Biology 178 (Principles of Biology) Spring 2006: Practice Questions for Final Exam
SHORT ANSWER QUESTIONS:
1. Black fur is completely dominant to white fur in guinea pigs. A population was sampled and found to contain 336 black and 64
white individuals. Use the Hardy-Weinberg equation to determine the following:
(a) The frequency of the black allele.
(b) The frequency of heterozygous individuals.
(c) The number of homozygous dominant individuals in the population.
1
2. Approximately 70% of white north Americans can taste the chemical phenythiocarbamide and the remainder cannot. The
ability to taste this chemical is determined by the dominant allele T and the inability to taste is determined by the recessive allele t.
If the population is assumed to be in hardy-Weinberg equilibrium, what are the genotypic and allelic frequencies in this
population?
2
3. Transcribe the following DNA sequence into mRNA, and then translate it into protein. How many amino acids constitute this
protein?
5 GTCTTAACCTGATAGGGGCATATCAGC 3
4. The following sequence of bases is from the template strand of a DNA molecule.
(a) Convert this sequence to the corresponding mRNA sequence and using the genetic code provided in the text (P. 197) translate
that into the appropriate polypeptide chain.
5-AACTCGGAATTCTAATTTATACATATAACTCCTTTTTGTCTATTAATACACATACTGAGCCCTCAGTCGCG-3
(b) How many amino acids are in this protein?
3
(c) What would be the 2 principle effects of a mutation deleting the 48th nucleotide of the DNA? (show what amino acid
sequence you would obtain and explain).
MULTIPLE CHOICE QUESTIONS:
1.
The theory of evolution by natural selection was proposed by:
(A) Charles Darwin
(B) Carolus Linnaeus
(C) Thomas Malthus
(D) James Watson and Francis Crick
(E) Bernard Kettlewell
2.
Darwin’s journey on the HMS Beagle was important because he was able to:
(A) concentrate on paleontology for 5 years.
(B) study natural history in a number of locations including different continents and islands.
(C) perform ecological experiments.
(D) explain the phenomenon of endurance due to experiencing the harsh conditions on board.
(E) none of the above.
3.
Darwin’s finches are important because they:
(A) are found on the Galapagos Islands.
(B) are closely related species found on different islands.
(C) represent a group of closely related species each adapted to a particular lifestyle.
(D) eat seeds
(E) A and D.
4.
Homologous structures are:
(A) alleles.
(B) features that resemble each other but were formed from different structures.
(C) features that had a function in the original ancestor but no longer have a function in the descendent.
(D) features that may differ in form and function in the descendents but are derived from the same body part of the
common ancestor.
(E) none of the above.
5.
The current population of northern elephant seals along the California coast is approximately 130,000. These animals are
all descended from 10-100 animals. This is an example of:
(A) genetic drift.
(B) the founder effect.
(C) the bottleneck effect.
(D) A and B.
(E) A and C.
4
6.
Convergent evolution is responsible for:
(A) form following function.
(B) the formation of analogous structures.
(C) wings for flight in insects, birds, reptiles, and mammals.
(D) all of the above.
(E) none of the above.
7.
The large-scale patterns, trends, and rates of change among groups of species is known as:
(A) adaptation.
(B) natural selection.
(C) convergent evolution.
(D) microevolution.
(E) macroevolution.
8.
The recent work of Mary Schweitzer has opened up the field of:
(A) molecular phylogeny.
(B) paleontology.
(C) molecular paleontology.
(D) cellular geology.
(E) molecular geology.
9.
A phylogenetic tree is:
(A) a plant found on the Galapagos Islands.
(B) a diagram showing DNA sequence alignment for closely related species.
(C) used to represent the evolutionary history of a group of organisms.
(D) a key used by taxonomists to identify organisms.
(E) none of the above.
10.
The conditions required for Hardy-Weinberg equilibrium to exist include:
(A) input of new alleles.
(B) isolation of the population from other populations.
(C) high mutation rate.
(D) occurrence of natural selection.
(E) none of the above.
11.
The maintenance of the sickle cell allele in areas with a high incidence of falciparum malaria is an example of:
(A) adaptation.
(B) disruptive selection.
(C) stabilizing selection.
(D) directional selection.
(E) A and C.
12.
The following description pertains to a(n) _________.
“A type of organism, the members of which have similar characteristics and can interbreed, but are reproductively isolated
from other groups of organisms”.
(A) species
(B) population
(C) subspecies
(D) community
(E) none of the above.
5
13.
In the Hardy Weinberg equation, heterozygotes are represented by:
(A) p
(B) q
(C) p2.
(D) q2.
(E) 2pq.
14.
_________ describes when 2 populations reproduce in different seasons or times of day:
(A) Speciation.
(B) Temporal isolation.
(C) Geographic isolation.
(D) Behavioral isolation.
(E) Natural selection.
15.
Recombination is:
(A) a change in the base sequence of 1 or more genes.
(B) the transfer of genes from 1 organism to another.
(C) the procedure where DNA is cut with a restriction enzyme.
(D) a change in the position of a portion of the genetic message.
(E) none of the above.
16.
In evolution, genetic changes that _______ the number of progeny of an individual will be selected for.
(A) change
(B) stabilize
(C) increase
(D) decrease
(E) none of the above-genetic changes are never selected for
17.
Only when a genetic change occurs in the __________ will it be passed on to the progeny.
(A) somatic tissue
(B) brain tissue
(C) germ line tissue
(D) all of the above
(E) none of the above
18.
There are ___________ prokaryotic kingdoms.
(A) 1
(B) 2
(C) 3
(D) 4
(E) 6
19.
In the scientific name Homo sapiens, sapiens is the ___________.
(A) genus
(B) species
(C) order
(D) phylum
(E) kingdom
20.
Which of the following is the highest (most inclusive) category)?
(A) Family
(B) Species
(C) Class
(D) Phylum
(E) Order
6
21.
Which of the following is a domain?
(A) Prokaryote
(B) Eukarya
(C) Archaebacteria
(D) Protista
(E) Animalia
22.
Which of the following “accidents” led to Mary Schweitzer’s incredible discovery?
(A) Excavation of a Triceratops fossil.
(B) Extraction of DNA from a hair of a frozen mammoth.
(C) Removal of a wing from an insect preserved in amber.
(D) Breakage of a Tyrannosaurus rex bone.
(E) Examination of dinosaur skin under the microscope.
23.
The increase in the dark phenotype of the peppered moth in polluted areas is an example of:
(A) natural selection.
(B) selective predation.
(C) industrial melanism.
(D) all of the above.
(E) none of the above.
24.
The graph represents:
(A) mutation.
(B) stabilizing selection.
(C) disruptive selection.
(D) directional selection.
(E) none of the above.
25.
___________ would be an example of the process shown in the graph above.
(A) Birth weight in human infants
(B) Elimination of flies that move towards light
(C) The distribution of sickle cell anemia in Africa
(D) Selection for large and small seeds by the African fire-bellied seed cracker finch
(E) A and C
26.
The allele for sickle cell anemia is present in a family. However, the incidence of the disease became more prevalent in
the descendents of a marriage between cousins. This is an example of:
(A) founder effect.
(B) assortative mating.
(C) disassortative mating.
(D) bottleneck effect.
(E) gene flow.
27.
Which of the following is an example of frequency dependent selection?
(A) Maintenance by fish of rare color forms in a population of waterboatmen.
(B) Removal of rare color forms of butterflies by birds.
(C) Presence of the giant tortoise on the Galápagos Islands.
(D) Removal of all the fishermen in a population by a tsunami.
(E) A and B.
7
28.
Prior to the 1940s __________ was believed to be the hereditary material.
(A) DNA
(B) RNA
(C) protein
(D) phospholipid
(E) cholesterol
29.
In the experiments of Griffith, mice died when they were injected with:
(A) DNA.
(B) bacteriophage.
(C) radioactive phosphorus.
(D) live R bacteria and dead S bacteria.
(E) dead R bacteria and dead S bacteria.
30.
Bacteriophages:
(A) are viruses.
(B) infect humans.
(C) are responsible for AIDS.
(D) do not harm their host cell.
(E) inject protein into their host cell.
31.
In the experiment of Hershey and Chase, radioactive phosphorus ended up in the:
(A) supernatant.
(B) pellet.
(C) viral protein.
(D) bacterial capsule.
(E) mice.
32.
Watson and Crick determined the structure of DNA in:
(A) 1665.
(B) 1928.
(C) 1944.
(D) 1953.
(E) 1972.
33.
Examples of purines are:
(A) adenine and guanine.
(B) adenine and cytosine.
(C) cytosine ane thymine.
(D) cytosine and guanine.
(E) none of the above.
34.
The X-ray diffraction work that suggested that DNA has the form of a helix was carried out by:
(A) James Watson.
(B) Francis Crick.
(C) Edwin Chargaff.
(D) Rosalind Franklin.
(E) A and B.
35.
Chargaff’s rule states that:
(A) A=T and C=G.
(B) A=C and T=G.
(C) A and B.
(D) mRNA is copied from DNA.
(E) polypeptide chains are translated from the mRNA message.
8
36.
Chargaff’s rule:
(A) plus other evidence allowed the structure of DNA to be elucidated.
(B) suggests a molecule with a constant thickness.
(C) suggests a molecule with a regular structure.
(D) all of the above.
(E) none of the above.
37.
RNA contains the same bases as DNA except:
(A) adenine.
(B) cytosine.
(C) guanine.
(D) thymine.
(E) uracil.
38.
The orientation of the DNA strands is determined by numbering the:
(A) phosphorus atoms in phosphate.
(B) carbon atoms in deoxyribose.
(C) nitrogen atoms in nitrogenous bases.
(D) oxygen atoms in phosphate.
(E) hydrogen atoms in deoxyribose.
39.
DNA replicates:
(A) in the 5 to 3 direction.
(B) in the 3 to 5 direction.
(C) courtesy of RNA polymerase.
(D) in the cytoplasm.
(E) using DNA primers.
40.
__________ proved that the _________ hypothesis for DNA replication is correct.
(A) Meselson and Stahl, semi-conservative
(B) Meselson and Stahl, conservative
(C) Meselson and Stahl, dispersive
(D) Hershey and Chase, conservative
(E) Hershey and Chase, semi-conservative
41.
Okazaki fragments are:
(A) synthesized in the 3 to 5 direction.
(B) synthesized continuously.
(C) the leading strand.
(D) ligated after synthesis.
(E) synthesized using DNA primers.
42.
DNA helicase:
(A) winds up the DNA after replication.
(B) ligates DNA after replication.
(C) breaks the hydrogen bonds between DNA strands.
(D) removes introns.
(E) removes primers.
43.
In eukaryotes, translation occurs in the:
(A) cytoplasm.
(B) nucleus.
(C) nucleolus.
(D) rough endoplasmic reticulum.
(E) A and D.
During transcription:
44.
9
(A)
(B)
(C)
(D)
(E)
one of the strands of DNA serves as a template for mRNA synthesis.
both strands of DNA serve as a template for mRNA synthesis.
one of the strands of DNA serves as a template for tRNA synthesis.
mRNA is translated into protein.
ribosomes are synthesized from rRNA and protein.
45.
Each amino acid is specified by:
(A) 1 nucleotide.
(B) 2 nucleotides.
(C) 3 nucleotides.
(D) a codon.
(E) C and D.
46.
Ribsosomes are composed of :
(A) rRNA.
(B) mDNA.
(C) tRNA.
(D) protein.
(E) A and D.
47.
The part of tRNA that binds to mRNA is the:
(A) codon.
(B) anticodon.
(C) promoter.
(D) start sequence.
(E) A and B.
48.
Translation stops when:
(A) the promoter is reached.
(B) the codon for the amino acid methionine is reached.
(C) the 3 nucleotide sequence AUG is reached.
(D) a stop codon is reached.
(E) the end of the mRNA molecule is reached.
49.
A group of DNA nucleotides that contains the information to make a polypeptide chain is called a(n):
(A) gene.
(B) codon.
(C) anticodon.
(D) karyotype.
(E) promoter.
50.
All tRNA molecules except the one carrying the first amino acid of the polypeptide, first bind to the _______ site of the
ribosome:
(A) E.
(B) P.
(C) A.
(D) U.
(E) none of the above.
51.
When mRNA leaves the nucleus it first becomes associated with:
(A) tRNA.
(B) the large ribosomal subunit.
(C) the small ribosomal subunit.
(D) the entire ribosome.
(E) proteins.
mRNA leaves the nucleus via :
52.
10
(A)
(B)
(C)
(D)
(E)
the ribosome.
nuclear pores.
tRNA.
the nucleolus.
DNA pores.
53.
If a protein is to be secreted from a cell translation occurs;
(A) in the cytoplasm.
(B) in the nucleus.
(C) on the endoplasmic reticulum.
(D) on the Golgi complex.
(E) on the lysosomes.
54.
Which of the following scientists were responsible for elucidating the genetic code?
(A) Leder
(B) Nirenberg
(C) Crick
(D) Gobind Khorana
(E) All of the above
55.
The genetic code is universal, with the exception of _________.
(A) E. coli
(B) humans
(C) mitochondria
(D) bacteriophage
(E) A and C
56.
A GC hairpin is:
(A) an object Rosalind Franklin used to secure her hair.
(B) secondary structure of RNA.
(C) a primer.
(D) a type of Okazaki fragment.
(E) an experimental technique used to determine the structure of DNA.
57.
Which of the following is used to lengthen the “life” of mRNA in eukaryotes?
(A) Introns
(B) Exons
(C) 5 leader sequence
(D) Transcription factors
(E) 3 poly-A tail
58.
What did Watson and Crick (in their 1953 paper) state was wrong with Pauling and Corey’s model of DNA structure?
(A) The DNA was composed of only one chain.
(B) The phosphates were on the inside.
(C) The bases were linked by four hydrogen bonds.
(D) Their structure was actually RNA, not DNA.
(E) The nucleotides were composed of four subunits, not three.
11