Name_____________________________Date ________________________________
South Lewis High School – Mr. Comet
Living Environment
Student Name_________________________
Date Packet Began__________________ Date Packet Finished_________________
Lab # Title Turned in?
Yes No
Homework assigned Quizzes Scheduled Tests Scheduled
Yes No
Yes No
Yes No
Yes No
Yes No
Yes No
Yes No
Other Assignments
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
140

Name_____________________________Date ________________________________
Sun Mon Tue Wed Thu Fri
1
Sat
2
3 4 5 6 7 8 9
10 11 12 13 14 15 16
17
24
18
25
19
26
20
27
21
28
22
29
23
Sun Mon
2 3
Tue Wed Thu
4 5 6
9
16
10
17
11
18
12
19
13
20
23
30
24
31
25 26 27
Fri
7
Sat
1
8
14
21
15
22
28 29
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
141

Name_____________________________Date ________________________________
Mendelian Genetics
New York State Education Department Living Environment Core Curriculum Performance
Indicators: 2.1 e, 4.1 c
Upon completion of this unit the student will:
 recognize that Mendel developed his laws of heredity without any prior

 knowledge concerning genes or chromosomes. list at least five reasons for Mendel's success working with pea plants. recognize that every organism has coded instructions for specifying its traits and that DNA provides a reliable way for transferring hereditary information from one



 generation to the next. recognize that each gene carries a separate piece of information. recognize that the inherited trait of an individual can be determined by one or by many genes, and that one gene can influence more than one cell. recognize that each human cell contains thousands of genes. correctly define the following terms; gene, allele, chromosome, locus, and homologous chromosomes.















 recognize that alleles are located on the same position on homologous chromosomes. recognize that in asexually reproducing organisms, all the genes come from a single parent and are identical to those of the parent. recognize that sexually reproducing organisms receive half their genetic information from their Mother's egg and half from their Father's sperm. recognize that sexually reproduced offspring usually resemble, but are not identical to their parents. define the following terms and correctly use them in reference to genetic crosses; homozygous, heterozygous (hybrid), parental generation, first filial generation, and second filial generation. define the terms progeny and sibling. define the following terms and correctly use them in reference to genetic crosses; phenotype and genotype. state Mendel's three Laws of Heredity and correctly explain each. list two examples of intermediate inheritance. list two examples of codominance. correctly complete genetic crosses/Punnett squares involving the Law of
Dominance, incomplete dominance, or codominance. define the term gene linkage and list an example of this in humans. define the term crossing over and explain how it leads to genetic variability in sexually produced offspring. explain what is meant by a karyotype and list some examples of its usefulness. explain how sex is determined in the genetic makeup of humans. explain why the male determines the sex of a human baby.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
142

Name_____________________________Date ________________________________








 define the term mutation. explain why only mutations in gametes may be passed on to the offspring. explain the difference between a chromosomal alteration and a gene mutation. define the following terms correctly; disjunction, nondisjunction, polyploidy, and mutagenic agent. list some examples of mutagenic agents. recognize that the adaptive value of a gene mutation is dependent upon the nature of the mutation and the type of environment in which the organism interacts. list three examples of the interaction of the environment with genes in the expression of inherited traits. explain the difference between the following types of selective breeding; artificial selection, inbreeding, hybridization, vegetative propagation, and recombinant
DNA technology. explain the difference between the following changes in chromosome structure;

 translocation, addition, deletion, and inversion. recognize that the mapping of the genetic instructions in cells makes it possible to detect, and perhaps correct, defective genes that lead to poor health. recognize that substances from genetically engineered organisms may reduce the costs and side effects of replacing costly body chemicals.
I. Basic Genetics -- Mendel (1866)
** Mendel developed some basic principles of heredity
Image from: http://www.jic.bbsrc.ac.uk/germplas/pisum/zgs4f1.gif
Reginald Punnett
Image from: http://www.naturalselectionreptiles.com/Genetics.html
** As a result of analyzing specific mathematical ratios associated with certain characteristics in the offspring, Mendel proposed that characteristics were inherited
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
143

Name_____________________________Date ________________________________ as the result of the transmission of hereditary factors.
A. . Why was Mendel successful with the pea?
1.
2.
3.
4.
5.
Image from: http://eebweb.arizona.edu/courses/ecol320/Mendel'sPeaSoupSmall.jpg
B. Mendel had no knowledge of genes or chromosomes
8.
genes:
•Every organism requires a set of coded instructions for specifying its traits. For offspring to resemble their parents, their must be a reliable way to transfer hereditary information from one generation to the next.
•Each gene carries a separate piece of information. An inherited trait of an individual can be determined by one or by many genes, and a single gene can influence more than one cell.
•Each human cell contains thousands of different genes.
9.
alleles:
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
144

Name_____________________________Date ________________________________
Image from: http://www.naturalselectionreptiles.com/Genetics/allele.jpg
3. chromosomes:
4. locus:
(a.) homologous chromosomes:
Image from: http://www.biology.iupui.edu/biocourses/N100H/ch10genetics.html
** Alleles are located in the same position or locus on homologous chromosomes.
C
A.
Sexually reproducing organisms normally receive half their genetic information from the Mother's egg and half their genetic information from their Father's sperm.
E. The significance of Mendel's work was not immediately recognized.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
145

Name_____________________________Date ________________________________
F. Mendel's hereditary factors, now called genes, exist at definite loci in a linear fashion on chromosomes. Two genes associated with a specific characteristic are known as alleles and are located on homologous chromosomes.
The gene-chromosome theory provides the mechanism to account for the hereditary patterns which Mendel observed.
A.
homozygous (pure)
B.
heterozygous: (hybrid)
3. parental generation (P
4. first filial generation
A.
second filial generation
II. Some Major Genetic Concepts
Image from:
A. Law of Dominance (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
146

Name_____________________________Date ________________________________
1.
2. ex. red flowering X white flowering-->red flowering peas
3. dominant trait
4. recessive trait
5. progeny
6. siblings
7. Punnett square
8. genotype
9. phenotype
B. Principle of Segregation and Recombination (Mendel)
Image from: http://biology.about.com/library/weekly/aa100903a.htm
1.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
147

Name_____________________________Date ________________________________
2. As a result of fertilization, _______________________. As a consequence, new allelic gene combinations are likely to be produced.
** Segregation and recombination is illustrated by the cross between two individuals heterozygous for a trait.
C. Law of Independent Assortment (Mendel)
Image from: Image from: http://biology.about.com/library/weekly/aa100903a.htm
1. If the genes for two different traits are located on different chromosomes (nonhomologous chromosomes), they segregate randomly during meiosis and, therefore, may be inherited independently of each other.
2. The cross of two organisms heterozygous for a trait is known as a hybrid cross.
** Assuming large numbers of such crosses, the phenotypic ratio of dominant offspring to recessive offspring is 3:1 and the genotypic ratio of homozygous dominant offspring to heterozygous dominant offspring to homozygous recessive offspring is 1:2:1
D. Intermediate Inheritance
•2 examples -- incomplete dominance and codominance a. Incomplete Dominance - A case of contrasting alleles in which one allele is only partially dominant over the other --the dominant allele is only partially expressed when the recessive allele is present. Sometimes called blending inheritance
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
148

Name_____________________________Date ________________________________ examples: red snapdragon X white snapdragon ----> pink snapdragons
Image from: http://www.naturalselectionreptiles.com/Genetics/exIncompleteDominance.jpg b. Codominance:
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
149

Name_____________________________Date ________________________________
Image from: http://www.naturalselectionreptiles.com/Genetics/exCodominance.jpg
ex. cross between red and white horses gives roan horse ex. cross between black and white Andulusian fowl gives blue (gray) fowl
** Examples of codominance in humans are the blood groups and the sickle cell trait. (sickle cell anemia)
A Discussion of Blood Types in Humans……
A
A
A
B
B
B
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
150

Name_____________________________Date ________________________________
A
B gene linkage
Linked genes are usually inherited together. crossing over:
** Crossing over results in the rearrangement of linked genes and increases the variability of offspring.
Note in the picture above the four chromosomes make up a tetrad in synapsis. The second stage shows crossing over, and the last stage shows the genetic variability produced in the new gene combinations. karyotype:
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
151

Name_____________________________Date ________________________________
Image from: http://oak.cats.ohiou.edu/~schutte/kary.jpg
•Above is a karyotype of a normal human male.
•Human diploid cells contain ___________ chromosomes.
•autosomes:
•Homo sapiens has one pair of sex chromosomes - that which make us either male or female.
** In the male each sex chromosome is unlike and is designated XY. In the female each sex chromosome is alike and is designated XX.
** The sex of a human is genetically determined at fertilization when a sperm cell containing either an X or a Y chromosome unites with an egg cell containing an
X chromosome.
III. Mutations:
General statements about mutation….
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
152

Name_____________________________Date ________________________________
** While an altered gene (mutation) may be passed on to every cell that develops from the mutated cell, only mutations in sex cells may be passed on to the offspring.
** A mutation occurring only in body cells may be perpetuated in the individual but will not be passed on to the offspring by sexual reproduction.
•
•
B. Types of Chromosomal Alterations
3.
Nondisjunction:
4.
disjunction
** If disjunction fails to occur (nondisjunction), gametes with an addition or a missing chromosome will be produced.
3. Polyploidy
--
--
IV. Mutation: a random change in the chemical nature of the genetic material (DNA)
•
•
A. Mutagenic Agents -- increase the random incidence of mutations
1. Radiation
2. Chemicals --
** The adaptive value of a gene mutation is dependent upon the nature of the mutation and the type of environment with which the organism interacts.
** The environment interacts with genes in the development and expression of inherited traits.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
153

Name_____________________________Date ________________________________
1. Examples
• Many green plants contain chlorophyll for food making but if these leaves are
screened from the light they stop making chlorophyll.
• Identical twins raised in different environments may be vastly different in intelligence.
• If some white fur is shaved from a Himalayan rabbit and the area is kept cold with an ice pack, black fur will grow back in its place. (The gene for black fur is active only at very low temperatures.)
Image from: http://www.ekcsk12.org/science/regbio/rabbit.gif
** The principles of genetics appear to hold true for all organisms including humans.
The acquisition of knowledge of human genetics has been limited because humans are not suitable subjects for experimentation. An increased knowledge of human genetics has resulted from the expansion of the field of genetic counseling.
V. Types of Selective Breeding
A. Artificial Selection
--
B. Inbreeding
C. Hybridization
-- ex. English shorthorn cattle X Brahman cattle --->Santa Gertrudis cattle
(good beef X heat resistant -> good beef that is heat resistant )
D. Mutations may be preserved by vegetative propagation. (ex. seedless oranges)
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
154

Name_____________________________Date ________________________________
E. Recombinant DNA (genetic engineering) ---
VI. Changes in Chromosome Structure
A.
Translocation:
B.
Addition:
C.
Deletion:
D.
Inversion
Knowledge of genetics is making possible new fields of health care. Mapping of genetic instructions in cells makes it possible to detect, and perhaps correct, defective genes that may lead to poor health.
Substances from genetically engineered organisms may reduce the cost and side effects of replacing missing body chemicals.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
155

Name_____________________________Date ________________________________
Modern Genetics
New York State Education Department Living Environment Core Curriculum Performance
Indicators: 2.1 a-l
Upon completion of this unit the student will:
 recognize that DNA (deoxyribonucleic acid) controls cellular activity by influencing


 the production of enzymes. describe the structure of a nucleotide. describe the structure of the DNA molecule. explain what is meant by complementary base pairing.






 explain how DNA is able to replicate itself during mitosis and meiosis. correctly define the term template. explain the usefulness of the Watson-Crick model of DNA. define the term polymer and explain why DNA and RNA are polymers. describe the structure of RNA and list three ways it differs in structure from DNA. explain how proteins are synthesized from a DNA template. define the terms transcription and translation. explain the role of mRNA, rRNA, and tRNA in the process of protein synthesis.













 correctly define the terms triplet, codon, and anticodon. in a paragraph or two, explain how DNA, RNA, and proteins are able to determine the individuality of an organism. recognize that the work of a cell is carried out by the many different kinds of molecules it assembles (especially its proteins). recognize that proteins are long, folded molecules composed of up to 20 different kinds of amino acids which interact to produce specific protein shapes. recognize that enzymes and hormones are protein in nature. recognize that the specific shape of a protein usually determines its function. realize that offspring resemble their parents because they inherit similar genes that code for the production of proteins that form similar structures and perform similar functions. explain in a paragraph how cell functions are regulated. explain why the body cells of an organism can be very different from each other, even though they have the same genetic makeup. explain what is meant by cloning and list some uses of this. describe the process of genetic engineering and list five uses for this procedure. explain what restriction enzymes are and how they are used. recognize that inserting, deleting, or altering DNA segments can alter genes and that this alteration may be passed on to every cell that develops from the altered cell. explain what the genetic mapping is. explain what the human genome project is and some potential advantages/ disadvantages of this work.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
156

Name_____________________________Date ________________________________
Image from: http://www.csiro.au/helix/dna/
Image from: http://www.msu.edu/course/isb/202/ebertmay/notes/snotes/02_15_07_genes_evo2.html
Chromosomes found in the nucleus carry the hereditary material -- DNA
What is DNA ?____________________________________
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
157

Name_____________________________Date ________________________________
-
Structure of DNA Molecules
Image from: http://www.accessexcellence.com/RC/VL/GG/dna2.html
--DNA is a
--Nucleotide Unit is composed of
--The Nitrogenous Bases are:
A
T
C
G
What is a purine? …a pyrimidine?
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
158

Name_____________________________Date ________________________________
Therefore, show the resulting base pairings below!
ATGCGCCCTACGTTAAAGCTTACGGGGTACCTAAGCCCTATTGCAAT
A Better Look at the Structural Sub-Units
Image from: http://www.accessexcellence.com/RC/VL/GG/basePair2.html
History of the Molecule
--
--
** Consists of two chains of nucleotide units in a twisted ladder-like structure.
(resembles a spiral staircase)
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
159

Name_____________________________Date ________________________________
--
--
Adenine - Thymine (A-T) AND Guanine – Cytosine (G-C)
--This specific matching up of the nitrogenous bases is called complementary base pairing.
--
-- Only 2 combinations of base pairs can form the rungs of the DNA molecule.
DNA is able to _________________ itself.
How does DNA form duplicates of itself during mitosis and meiosis?
1.
2.
A view of DNA replication
Image from: http://www.accessexcellence.com/RC/VL/GG/dna_replicating.html
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
160

Name_____________________________Date ________________________________
Usefulness of the Watson-Crick Model
A.
B.
C.
1.
2.
3.
Rosalind Franklin James Watson and Francis Crick
Image from: http://physicsweb.org/articles/world/16/3/2/1/pwcrit1_03-03
Image from: http://www.achievement.org/achievers/wat0/large/wat0-001.jpg
RNA__________________________________
--
How does RNA differ in structure from DNA?
Types of RNA
1.
mRNA (messenger RNA)
2.
tRNA (transfer RNA)
3.
rRNA (ribosomal RNA)
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
161

Name_____________________________Date ________________________________
Image from: http://www.accessexcellence.com/RC/VL/GG/rna2.html
How are proteins synthesized from a DNA template?
1.
DNA serves as a template for the synthesis of mRNA from RNA nucleotides in the nucleus. transcription:
2. mRNA molecules carrying a specific code determined by the base sequence of the DNA template move from the nucleus to the cytoplasm.
2.
Strands of mRNA carrying codons transcribed from DNA, move to the ribosomes in the cytoplasm.
3.
codon: triplet:
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
162

Name_____________________________Date ________________________________
4. mRNA strands become associated with rRNA on the ribosomes. (rRNA
--
5. Different triplets of nitrogenous bases in tRNA molecules pick up specific amino acids in the cytoplasm and carry them to mRNA at the ribosomes. (tRNA -- I want aa.)
6. Amino acids are put into position on the ribosome with instructions from the triplet codes of tRNA and mRNA.
7. With the aid of enzymes and ATP (energy), the amino acids are bonded to form a polypeptide chain (protein) on the ribosome.
Image from: http://dwb.unl.edu/Teacher/NSF/C08/C08Links/gened.emc.maricopa.edu/Bio/BIO181/BIOBK/protein_synthesis.gif
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
163

Name_____________________________Date ________________________________
8. This protein formation is what directs metabolic activity in any cell.
** One gene codes for one polypeptide chain. gene =
** Since the sequence of nucleotides in DNA determines the sequence of nucleotides in messenger RNA, DNA ultimately determines the sequence of amino acids in specific proteins. The specificity of enzymes is dependent on their protein makeup, and, since the individuality of a cell is largely a function of the enzymes it possesses, it is evident that DNA determines the individuality and function of an organism.
The work of a cell is carried out by the many different kinds of molecules it assembles, mostly proteins. Proteins are long, folded molecules made up of up to 20 different kinds of amino acids which interact to produce specific protein shapes.
2.
The specific shape of the protein (exs. enzymes and hormones) determines the specific function of that protein.
Offspring resemble their parents because they inherit similar genes that code for the production of proteins that form similar structures and perform similar functions.
How are cell functions regulated?
1.
** All this gene regulation allows cells and organisms to respond to their environment and control their growth and division.
Body cells of an individual can be very different from each other, even though they have descended from a single cell (zygote) and have essentially the same genetic instructions. This is because different parts of these instructions are used in different types of cells, influenced by the cells environment and developmental history.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
164

Name_____________________________Date ________________________________
Genetic Research
** This technique shows great promise in agriculture. Plants with desirable qualities can be rapidly produced from the cells of a single plant. What are the drawbacks???
Drawbacks/disadvantages?
Image from: http://www.iss.k12.nc.us/schools/scavenger/tggenetics.html
Or, probably more importantly a new way to feed the world?????
Image from: http://megcooperation.gov.in/model-baproj/model%20scheme3/bt/ptc.ht2.gif
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
165

Name_____________________________Date ________________________________
Genetic engineering: ( )
--
--
** A cell can synthesize a new chemical coded for by its new gene(s)
-- examples include interferon, insulin, and growth hormone.
Genetic engineering can restriction enzymes –
Characteristics produced by the segments of DNA may be expressed when these segments are inserted into new organisms such as bacteria.
Inserting, deleting, or altering DNA segments can alter genes. An altered gene may be passed on to every cell that develops from it. human genome project ---
A down side to this is that health insurance agencies and other organizations may use this genetic information against individuals.
Substances from genetically engineered organisms may reduce the cost and side effects of replacing body chemicals. Human insulin produced in bacteria is already an example of this.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
166

Name_____________________________Date ________________________________
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
167

Name_____________________________Date ________________________________
Secret of Photo 51 Video Worksheet Living Environment: Comet
Directions: Answer the following questions as you view the Nova video entitled “Secret of Photo 51”. Ask your instructor to pause the program if you get terribly behind, but not after each question you might miss. You may also complete the photo quiz of this program at your instructor’s discretion.
10.
Who were the two leading DNA scientists in this field? [introduction of the video]
11.
What was Rosalind Franklin trying to do at the same time as Watson and Crick?
12.
What year did Watson and Crick receive the Nobel Prize?
13.
What is the title of James Watson’s book?
14.
Why wasn’t Franklin able to defend herself as portrayed in Watson’s book?
15.
What year and where was Rosalind Franklin born?
16.
What was the Franklin family “doing” as the Nazi party came to power?
17.
What school (college) did Rosalind Franklin attend?
18.
What is x-ray crystallography?
19.
What were Rosalind’s first experiments concerned with and how did they contribute to the war effort?
20.
Where did Rosalind work when she later moved to Paris and what did she perfect when she worked there?
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
168

Name_____________________________Date ________________________________
21.
What often forced Rosalind to suspend her work for weeks at a time?
22.
Where in England was Rosalind offered a position?
23.
What was her main assignment when Rosalind started there in 1951?
24.
Who was in charge of Rosalind in the lab?
25.
(BONUS): Where did the assistant (Mrs. Heller) graduate from in the letter Aaron
Klug speaks of?
26.
Who “enters the game” while setting up the lab at Kings?
27.
Where does Watson end up getting a position?
28.
Who was Watson’s office mate?
29.
What nickname was Rosalind given that Watson later “popularizes”?
30.
How many forms of DNA does Rosalind initially photograph?
31.
How do Watson and Crick propose to demonstrate DNA structure?
32.
Who do Watson and Crick “acquire” Franklin’s unpublished data?
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
169

Name_____________________________Date ________________________________
33.
What does Franklin finally name her best “B form” picture?
34.
What new nickname does she acquire after this?
35.
How many angstroms per “turn” is the DNA molecule?
36.
What is the name of the pub that Watson and Crick declare that they have found the
“secret of life” in?
37.
What was the general theme of her work after leaving King’s?
38.
What is she later diagnosed with and what is the probable cause?
39.
Social question: What is significant about Franklin’s upbringing and religion when she “started” her science career versus when she completed her science career?
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
170

Name_____________________________Date ________________________________
Comparison of a “Modern” View and Photo 51
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
171

Name_____________________________Date ________________________________
Video Guide: “Secret of Photo 51”
Living Environment: Comet
Directions: Watch for these faces as you view the Nova video entitled “Secret of Photo
51”. Make certain to pay attention to the video AND answer the questions. Ask your instructor to stop the video and review certain portions of the program so that you can fully understand the history behind the discovery of the DNA molecule.
“Secret of Photo 51”
Who am I?
What role do I play in this documentary? www.physics.ucla.edu/~cwp/dev/photopage1.1.html
Who am I?
What role do I play in this documentary? www.davidgalbraith.org/archives/cat_science.html
Who am I?
What role do I play in this documentary? http://osulibrary.orst.edu/specialcollections/coll/pauling/dna/pictures/portrait-crick.jpg/
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
172

Name_____________________________Date ________________________________
Who am I?
What role do I play in this documentary? http://nobelprize.org/medicine/laureates/1962/watson-bio.html
Who am I?
What role do I play in this documentary? http://www.nobel.se/chemistry/laureates/1982/klug-autobio.html
Who am I?
What role do I play in this documentary? http://nobelprize.org/medicine/laureates/1962/wilkins-bio.html
Using the list below, your lecture notes (also available from my website), and your workbook, make CERTAIN that you can do each of the following. You should have a general knowledge base that would allow you to answer questions on the following statements. Check off each statement/objective as you feel comfortable with it!
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
173

Name_____________________________Date ________________________________
Three Things I NEED to find out about during this review
3
2
1
OK?














Objective
Mendelian Genetics recognize that Mendel developed his laws of heredity without any prior knowledge concerning genes or chromosomes. list at least five reasons for Mendel's success working with pea plants. recognize that every organism has coded instructions for specifying its traits and that DNA provides a reliable way for transferring hereditary information from one generation to the next. recognize that each gene carries a separate piece of information. recognize that the inherited trait of an individual can be determined by one or by many genes, and that one gene can influence more than one cell. recognize that each human cell contains thousands of genes. correctly define the following terms; gene, allele, chromosome, locus, and homologous chromosomes. recognize that alleles are located on the same position on homologous chromosomes. recognize that in asexually reproducing organisms, all the genes come from a single parent and are identical to those of the parent. recognize that sexually reproducing organisms receive half their genetic information from their Mother's egg and half from their
Father's sperm. recognize that sexually reproduced offspring usually resemble, but are not identical to their parents. define the following terms and correctly use them in reference to genetic crosses; homozygous, heterozygous (hybrid), parental generation, first filial generation, and second filial generation. define the terms progeny and sibling. define the following terms and correctly use them in reference to genetic crosses; phenotype and genotype.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
174

Name_____________________________Date ________________________________



















 state Mendel's three Laws of Heredity and correctly explain each. list two examples of intermediate inheritance. list two examples of codominance. correctly complete genetic crosses/Punnett squares involving the
Law of Dominance, incomplete dominance, or codominance. define the term gene linkage and list an example of this in humans. define the term crossing over and explain how it leads to genetic variability in sexually produced offspring. explain what is meant by a karyotype and list some examples of its usefulness. explain how sex is determined in the genetic makeup of humans. explain why the male determines the sex of a human baby. define the term mutation. explain why only mutations in gametes may be passed on to the offspring. explain the difference between a chromosomal alteration and a gene mutation. define the following terms correctly; disjunction, nondisjunction, polyploidy, and mutagenic agent list some examples of mutagenic agents. recognize that the adaptive value of a gene mutation is dependent upon the nature of the mutation and the type of environment in which the organism interacts. list three examples of the interaction of the environment with genes in the expression of inherited traits. explain the difference between the following types of selective breeding; artificial selection, inbreeding, hybridization, vegetative propagation, and recombinant DNA technology. explain the difference between the following changes in chromosome structure; translocation, addition, deletion, and inversion. recognize that the mapping of the genetic instructions in cells makes it possible to detect, and perhaps correct, defective genes that lead to poor health. recognize that substances from genetically engineered organisms may reduce the costs and side effects of replacing costly body chemicals.






Modern Genetics recognize that DNA (deoxyribonucleic acid) controls cellular activity by influencing the production of enzymes. describe the structure of a nucleotide. describe the structure of the DNA molecule. explain what is meant by complementary base pairing. explain how DNA is able to replicate itself during mitosis and meiosis. correctly define the term template.
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
175

Name_____________________________Date ________________________________




















 explain the usefulness of the Watson-Crick model of DNA. define the term polymer and explain why DNA and RNA are polymers. describe the structure of RNA and list three ways it differs in structure from DNA. explain how proteins are synthesized from a DNA template. define the terms transcription and translation. explain the role of mRNA, rRNA, and tRNA in the process of protein synthesis. correctly define the terms triplet, codon, and anticodon. in a paragraph or two, explain how DNA, RNA, and proteins are able to determine the individuality of an organism recognize that the work of a cell is carried out by the many different kinds of molecules it assembles (especially its proteins). recognize that proteins are long, folded molecules composed of up to 20 different kinds of amino acids which interact to produce specific protein shapes. recognize that enzymes and hormones are protein in nature. recognize that the specific shape of a protein usually determines its function. realize that offspring resemble their parents because they inherit similar genes that code for the production of proteins that form similar structures and perform similar functions. explain in a paragraph how cell functions are regulated. explain why the body cells of an organism can be very different from each other, even though they have the same genetic makeup. explain what is meant by cloning and list some uses of this. describe the process of genetic engineering and list five uses for this procedure. explain what restriction enzymes are and how they are used. recognize that inserting, deleting, or altering DNA segments can alter genes and that this alteration may be passed on to every cell that develops from the altered cell explain what the genetic mapping is. explain what the human genome project is and some potential advantages/ disadvantages of this work.
Three things I learned during this review
©Mr. Comet’s Living Environment Lecture Outlines, 2007-2008, South Lewis High School, Turin, New York 13473.
Permission is granted for not-for-profit educational use by certified teachers.
176