HOW IS A DNA FINGERPRINT MADE?
DNA EXTRACTION
The biological tissues collected from the crime scene must be prepared for analysis. The first step
is to extract the DNA from the collected tissue sample. When you give the sample to the
technician, she will treat it with a series
1
of reagents that separate the DNA from
the other materials that make up the
cells in the tissue. DNA extracted from
animal and plant sources contains both
2
3
nuclear and mitochondrial DNA. DNA
from plant sources also contains
4
chloroplast DNA. The lab technician can
5
amplify each of these sources of DNA
using the polymerase chain reaction
(See Amplification below). The process
of DNA extraction consists of the
following steps:
• First the technician grinds up the
tissue in the sample to break open
the cells.
• Then she adds detergent to remove
the lipids that make up the
membranes of the cells.
6
• Finally, she adds a protease to
remove all of the proteins.
Alternatively, she may remove the
proteins by precipitating them.
• The DNA sample is now ready to be
amplified using the polymerase
chain reaction (PCR).
The DNA extraction is typically performed
in small reaction tubes like these.
(www.Carolina.com Assay for Antibiotic Resistance Kit).
AMPLIFICATION
Since you may only have a few hairs or buccal (cheek) cells, the total amount of DNA in the
sample you collected is very small. To get enough DNA for forensic analysis, the technician
1
amplifies the extracted DNA using the polymerase chain reaction (PCR). PCR enables the
technician to amplify selected parts of the genome in the hair cells. Usually, two or more short,
selected DNA segments from a mixture of many DNA molecules are rapidly replicated. The result
is millions or billions of copies of the selected DNA segments, which are typically no more than
about 10,000 base pairs in length. PCR is so powerful that selected segments of DNA can be
2
amplified from very minute starting amounts, even as little as 250 picograms of DNA. Because of
the ability to amplify even very minute quantities of DNA, PCR has revolutionized molecular
biology and many other fields such as forensic DNA analysis.
The short segment of extracted DNA that you want to amplify will serve as an initial template for
3
making the billions of copies. The technician combines the extracted DNA with two primers , a
4
5
heat-stable DNA polymerase (like Taq polymerase , and a supply of the four
6
deoxyribonucleotide triphosphates (A’s, T’s, C’s, and G’s). Two primers are used because a DNA
molecule consists of two complementary strands. One primer begins the DNA replication process
on one strand of the DNA at one end of the selected short segment of DNA. The other primer is
designed to begin replication at the opposite end of the selected segment on the complementary
strand of DNA, so both of the complementary strands of the selected region are copied
simultaneously. Since the primers only bind with sequences on the DNA that are complementary,
the segment of DNA between the locations where the two primers bind is selectively copied.
An important tool in the PCR process is the thermal cycler, or thermocycler (seen in the picture
below). The thermal cycler is a machine that heats and cools the PCR reaction tubes to the
precise temperature required for each of the three steps of the PCR reaction (See below). The
PCR reaction tubes containing the DNA samples, the primers, the Taq polymerase, and the four
deoxyribonucleotide triphosphates are placed in the thermal cycler and the machine alternately
raises and lowers the temperature in a series of discrete, pre-programmed steps.
A Thermal Cycler
(From http://en.wikipedia.org/wiki/Thermal_cycler)
The basic PCR cycle consists of three steps that take place inside the thermal cycler:
• Denaturation - The first step involves heating the extracted DNA sample to 94°C. This
causes the DNA double helix to separate into single-stranded molecules.
• Annealing (or Hybridization) - In the second step, the temperature is reduced to 68°C to
allow the primers to attach to the DNA from the sample.
•
DNA Synthesis (or Extension) - In the third step the temperature is raised again to the
optimal temperature for the Taq polymerase to synthesize DNA, usually about 72°C.
After one cycle of PCR, you will still have the original DNA segment and now you will also have
one copy. This three-step cycle may be repeated as many as 30 to 40 times. In each subsequent
cycle, both the original segment and the copies can act as templates to make new copies. The
result is an exponential (2  4  8  16  etc.) increase in the number of copies of the short,
selected segment of DNA. (See Figure below.) This is why PCR is referred to as a chain reaction.
The result is the amplification of a small segment of the sample DNA that was bordered on either
side by the two primers. The sample now contains billions of copies of this short sequence
selected by the primers. There is now enough DNA for separation using gel electrophoresis.
SEPARATION
An important group of techniques for separating molecules is gel electrophoresis. In
electrophoresis, an electric current is applied to a gel and the molecules of interest are separated
on the basis of their physical characteristics as they move through the gel. The characteristics
that influence the molecules’ movement include their size, shape and their electric charge.
As seen in the diagram below, the technician places solutions containing the molecules of interest
into small wells formed in a gel. The gel is usually made of agarose, a purified form of agar, the
gelatinous substance used as a medium to grow bacteria. The technician immerses the gel in a
buffer solution and applies an electric current across the gel. The electric current causes the
molecules to move at different rates through the gel based on their size. They may also move in
different directions depending on whether their net electric charge is positive or negative. For
example, proteins may have either a net positive or net negative charge. Since opposite charges
attract, positively charged proteins move toward the negative pole, and negatively charged
proteins move toward the positive pole. DNA molecules are always negatively charged, so they
are always attracted toward the positive pole.
Since all DNA molecules are negatively charged, the only factor that influences their rate of
movement through the gel is their size. The gel acts somewhat like a molecular strainer. Shorter
DNA molecules move through the gel more easily than longer DNA molecules. As a result, the
shorter molecules move further away from the negative side of the power source. (See the
diagram below.) The end result is the separation of the DNA molecules based on differences in
their lengths (the size of the molecules). After staining, each different length of DNA molecule
shows up as a band in the gel. The pattern of bands formed resembles a bar code that
characterizes the DNA from a given source. (See Figure, Next Page)
STAINING –
In order to see the bands formed by the different DNA molecules, the DNA must be stained.
Ethidium bromide is often used as a DNA stain. When exposed to ultraviolet light, ethidium
bromide will fluoresce with a red-orange color, intensifying almost 20-fold after binding to DNA.
ANALYSIS – THE DNA FINGERPRINT
The end product of all this manipulation of DNA from the samples collected at the crime scene is
a DNA fingerprint. Forensic scientists use a DNA fingerprint to identify suspects from hair, blood,
semen, and other biological materials found at the scene of a crime. This process depends on the
fact that no two people (except for maternal twins) have exactly the same DNA sequence.
Currently, forensic scientists use polymerase chain reaction (PCR) to amplify regions of the
1
genome called microsatellites or, more commonly, short tandem repeats (STRs). STRs are short
sequences of DNA, normally 2-5 base pairs long, that are repeated numerous times in a head-tail
manner. For example, one STR used in DNA fingerprinting is known as D5S818, which is found
on chromosome #5. It consists of the base sequence AGAT repeated multiple times. There are
2
15 observed alleles of D5S818 in the population. Twelve of these have the sequence AGAT
repeated anywhere from 7 times up to 18 times. Three additional alleles have the AGAT
sequence repeated 10, 11, or 12 times, but also have an additional 1 to 3 base pairs resulting
from partial repeats of the 4-base sequence. These alleles are named 10.1, 11.1, and 12.3.
As an example, consider allele #11. It has the sequence AGAT repeated exactly 11 times, so its
sequence is AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT. Each person in
the population has two D5S818 alleles. One resides on the chromosome #5 inherited from their
mother and the other resides on the chromosome #5 inherited from their father. Suppose a
person had inherited the D5S818 allele #11 (with 11 repeats) from one parent, and the D5S818
allele #13 (AGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAT) from
3
the other parent. Their genotype for the D5S818 locus is 11,13. If you amplify their D5S818
locus using PCR, separate the DNA using gel electrophoresis, then label it using Southern blot
and autoradiography, there will be 2 dark bands produced on the autoradiograph. One band
represents the allele with 11 repeats and the other band represents the allele with 13 repeats.
Since the allele with 11 repeats results in a shorter segment of DNA than the 13-repeat allele, the
11-repeat allele would travel further on the gel than the 13-repeat allele.
DNA fingerprinting cannot identify a single specific individual. It only narrows the field of suspects
to those individuals who have a particular STR genotype. However, DNA fingerprinting can
exclude a suspect with certainty. If your suspect’s DNA fingerprint shows a pattern of STR
genotypes not found at the crime scene, then you must exclude that suspect from consideration.
The frequency of the D5S818 genotype 11, 13 in the population is 0.13. So you can use this
particular two-band pattern produced by amplifying the D5S818 locus to distinguish one person’s
DNA from many other people. However, there are still many people with this same genotype
(13% of the population). By combining the results from several other STR loci along with D5S818
you can narrow the field further. In most cases, forensic scientists use 3 to 5 STR loci to match a
suspect’s DNA to a crime scene.
Although there are hundreds of STR loci in the human genome, forensic scientists use 13 specific
STR loci that are known to be highly variable. Since 1997, the Federal Bureau of Investigation
(FBI) has been compiling a national database, the Combined DNA Index System (CODIS), that
contains DNA profiles (using the 13 STR loci) from convicted offenders, unsolved crime scene
evidence, and missing persons. Since the frequencies of alleles at each of the 13 selected STR
loci are known, forensic scientists can calculate the probability of finding a positive match
between two samples of DNA when they test for any combination of the 13 STR loci. As
mentioned above, forensic scientists typically use 3 to 5 loci. If a match is obtained on 3, 4, or 5
loci, then the probability is very small that the DNA samples being compared came from different
sources. If any two samples have matching genotypes at all 13 CODIS loci, it is a virtual certainty
that the two DNA samples came from the same individual (or an identical twin).