diversity.” When you are done, list 5 specific ways organisms respond to the environment.
1.
2.
3.
4.
5.
Using the computer at this station, go to the following website : https://encryptedtbn3.gstatic.com/images?q=tbn:ANd9GcROhiLitRp8Gushg24yXlkYGoPxAHQWzoQEKY4lRGS9AxhztaKAQ and complete the lab. Answer the following questions:
1. How do plants respond to light?
2. How do plants respond to gravity?
3. How do plants respond to touch?
4. Are these responses similar or different from animal responses? Why or why not? Be specific in
your answer and provide evidence to support your answer.
*Key Idea: All living things live in constantly changing environments. Each organisms
responds to changes in its own way. !
Station #8: Grow and Develop
Individually or together with your group members, read the brief article at this station entitled “Scientists
successfully grow human brain…. Or “lab grown skin” When you are finished reading the article, write a 5
sentence summary.
Summary:
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
_________________________________________________________________________________________
In this virtual lab, you will explore the stages of embryonic development. Using the computer at this station, go
to the following website: http://www.glencoe.com/sites/common_assets/science/virtual_labs/LS26/LS26.html
and complete the lab. Answer the following questions:
1. Use the graph to determine in which time period the developing embryo grows the most.
2. When does the development of the embryo begin? Explain your answer using information from the lab.
3. What are some of the major events in the stages of embryonic development?
*Key Idea: All living things live have a distinctive life cycle- pattern of growth and change that occurs
over the organisms lifetime. For some, the may organisms, the main change is growth, an increase in size.
All organisms grow during at least a part of their lives.
During development, the cells in an organism not only increase in number but also become different, or
differentiate. !