Resource
CRISPR-Mediated Modular
RNA-Guided Regulation
of Transcription in Eukaryotes
Luke A. Gilbert,1,2,4,5 Matthew H. Larson,1,2,4,5 Leonardo Morsut,1,2 Zairan Liu,10 Gloria A. Brar,1,2,4,5 Sandra E. Torres,1,2,4,5
Noam Stern-Ginossar,1,2,4,5 Onn Brandman,1,2,4,5 Evan H. Whitehead,1,3,4 Jennifer A. Doudna,2,4,5,6,7,8,9
Wendell A. Lim,1,2,3,4 Jonathan S. Weissman,1,2,3,4,5,* and Lei S. Qi1,3,4
1Department
of Cellular and Molecular Pharmacology
Hughes Medical Institute
3UCSF Center for Systems and Synthetic Biology
University of California, San Francisco, San Francisco, CA 94158, USA
4California Institute for Quantitative Biomedical Research, San Francisco, CA 94158, USA
5Center for RNA Systems Biology
6Department of Molecular and Cellular Biology
7Department of Chemistry
8Department of Bioengineering
University of California, Berkeley, Berkeley, CA 94720, USA
9Physical Biosciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 94720, USA
10Peking University, Beijing China
*Correspondence: weissman@cmp.ucsf.edu
http://dx.doi.org/10.1016/j.cell.2013.06.044
2Howard
SUMMARY
The genetic interrogation and reprogramming of cells
requires methods for robust and precise targeting of
genes for expression or repression. The CRISPRassociated catalytically inactive dCas9 protein offers
a general platform for RNA-guided DNA targeting.
Here, we show that fusion of dCas9 to effector
domains with distinct regulatory functions enables
stable and efficient transcriptional repression or activation in human and yeast cells, with the site of delivery determined solely by a coexpressed short guide
(sg)RNA. Coupling of dCas9 to a transcriptional
repressor domain can robustly silence expression
of multiple endogenous genes. RNA-seq analysis
indicates that CRISPR interference (CRISPRi)-mediated transcriptional repression is highly specific.
Our results establish that the CRISPR system can
be used as a modular and flexible DNA-binding platform for the recruitment of proteins to a target DNA
sequence, revealing the potential of CRISPRi as a
general tool for the precise regulation of gene
expression in eukaryotic cells.
INTRODUCTION
Targeted gene regulation on a genome-wide scale is a powerful
approach for interrogating gene function and rewiring regulatory
networks. Naturally occurring and engineered DNA-binding proteins, such as the tetracycline repressor, Gal4, zinc fingers, or
442 Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc.
the TALE proteins, have been fused to transcription activators
and repressors to modulate gene expression (Cong et al.,
2012; Deuschle et al., 1995; Gossen and Bujard, 1992; Hathaway
et al., 2012; Maeder et al., 2013; Margolin et al., 1994; PerezPinera et al., 2013; Sadowski et al., 1988; Zhang et al., 2000).
However, due to either fixed DNA-sequence-binding requirements or their repetitive composition and size, it remains
time consuming and expensive to develop large-scale protein
libraries for genome interrogation (Joung and Sander, 2013).
Recently, several groups have shown that a modified type II
CRISPR (clustered regularly interspaced palindromic repeats)
system can be targeted to DNA using RNA, enabling genetic
editing of any region of the genome in a variety of organisms
(Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013; Gratz
et al., 2013; Hwang et al., 2013; Jiang et al., 2013; Jinek et al.,
2012, 2013; Mali et al., 2013; Wang et al., 2013). This single
RNA–single protein CRISPR system is derived from a natural
adaptive immune system in bacteria and archaea. Prokaryotes
have evolved diverse RNA-mediated systems that use short
CRISPR RNAs (crRNAs) and Cas (CRISPR-associated) proteins
to detect and defend against invading DNA elements (Bhaya
et al., 2011; Marraffini and Sontheimer, 2008, 2010; Wiedenheft
et al., 2012). In the type II CRISPR/Cas system, a ribonucleoprotein complex formed from a single protein (Cas9), a crRNA, and a
trans-acting crRNA (tracrRNA) can carry out efficient crRNAdirected recognition and site-specific cleavage of foreign DNA
(Deltcheva et al., 2011; Jinek et al., 2012). This system has
been further simplified with the development of a chimeric
single-guide RNA (sgRNA) and a Cas9 protein from the Streptococcus pyogenes CRISPR that, together, are sufficient for targeted DNA binding and cleavage with the cleavage site dictated
solely by complementarity to the sgRNA (Jinek et al., 2012). We
have shown recently in bacterial and human cells that the
endonuclease domains of the Cas9 protein can be mutated to
create a programmable RNA-dependent DNA-binding protein
(Qi et al., 2013). Targeting of catalytically inactive Cas9 protein
(dCas9) to the coding region of a gene can sterically block
RNA polymerase binding or elongation, leading to dramatic suppression of transcription in bacteria. By contrast, only a modest
block in transcription was seen in mammalian cells, thus limiting
the utility of the system as a tool for programmed knockdown of
genes.
Transcriptional regulation in eukaryotes is complex. Most
genes are controlled by the interplay of activating and repressive
transcription factors acting at DNA regulatory elements, which
can be spread across large regions of the genome (Conaway,
2012). Further regulation occurs through epigenetic modification
of histone acetylation and both histone and DNA methylation.
Globally deciphering the mechanisms for establishing and
maintaining these signals, as well as the functional impact of
such modifications, has been hampered by a lack of tools for targeting transcription and epigenetic regulators to specific DNA
sequences. Here, we show that dCas9 can be used as a modular
RNA-guided platform to recruit different protein effectors to DNA
in a highly specific manner in human cells and the budding yeast
Saccharomyces cerevisiae (S. cerevisiae). We show that both
repressive and activating effectors can be fused to dCas9 to
repress or activate reporter gene expression, respectively. We
also show CRISPRi can be used for multiplexed control of
endogenous genes. Using a dCas9 fusion protein, we further
show that the system can be used to stably repress genes with
comparable gene silencing efficiency typically achieved by
RNA interference (RNAi) while minimally impacting transcription
of nontargeted genes.
RESULTS
dCas9 Fusion Proteins Can Efficiently Activate or
Silence Transcription
We have shown recently that CRISPRi can decrease gene
expression in human cells (Qi et al., 2013). In that initial study,
the degree of repression achieved by CRISPRi was modest
(2-fold). To improve the efficacy of CRISPRi in human cells,
we examined whether dCas9 could be fused to protein domains
that are known to recruit repressive chromatin-modifying complexes to improve transcriptional silencing (Figure 1A). We
created a gene encoding a human codon-optimized dCas9
from S. pyogenes fused to two copies of a nuclear localization
sequence (NLS), an HA tag, and blue fluorescent protein (BFP).
We further fused this modified dCas9 gene with different repressive chromatin modifier domains, including the KRAB (Krüppelassociated box) domain of Kox1 (Figure 1B), the CS (chromo
shadow) domain of HP1a, or the WRPW domain of Hes1 (Fisher
et al., 1996; Hathaway et al., 2012; Margolin et al., 1994). The
sgRNAs were expressed from a murine RNA polymerase III U6
promoter (Figure 1B). To test whether dCas9 can recruit chromatin-modifying complexes to silence transcription, dCas9 or
each dCas9 repressor fusion protein was cotransfected into
GFP+ HEK293 reporter cells (in which an SV40-promoter-driven
GFP reporter gene is randomly genomically integrated) with
an sgRNA targeting GFP. We found that cells expressing the
dCas9-KRAB fusion protein show a 5-fold decrease in GFP
signal, whereas cells expressing dCas9 alone, dCas9-CS, or
dCas9-WRPW show a 2-fold decrease in GFP signal, suggesting
that the dCas9-KRAB fusion protein might recruit chromatinmodifying complexes to increase the potency of CRISPRi
silencing.
To improve the utility of CRISPRi, we tested whether stable
dCas9 or dCas9-KRAB expression could effectively silence
gene expression. We cloned dCas9 and dCas9-KRAB into a
minimal lentiviral construct under the control of the spleen
focus-forming virus promoter (SFFV) (Figure 1B). We generated
lentivirus, infected GFP+ HEK293 cells, and isolated the cell
subpopulations expressing dCas9 or dCas9-KRAB by flow cytometry sorting. After 1 week of growth, we transfected sgRNAs
targeting GFP and measured the level of GFP expressed 3 and
6 days following transfection. We found that stable dCas9KRAB expression is sufficient to silence GFP with substantial
knockdown 3 days following transfection (Figures S1A and
S1B available online) and strong silencing 6 days following transfection (Figure 1C). We observed that six out of eight sgRNAs targeting GFP knocked down GFP expression by at least 75%, with
15-fold repression for the best sgRNA (NT1) (Table S1). Our
results also revealed a linear relationship between the level of
expression from the sgRNA vector and the level of GFP remaining within a cell (Figure S2A). As a further technical refinement to
CRISPRi, we also tested whether we could stably express the
sgRNA with a lentivirus, as this allows for stable long-term
gene silencing. We transduced GFP+ HEK293 cells that stably
express dCas9 or dCas9-KRAB proteins with a lentivirus to
stably express an sgRNA targeting GFP or a negative control
sgRNA. We then measured GFP expression 14 days following
viral infection. We found that we can robustly silence GFP
expression in HEK293 cells when both the RNA and protein components of CRISPRi are stably expressed in human cells (Figure 1D). We sequenced the GFP reporter locus in these cells to
confirm that dCas9 is completely nucleolytically inactive. Here,
GFP retained a wild-type sequence with no detectable indels
in GFP knockdown cells. In the 5% of cells that still express
some GFP, it is unclear why CRISPRi does not suppress transcription. These cells may express low levels of the sgGFP
RNA or may represent specific retroviral integration sites that
are refractory to silencing.
We reasoned that the CRISPRi platform provides a modular
protein effector recruitment system that could also be used
for gene activation when coupled with transcription activators.
To test whether we can activate gene expression in human
cells with dCas9, we fused four copies of the well-characterized
transcription activator VP16 or a single copy of p65 activation
domain (AD) to dCas9. We cotransfected dCas9-VP64 or
dCas9-p65AD and an sgRNA construct that targets the
Gal4 UAS (upstream activation sequence) into a HEK293 reporter cell line expressing a Gal4 UAS-GFP reporter (Figure 1E,
left). Two days following transfection, we measured the
levels of GFP expressed by flow cytometry. Our results revealed
that both dCas9-VP64 and dCas9-p65AD can effectively
activate reporter gene expression, suggesting that dCas9 can
serve as a generic and modular platform for different types of
Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc. 443
A A modular RNA-guided genome regulation platform
B pSFFV
NLSX2
dcas9 BFP
Transcription repressor
Effector
Transcription activator
dCas9
pSFFV
NLSX2
dcas9 BFP KRAB
sgRNA
Target gene
DNA targeting
NT1
SV40 +1
promoter
EGFP
+100
T1
+200
D
+800
+300
HEK293 (- EGFP)
T strand
GFP+ HEK293, dCas9-KRAB + Neg. control sgRNA
T3
GFP+ HEK293, dCas9 + sgGFP-NT1
dCas9-KRAB fusion protein
GFP+ HEK293, dCas9-KRAB + sgGFP-NT1
15-fold repression
1.0
300
15-fold
repression
Counts
0.8
0.6
0.4
150
0.2
0
0
-
Neg. NT1 NT2 NT3 NT4 NT5 T1
T2
0
T3
1
10
sgRNA
mCMV
GAL4 UAS x4
GFP
Target
Fluorescence (a.u., Log10)
dCas9-VP64 fusion
NLSx2
dcas9
VP64 BFP dCas9-VP64
or p65AD
sgRNA
25-fold activation
3
2
-
+
+
+
+
Neg. sgRNA -
-
+
-
+
dCas9-VP64
sgGAL4-1
sgGAL4-1: 3 targetable sites
3
10
10
Fluorescence (a.u.)
pLTR
pU6
2
10
+sgRNA
E
sgRNA
NT strand
EGFP
T2
dCas9
Relative expression
sgRNA
NT5
NT3 NT4
dCas9-KRAB
pU6
Regulation
NT2
UTR
Human genome
dCas9-p65AD fusion
Fluorescence (a.u., Log10)
C
dCas9
12-fold activation
3
2
-
+
sgGAL4-1
Figure 1. A Modular CRISPR Fusion System for Efficiently Repressing and Activating Transcription in Human Cells
(A) dCas9 fused to effector domains can serve as an RNA-guided DNA-binding protein to target any protein to any DNA sequence.
(B) A minimal CRISPRi system in human cells contains an sgRNA expression plasmid and dCas9 or dCas9 fused to the repressive KRAB effector domain. Both
dCas9 constructs are fused to two copies of a nuclear localization sequence and a blue fluorescent protein.
(C) A dCas9-KRAB fusion protein efficiently silences GFP expression. Eight sgRNAs targeting GFP are transfected into GFP+HEK293 stably expressing either
dCas9 (light gray) or dCas9-KRAB (dark gray). GFP fluorescence is quantified by flow cytometry 6 days following transfection and is displayed as a signal
normalized to a vector control. The data are displayed as mean ± SD for three independent experiments. See also Figure S1.
(D) CRISPRi gene repression is stable over time. GFP+HEK293 cells were infected with lentivirus constructs expressing a negative control sgRNA or a sgRNA
targeting GFP and either dCas9 or dCas9-KRAB. Cells were grown for 14 days and then analyzed for GFP expression. A histogram displays GFP fluorescence for
each sample and a control population of HEK293 cells that do not express GFP. Data are representative of three independent experiments.
(E) Two dCas9 fusion proteins were constructed with VP64 or p65AD. The sgRNA is expressed as before. Shown is a diagram of the Gal4 UAS-GFP reporter and
data showing transient transfection of either dCas9-VP64 or dCas9-p65AD and sgGAL4-1 can activate gene expression in HEK293 cells. Cells were transfected
with the indicated plasmids and 48 hr later were analyzed by flow cytometry for GFP expression. The data are displayed as mean ± SD for two independent
experiments. See also Figure S2.
transcriptional control, including both repression and activation (Figure 1E). Interestingly, we observed varying amounts of
activation with different fusion protein designs using VP64
444 Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc.
(Figure S2B), arguing that the design of the fusion protein or
fusion partner is an important parameter for future optimization
efforts.
A
we observed few changes in gene expression in the negative
control sample, suggesting that the negative control sgRNA triggers minimal off-target effects (Figures 2 and S3A). We also
found no evidence for significant on- or off-target effects due
to expression of either sgGAL4-4 or sgGFP-NT1 alone (Figure S3B). Finally, expression of dCas9-KRAB resulted in minimal
changes in gene expression (Figure S3C).
12
Activation
dCas9-KRAB + sgGFP-NT1
(RPKM Log2)
10
8
6
GFP
4
2
0
Repression
-2
Gene counts
B
-2
0
2
4
6
8
10
12
dCas9-KRAB + Neg. control sgRNA
(RPKM Log2)
1000
GFP
500
0
0.1
1
Fold change of RPKM (Log10)
Figure 2. CRISPRi Is Highly Specific in Human Cells
(A) RNA-sequencing RPKM (reads per kilo base per million) are plotted for
GFP+ HEK293 cells stably expressing dCas9-KRAB and either a negative
control sgRNA targeting Gal4 or an sgRNA targeting GFP. Total RNA was
collected 15 days following lentiviral transduction. The data are representative
of two independent biological replicates. See also Figure S3.
(B) A histogram showing the fold changes in gene expression from (A) plotting
dCas9-KRAB/sgGFP-NT1 over dCas9-KRAB/Neg. Control sgRNA. GFP is
indicated with an arrow. The data are representative of two independent
biological replicates. See also Figure S3.
CRISPRi-Mediated Gene Knockdown Is Highly Specific
to the Target Gene
To test the specificity of CRISPRi in human cells, we used RNA
sequencing (RNA-seq) to quantify the transcriptome of GFP+
HEK293 cells expressing dCas9-KRAB and either a negative
control sgRNA (sgGAL4-4) or an sgRNA targeting GFP
(sgGFP-NT1). Our results show that CRISPRi is highly specific,
as GFP is the only gene product that is significantly suppressed
by the GFP-targeting sgRNA (Figures 2 and S3A). If we average
the data from two independent biological replicates, no gene
other than GFP changes by more than 1.5-fold. For the few
genes for which we measured changes in expression, we find
no evidence for the presence of a near match to the sgRNA
seed sequence, suggesting that the changes observed are due
to a small level of noise in RNA-seq measurements. Furthermore,
CRISPRi Can Silence Endogenous Human Genes
As there can be important differences in how endogenous and
reporter genes are transcribed, we tested whether CRISPRi
can silence endogenous human genes. We designed sgRNAs
to target genes encoding cell surface transmembrane proteins,
enabling us to use flow cytometry with directly conjugated fluorescent antibodies to quantify gene expression at the single-cell
level. We cloned ten sgRNAs each for the transferrin receptor
(CD71) and C-X-C chemokine receptor type 4 (CXCR4), which
were designed to span a 500 bp region upstream or downstream
of the transcription start site, targeting either template or nontemplate strands (Table S1). Each sgRNA was transfected into
HeLa cells stably expressing dCas9 or dCas9-KRAB. Cells
were dissociated and stained for CD71 and CXCR4 expression
3 days after transfection. In this experiment, we found that
both dCas9 and dCas9-KRAB proteins can knock down endogenous expression of CD71 and CXCR4 (Figures 3A and 3B), with
three out of ten sgRNAs for each gene showing significant
repression (60%–80% repression). Interestingly, a strong correlation exists between the degree of knockdown for dCas9 and
dCas9-KRAB for endogenous genes, suggesting that sgRNA
binding to DNA or local chromatin structure may be limiting factors that dictate gene knockdown (Figure S4A). Further work is
required to systematically analyze why recruitment of a KRAB
domain has an effect in some contexts but not others.
We also tested whether stable lentivirus-mediated expression
of both the sgRNA and dCas9 or dCas9-KRAB could repress
endogenous gene expression. We transduced HeLa cells expressing dCas9 or dCas9-KRAB with three sgRNAs targeting
CD71 or CXCR4 and 7 or 8 days later measured the amount of
CD71 or CXCR4 expressed. Our data show that CD71 and
CXCR4 can be efficiently and stably knocked down (Figures
3C and 3D), providing evidence that CRISPRi can be used like
RNAi to suppress endogenous gene expression.
A valuable extension of CRISPRi is the capability for multiplexed gene regulation in human cells. To test whether we can
suppress the expression of multiple genes, we transfected
sgRNAs targeting CD71, CXCR4, or both into HeLa cells
stably expressing dCas9-KRAB. Cells were dissociated and
stained for CD71 and CXCR4 expression 5 days after transfection. In this experiment, we found that we can simultaneously
knock down endogenous expression of CD71 and CXCR4 (Figure 3E). This result was independently confirmed by qPCR
(Figure S4B).
CRISPRi Is a General Method for Silencing Transcription
of Endogenous Genes in Eukaryotes
To test whether CRISPRi can be used for transcription repression in other eukaryotes, we examined whether dCas9, alone
or fused to a transcriptional repressor, will effectively silence
Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc. 445
A
B
CD71-1
CD71
Exon
CXCR4
NT strand
Intron
UTR
CXCR4-1
NT strand
UTR
Intron
Figure 3. CRISPRi Can Stably Suppress
Expression of Endogenous Eukaryotic
Genes
(A) A diagram of sgRNA-binding sites for CD71 and
a
graph displaying suppression of CD71 by dCas9
CD71-2 CD71-3
or dCas9-KRAB in HeLa cells. Cells stably expressing dCas9 or dCas9-KRAB were transfected
dCas9
dCas9
dCas9-KRAB
dCas9-KRAB
with sgRNAs targeting CD71. After 72 hr, cells
CD71 Transient
CXCR4 Transient
were harvested and analyzed by flow cytometry
1.2
1.2
1.0
for CD71 protein expression. The data are dis1.0
0.8
0.8
played as mean ± SD for two independent exper0.6
0.6
iments. See also Figure S4A.
0.4
0.4
(B) A diagram of sgRNA-binding sites for CXCR4
0.2
0.2
and a graph displaying suppression of CXCR4 by
0
0
dCas9 or dCas9-KRAB in HeLa cells. Cells stably
Neg.
sgCXCR4-1 sgCXCR4-2 sgCXCR4-3
Neg. sgCD71-1 sgCD71-2 sgCD71-3
expressing dCas9 or dCas9-KRAB were transfected with sgRNAs targeting CXCR4. After 72 hr,
C
D
cells were harvested and analyzed by flow cydCas9
dCas9
dCas9-KRAB
dCas9-KRAB
tometry for CXCR4 protein expression. The data
CD71 Lentiviral
CXCR4 Lentiviral
1.2
are displayed as mean ± SD for two independent
1.0
1.0
experiments. See also Figure S4A.
0.8
0.8
(C) Stable suppression of CD71 by dCas9 or
0.6
0.6
dCas9-KRAB in HeLa cells. Cells stably express0.4
ing dCas9 or dCas9-KRAB were transduced with
0.4
sgRNAs targeting CD71. After 7 days, cells were
0.2
0.2
harvested and analyzed by flow cytometry for
0
0
Neg. sgCD71-1 sgCD71-2 sgCD71-3
Neg.
sgCXCR4-1 sgCXCR4-2 sgCXCR4-3
CD71 protein expression. The data are displayed
as mean ± SD for two independent experiments.
E
F
(D) Stable suppression of CXCR4 by dCas9 or
CXCR4 expression
Targeting endogenous TEF1 in S. cerevisiae
CD71 expression
dCas9-KRAB in HeLa cells. Cells stably express53
fold
repression
10000
Double knockdown
ing dCas9 or dCas9-KRAB were transduced with
1.0
sgRNAs targeting CXCR4. After 8 days, cells were
0.8
- dCas9
harvested and analyzed by flow cytometry for
0.6
CXCR4 protein expression. The data are displayed
1000
+ dCas9
as mean ± SD for two independent experiments.
0.4
(E) Double knockdown of both CD71 and CXCR4
0.2
+ dCas9-Mxi1
using sgRNAs targeting CD71 and CXCR4 in HeLa
0
cells that stably express dCas9-KRAB. Cells were
+
+
sgCD71-2
100
dissociated and stained for CD71 and CXCR4
+
sgCXCR4-2
+
+ sgTEF
expression 5 days after transfection. The data are
displayed as mean ± SD for two independent experiments. See also Figure S4B.
(F) Robust repression of endogenous genes in yeast. A bar graph shows fluorescence intensity of a strain expressing TEF1-GFP transformed with the indicated
sgRNA and dCas9 or dCas9-Mxi1. The two dotted lines indicate fluorescent signals from untagged yeast cells that do not express GFP or TEF1-GFP yeast cells
without dCas9. The data are displayed as mean ± SD for three independent experiments. See also Figure S4C.
+1
+100
+200
+300
T strand
T strand
Relative expression
Relative expression
CXCR4-3
Fluorescence (a.u.)
Relative expression
Relative expression
CXCR4-2
Relative expression
+200
+100
+1
gene expression in S. cerevisiae. We cloned dCas9 with two
NLSs into a vector under control of the TDH3 promoter (Figure S4C). Using this same scheme, we also fused dCas9 to
Mxi1, a mammalian transcriptional repressor domain that is reported to interact with the histone deacetylase Sin3 homolog
in yeast (Figure S4C) (Harper et al., 1996; Kasten et al., 1996;
Schreiber-Agus et al., 1995). Both dCas9 fusion proteins were
transformed into a strain carrying a TEF1-GFP fusion expressed
from the endogenous locus (Huh et al., 2003). We expressed an
sgRNA that targets the endogenous TEF1 locus under control of
the Pol III SNR52 promoter (Figure S4C) (DiCarlo et al., 2013).
With dCas9 alone, we observed 18-fold repression, which is
increased to 53-fold with addition of the Mxi1 domain (Figure 3F).
As CRISPRi shows robust endogenous gene silencing in yeast, it
could also prove a useful tool for studying organisms with limited
genetic tools, such as the pathogenic yeast Candida albicans.
We found that both the Mxi1 and KRAB domains strongly suppress transcription when targeted to some regions of DNA, but
446 Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc.
not to others. Additionally, some genes may require recruitment
of repressive complexes other than Kap1/HP1 or Sin3. Ongoing
work will define what regions of a gene are most effective for
dCas9-fusion-mediated gene silencing. However, the remarkable success in using RNA-guided Cas9 to enable DNA cutting
for many genes in distinct organisms argues that Cas9 can
bind to target DNA sites in a broad range of genes or regulatory
regions (Cho et al., 2013; Cong et al., 2013; DiCarlo et al., 2013;
Gratz et al., 2013; Hwang et al., 2013; Jiang et al., 2013; Jinek
et al., 2012, 2013; Mali et al., 2013; Wang et al., 2013). Taken
together with the present study, these findings suggest that
CRISPRi will be a general method for efficiently and specifically
regulating transcription in many eukaryotes.
CRISPRi as a Tool for Mapping and Perturbing
Regulatory Elements
A method for functionally mapping DNA regulatory elements
such as enhancers in a high-throughput manner does not
A
AP1 enhancer
Figure 4. CRISPRi Can Suppress Gene
Expression from the Promoter of a Gene
SP1 enhancer
SV40 promoter
P1
P4 P5
+1
Non-template strand
UTR EGFP
-200
-100
P2 P3
P6
Relative expression
Relative expression
AP1 enhancer targeting
1.0
0.8
0.6
0.4
0.2
0
Template strand
SP1 enhancer targeting
+ dCas9
-
Neg. P1
P2
P3
P4
1.0
0.8
0.6
0.4
0.2
0
P5
P6
(A) A dCas9-KRAB fusion protein efficiently
silences GFP expression when targeted to the
SV40 promoter of an SV40-GFP reporter. Six
sgRNAs targeting different regions of the SV40
promoter as indicated are transfected into
GFP+HEK293 cells stably expressing either dCas9
(top) or dCas9-KRAB (bottom). GFP fluorescence
is quantified by flow cytometry 6 days following
transfection and is displayed as a signal normalized to a vector control. The data are displayed as
mean ± SD for three independent experiments.
(B) The dCas9 construct and an sgRNA (sgTET)
construct were cotransformed into a yeast strain
expressing a TetON-Venus reporter and the rtTA
protein. Doxycycline was added to cells expressing rtTA alone or rtTA, dCas9, and sgTET. The data
are displayed as mean ± SD for three independent
experiments.
had little effect on transcription (Baty
et al., 1984; Benoist and Chambon,
1981). Interestingly, we also observed
that blocking the AP1 enhancer caused
a stronger silencing effect than blocking
- Neg. P1 P2 P3 P4 P5 P6
the SP1 enhancer within the SV40 proB
moter (Figure 4A), implying that CRISPRi
115 fold repression
can be used as a tool for perturbing and
VP16
mapping regulatory functions of DNA
dCas9-sgRNA
10000
rtTA
elements.
We next examined whether CRISPRi
TetR
could block a transcription factor
1000
from binding to enhancer sites in
S. cerevisiae. Plasmids expressing the
dCas9 protein and an sgRNA (sgTET)
pTET07
Dox
were cotransformed into a strain expressBasal
100
Venus
tetO sites
ing the rtTA protein and a TetON-Venus
(-Venus)
rtTA
+
+
reporter in which the addition of doxycyS. cerevisiae
dCas9&
cline leads to expression of Venus. We
+
added doxycycline to strains expressing
sgTET
rtTA alone or rtTA, dCas9, and sgTET
(which targets dCas9 to the rTA-binding
currently exist. We reasoned that, if CRISPRi was effective when site). Without dCas9, rtTA strongly activated the reporter, but
targeted to promoters or introns, we could map enhancer ele- this induction can be effectively blocked by dCas9 (115-fold
ments. We tested whether we could silence gene expression repression, Figure 4B). This suggests that dCas9 can sterically
by targeting dCas9 or dCas9-KRAB fusion protein to cis-acting compete with transcription factors that have tight binding affinity
proximal elements within the SV40 early promoter of our GFP re- for DNA elements, further implying that CRISPRi can be used to
porter (Table S1). We found that, although dCas9 alone had no perturb and map the regulatory roles of distal and proximal
effect on transcription, we efficiently repressed GFP expression enhancers.
with dCas9-KRAB (Figure 4A). This suggests that, although
dCas9 may not be able to directly block the initiation of transcrip- DISCUSSION
tion, dCas9 fusion proteins can silence proximal regulatory
elements within a promoter by recruiting chromatin modifiers. dCas9 Provides a General Platform for Targeting
Previous studies have shown that the AP1 enhancer (for AP-1 Proteins to DNA
transcription factor binding) is a more important DNA motif for Systematic characterization of gene function depends on the
SV40 promoter activity as compared to the SP1 enhancer (for ability to manipulate genes through deletion, suppression, or
SP-1 transcription factor binding), as SP1 enhancer deletion overexpression. Here, we have developed a modular method
Fluorescence (a.u.)
+ dCas9-KRAB
Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc. 447
using a modified type II CRISPR system to target effector
domains to specific genomic loci. We have shown that programmable dCas9 can repress or activate transcription in human
cells. dCas9 fusion proteins can functionally mimic multiple
native protein interactions, including the KRAB domain of
Kox1, VP16, and p65AD (Groner et al., 2010). Our data demonstrate how dCas9 can be used to target a protein to a specific
region of DNA. The modularity of the dCas9 system provides a
new approach for studying transcription, epigenetic regulation,
and both DNA replication and repair.
The simple constitutive dCas9 system can be coupled to more
complex inducible systems for precise temporal and spatial control, enabling refined analysis of chromatin remodeling processes during cell development and differentiation. For example,
dCas9 could be used with existing optogenetic or chemicalinduced proximity systems to dynamically analyze recruitment
of a broad range of chromatin modifiers to a specific DNA
sequence (Hathaway et al., 2012; Levskaya et al., 2009). Targeting dCas9 fusions to distinct chromatin microenvironments
could elucidate how distinct chromatin-remodeling complexes
propagate the spreading or insulation of repressive chromatin
marks along a chromosome. Using multiple sgRNAs, one can
titer how many chromatin-modifying complexes are recruited
to a gene to interrogate how the local concentration of any chromatin-modifying complex modulates chromatin structure and
transcription. dCas9 could also be used to recruit or tether a
specific genomic locus to a subnuclear localization such as the
nuclear pore, nucleolus, or nuclear membrane. This system
may enable spatial manipulation of DNA and chromatin, allowing
the study of chromatin and transcription in qualitatively new
ways that, to date, have largely involved retrospective association studies or broad loss-of-function genetics.
At present, all mammalian work on Cas9 has focused on the
protein from a single species (S. pyogenes), and there is a
huge amount of biological diversity that remains untapped (Chylinski et al., 2013; Zhang et al., 2013). It is likely that the current
Cas9 is not optimal. Additionally, many of the different Cas9
species use distinct sequences to recognize the guide RNA.
Thus, two or more sgRNA variants can be expressed in the
same cell, and each will bind exclusively to its cognate dCas9
species. This will allow for orthogonal targeting of multiple
independent sites within a genome, enabling the independent
delivery of distinct effector domains and combinatorial manipulation of chromatin structure and epigenetic marks.
Mapping the Function of Enhancers and Chromosome
Topology with dCas9
Our results provide evidence that dCas9 can target enhancers,
introns, and other noncoding elements to map the regulatory
functions of these elements on transcription. This could enable
sophisticated high-throughput mapping of enhancers at endogenous loci. In theory, using inducible dimerization systems,
dCas9 could tether a distant enhancer close to the promoter
of a gene to interrogate how chromosome conformation regulates transcription. Recent work has shown that, during neural
differentiation, CCCTC binding factor, cohesion, and the mediator complex modulate chromosome topology to control development (Millau and Gaudreau, 2011; Phillips-Cremins et al.,
448 Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc.
2013). dCas9 could enable studying these processes in a
much more dynamic and programmable manner by artificially
creating different genomic conformations and measuring how
these modulate transcription and development.
CRISPRi Efficiently and Specifically Represses
Transcription in Human Cells
In our experiments, we observed robust gene knockdown of
both reporter and endogenous genes (5- to 15-fold repression
in human and 50-fold in yeast). Our method uses common lentiviral constructs to express both dCas9 and sgRNAs to achieve
stable long-term gene knockdown. This is comparable to the
efficiency of existing gene knockdown techniques such as
RNAi and TALE proteins. Although we do not yet know what fraction of genes can be silenced by a dCas9 fusion protein, a significant portion of the genome should be targetable. In human cells,
previous work has demonstrated that local chromatin context is
a crucial determinant of KRAB-mediated silencing. For example,
recruitment of the KRAB domain to adjacent genomic regions
can have no effect or can completely silence transcription
(Groner et al., 2010). The biology underlying this observation remains to be characterized, and CRISPRi could provide a tool to
map chromatin structure and the function of chromatin-remodeling complexes. Nonetheless, an exon-trapping strategy in which
Tet-binding sites were randomly inserted in the genome allowing
recruitment of a tetracycline repressor-KRAB fusion protein revealed that 80% of genes tested can be silenced by KRABmediated recruitment of Kap1 and HP1 proteins (Groner et al.,
2010). Ongoing work will characterize additional fusion partners
to understand which transcription repressor complexes are most
useful for CRISPRi in different cell types.
Our RNA-seq results show that CRISPRi is highly specific, with
minimal off-target effects for two distinct sgRNA sequences.
By contrast, genome editing by the catalytically active Cas9
nuclease can be accompanied by off-target genomic alterations
that occur at loci where near-cognate DNA seed matches exist
(Fu et al., 2013). The specificity of CRISPRi remains to be determined across a broad range of sgRNA sequences. Nonetheless,
it may be substantially easier to specifically modulate transcription, as only a small fraction of the human genome is transcribed
or required for controlling transcription; thus, binding of catalytically inactive dCas9 or dCas9 fusion proteins at near-cognate
sites will often not impact transcription.
Future Optimization for CRISPRi Technology
The observation that the sgRNA is a limiting factor for CRISPRi
function suggests that improvements to RNA stability or loading
into dCas9 could improve both CRISPRi- and Cas9-mediated
genome editing in human cells (Jinek et al., 2013). Although we
are able to target dCas9 to both endogenous and reporter genes,
not all sgRNA-targeting constructs work efficiently. Specific
sgRNA sequence composition may improve sgRNA stability,
loading into dCas9, or binding to DNA. Alternately, dCas9 binding may be strongly dictated by the local chromatin structure of
the target sequence. The recently published genome-wide maps
of chromatin structure can inform where one targets dCas9 for
both transcription repression and activation (Thurman et al.,
2012). High-throughput analysis of sgRNAs that are functional
will discriminate between sequence requirements and local
chromatin states to determine rules for dCas9 targeting and
function. Although the experiments described here have examined a set of fusion partners and fusion design strategies, future
work will be required to refine and improve CRISPRi fusion proteins with different effectors for optimal performance. Finally, as
additional Cas9 proteins are characterized, the use of parallel
orthogonal dCas9 proteins with cognate sgRNAs will enable
controlling multiple genes differentially (Chylinski et al., 2013;
Zhang et al., 2013).
CRISPRi Provides an Alternative Strategy to RNAi for
Gene Regulation
Our data here describe a dramatic improvement from our previously published work on CRISPRi in human cells and argue that
CRISPRi represents an alternate strategy to RNAi for repressing
gene expression in mammalian cells. RNAi is a transformative
technique for studying mammalian biology, and more than a
decade of effort has led to sophisticated vectors, algorithms,
and libraries for knocking down genes in human and mouse cells
(Chang et al., 2006; Fellmann et al., 2011). Genome-wide shRNA
libraries enable high-throughput interrogation of gene function
and genetic networks in human cells (Bassik et al., 2013). It
should be possible to develop pooled sgRNA libraries that will
allow CRISPRi to be used in an analogous manner to pooled
genome-wide shRNA libraries.
We believe that, in many applications, RNAi and CRISPRi
could be complementary methods, with CRISPRi providing a
number of potential advantages. As an exogenous system,
CRISPRi does not compete with endogenous machinery such
as microRNA expression or function. Furthermore, because
CRISPRi acts at the DNA level, one can target transcripts
such as noncoding RNAs, microRNAs, antisense transcripts,
nuclear-localized RNAs, and polymerase III transcripts. Finally,
CRISPRi possesses a much larger targetable sequence space,
as we show that promoters and, in theory, introns can also be
targeted.
EXPERIMENTAL PROCEDURES
RNA Sequencing
Total RNA was purified from the cells using Trizol (Invitrogen). 150 mg of total
RNA was mixed with oligo (dT)25 Dynabeads, and mRNA was purified according to the manufacturers protocol (Invitrogen). 1 mg mRNA was resuspended in
20 ml of 10 mM Tris (pH 7) mixed with an equal volume of 23 alkaline fragmentation solution (2 mM EDTA, 10 mM Na2CO3, and 90 mM NaHCO3 [pH 9.3]) and
incubated for 30 min at 95 C to generate fragments ranging from 30 to 100 nt.
The fragmentation reaction was stopped by adding 0.56 ml of ice-cold precipitation solution (300 mM NaOAc [pH 5.5] plus GlycoBlue [Ambion]), and the
RNA was purified by a standard isopropanol precipitation. The fragmented
mRNA was then dephosphorylated in a 50 mL reaction with 25 U T4 PNK
(NEB) in 13 PNK buffer (without ATP) plus 0.5 U SUPERase,In (Ambion) and
precipitated with GlycoBlue via standard isopropanol precipitation methods.
A linker was ligated to the fragmented RNA using truncated T4 RNA ligase 2
(NEB) in 25% PEG-8000 in 50 mM Tris-HCl, 10 mM MgCl2, and 1 mM DTT
(pH 7.5) at 25 C for 3 hr. The RNA was then reverse transcribed to DNA using
SuperScript III (Invitrogen) and circularized using Circligase (Epicenter)
following the manufacturer’s recommended protocol. Barcodes were added
by PCR with Phusion polymerase (NEB). The DNA library was sequenced on
an Illumina HiSeq 2000. Reads were processed using the HTSeq Python package and other custom software written in Python.
Plasmid Design and Construction for CRISPRi in Human Cells
The sequence-encoding mammalian codon-optimized Streptococcus pyogenes dCas9 (DNA 2.0) was fused with two C-terminal SV40 NLSs and tagBFP
alone or with the KRAB, CSD, WRPW, VP64, or p65AD domains. Using Gibson
cloning we cloned these fusion proteins into MSCV-Puro (Clontech) or pHR
(Addgene). sgRNAs were expressed using a lentiviral U6-based expression
vector derived from pSico that coexpresses mCherry-T2A-Puro from a CMV
promoter. The sgRNA expression plasmids were cloned by inserting annealed
oligos into the lentiviral U6-based expression vector that was digested by
BstXI and XhoI. To detect indel formation in GFP in human cells, we purified
genomic DNA from cells expressing dCas9-KRAB and either a negative control sgRNA or sgGFP-NT1 that had been grown in culture for 3 weeks. We
PCR amplified the SV40 promoter and GFP and sequenced the PCR products.
Cell Culture, DNA Transfections, Viral Production, and Fluorescence
Measurements for CRISPRi in Human Cells
HEK293 and HeLa cells were maintained in Dulbecco’s modified Eagle
medium (DMEM) in 10% FBS, 2 mM glutamine, 100 units/ml streptomycin,
and 100 mg/ml penicillin. Lentivirus and retrovirus were produced by transfecting HEK293 or amphotropic Phoenix packaging cell lines with standard packaging vectors. HEK293 or HeLa cell lines were generated by transducing cells
with a MSCV retrovirus expressing GFP from the SV40 promoter or lentivirus
expressing dCas9, dCas9-KRAB from an SFFV promoter, or the sgRNA
from a U6 promoter or a Gal4-GFP reporter. Pure populations of each stable
cell line were sorted by flow cytometry using a BD FACS Aria2 for stable
GFP, BFP, or mCherry expression. For transient transfection experiments,
reporter HEK293 cell lines were transfected using TransIT-LT1 transfection
reagent (Mirus) with the manufacturer’s recommended protocol in 24 well
plates. Cells were transfected with 0.5 mg of the dCas9 expression plasmid
and 0.5 mg of the RNA expression plasmid or if dCas9 is stably expressed
with 1 mg of the RNA expression plasmid. Two sgRNA plasmids (0.75 mg
each) were cotransfected for double-knockdown experiments. For 6- to
7-day experiments, the cells are split at day 3. At 3 or 6 days following transfection or 7–14 days following transduction, cells were trypsinized to a singlecell suspension and gated on mCherry-positive population (top 30%–60% for
transient transfection experiments), and GFP expression was analyzed. To
analyze CXCR4 or CD71, expression cells were dissociated in 10 mM EDTA
PBS and then stained in PBS/10% FBS for 1 hr at room temperature. Isotype
control, CXCR4, and CD71antibodies for flow cytometry were purchased from
MBL or eBioscience and were used at 0.05 mg/ml. All flow cytometry analysis
was performed using a LSR II flow cytometer (BD Biosciences).
Quantitative RT-PCR
Cells were harvested using trypsin (Invitrogen), and total RNA was isolated
using the RNeasy Mini Kit (QIAGEN), according to manufacturer’s instructions.
RNA was converted to cDNA using AMV reverse transcriptase under standard
conditions with oligo dT primers and RNasin (Promega). Quantitative PCR reactions were prepared with Go-Taq (Promega) and SYBR Green (Invitrogen),
according to the manufacturer’s instructions. Reactions were run on a
LightCycler thermal cycler (Roche). Primer sequences for CXCR4, CD71,
and GAPDH are as follows: CXCR4, 50 GAAGCTGTTGGCTGAAAAGG 30
CTCACTGACGTTGGCAAAGA; CD71, 50 AAAATCCGGTGTAGGCACAG 30
GCACTCCAACTGGCAAAGAT; and GAPDH, 50 ACAGTCAGCCGCATCTTCTT
30 ACGACCAAATCCGTTGACTC.
Strain Construction and Fluorescence Measurements for CRISPRi in
Yeast
The mammalian codon-optimized dCas9 fused with two C-terminal SV40
nuclear localization signal sequences was PCR amplified and inserted into
pJED103 CEN/ARS plasmid (BglII/BamHI digested) using In-Fusion HD
cloning (Clontech). The Mxi1-repressive domain was synthesized using IDT
gBlocks gene fragments and cloned into the vector using Gibson assembly
(Gibson et al., 2009). A contiguous IDT gene block containing the SNR52 promoter, sgRNA, and SUP4 terminator 30 flanking sequence was amplified using
Phusion HF PCR and digested using EcoRI and PstI. The digested product
was inserted into the AH057 CEN/ARS plasmid using standard ligation/insertion protocols. Inverse PCR was used to generate sgRNA cassettes with new
Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc. 449
20 bp complementary regions. Standard lithium acetate transformations were
carried out to transform 1 mg of plasmid per transformation into TEF1-GFPtagged strain or a strain with a genomic integrated TetON-Venus reporter
and an rtTA gene. After transformation, cells were grown on selective media
(SC-uracil and -leucine) for 2 days. Strains were grown overnight at 30 C,
and the levels of fluorescence protein were determined using a LSRII flow
cytometer (BD Biosciences). For doxycycline induction experiments, the overnight culture without doxycycline was diluted to OD 0.05 in the same selective
media supplemented with 100 mg/ml doxycycline. The levels of fluorescence
protein were assayed by flow cytometer after 5 hr of growth. Triplicate cultures
were measured for each experiment, and their standard deviation was indicated as the error bar.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Extended Experimental Procedures, four
figures, and one table and can be found with this article online at http://dx.
doi.org/10.1016/j.cell.2013.06.044.
ACKNOWLEDGMENTS
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,
Jiang, W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering
using CRISPR/Cas systems. Science 339, 819–823.
Deltcheva, E., Chylinski, K., Sharma, C.M., Gonzales, K., Chao, Y., Pirzada,
Z.A., Eckert, M.R., Vogel, J., and Charpentier, E. (2011). CRISPR RNA maturation by trans-encoded small RNA and host factor RNase III. Nature 471,
602–607.
Deuschle, U., Meyer, W.K., and Thiesen, H.J. (1995). Tetracycline-reversible
silencing of eukaryotic promoters. Mol. Cell. Biol. 15, 1907–1914.
DiCarlo, J.E., Norville, J.E., Mali, P., Rios, X., Aach, J., and Church, G.M.
(2013). Genome engineering in Saccharomyces cerevisiae using CRISPRCas systems. Nucleic Acids Res. 41, 4336–4343.
Fellmann, C., Zuber, J., McJunkin, K., Chang, K., Malone, C.D., Dickins, R.A.,
Xu, Q., Hengartner, M.O., Elledge, S.J., Hannon, G.J., and Lowe, S.W. (2011).
Functional identification of optimized RNAi triggers using a massively parallel
sensor assay. Mol. Cell 41, 733–746.
Fisher, A.L., Ohsako, S., and Caudy, M. (1996). The WRPW motif of the hairyrelated basic helix-loop-helix repressor proteins acts as a 4-amino-acid transcription repression and protein-protein interaction domain. Mol. Cell. Biol. 16,
2670–2677.
The authors thank Martin Jinek for discussion and distribution of the dCas9
gene. The authors also thank Jason Park, Martin Kampmann, Mike Bassik,
and Xin Xiong for lentiviral vectors, technical advice, and helpful discussion.
L.S.Q. acknowledges support from the UCSF Center for Systems and Synthetic Biology. This work was supported by NIH P50 GM102706 (J.S.W. and
J.A.D.), NIH P50 GM081879 (L.S.Q., W.A.L., Z.L., and E.H.W.), NIH U01
CA168370 (J.S.W.), Howard Hughes Medical Institute (L.A.G., G.A.B., O.B.,
J.A.D., J.S.W., and W.A.L.), NSF SynBERC EEC-0540879 (W.A.L.), NIGMS
IMSD (S.E.T.), the Human Frontiers Scientific Program (N.S. and L.M.), and a
Ruth L. Kirschstein National Research Service Award (M.H.L.).
Fu, Y., Foden, J.A., Khayter, C., Maeder, M.L., Reyon, D., Joung, J.K., and
Sander, J.D. (2013). High-frequency off-target mutagenesis induced by
CRISPR-Cas nucleases in human cells. Nat. Biotechnol. Published online
June 23, 2013. http://dx.doi.org/10.1038/nbt.2623.
Received: May 30, 2013
Revised: June 19, 2013
Accepted: June 27, 2013
Published: July 11, 2013
Gratz, S.J., Cummings, A.M., Nguyen, J.N., Hamm, D.C., Donohue, L.K.,
Harrison, M.M., Wildonger, J., and O’Connor-Giles, K.M. (2013). Genome
engineering of Drosophila with the CRISPR RNA-guided Cas9 nuclease. Genetics. Published online May 24, 2013. http://dx.doi.org/10.1534/genetics.
113.152710.
REFERENCES
Groner, A.C., Meylan, S., Ciuffi, A., Zangger, N., Ambrosini, G., Dénervaud, N.,
Bucher, P., and Trono, D. (2010). KRAB-zinc finger proteins and KAP1 can
mediate long-range transcriptional repression through heterochromatin
spreading. PLoS Genet. 6, e1000869.
Bassik, M.C., Kampmann, M., Lebbink, R.J., Wang, S., Hein, M.Y., Poser, I.,
Weibezahn, J., Horlbeck, M.A., Chen, S., Mann, M., et al. (2013). A systematic
mammalian genetic interaction map reveals pathways underlying ricin susceptibility. Cell 152, 909–922.
Baty, D., Barrera-Saldana, H.A., Everett, R.D., Vigneron, M., and Chambon, P.
(1984). Mutational dissection of the 21 bp repeat region of the SV40 early promoter reveals that it contains overlapping elements of the early-early and lateearly promoters. Nucleic Acids Res. 12, 915–932.
Benoist, C., and Chambon, P. (1981). In vivo sequence requirements of the
SV40 early promotor region. Nature 290, 304–310.
Bhaya, D., Davison, M., and Barrangou, R. (2011). CRISPR-Cas systems in
bacteria and archaea: versatile small RNAs for adaptive defense and regulation. Annu. Rev. Genet. 45, 273–297.
Gibson, D.G., Young, L., Chuang, R.-Y., Venter, J.C., Hutchison, C.A., 3rd, and
Smith, H.O. (2009). Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods 6, 343–345.
Gossen, M., and Bujard, H. (1992). Tight control of gene expression in
mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad.
Sci. USA 89, 5547–5551.
Harper, S.E., Qiu, Y., and Sharp, P.A. (1996). Sin3 corepressor function in Mycinduced transcription and transformation. Proc. Natl. Acad. Sci. USA 93,
8536–8540.
Hathaway, N.A., Bell, O., Hodges, C., Miller, E.L., Neel, D.S., and Crabtree,
G.R. (2012). Dynamics and memory of heterochromatin in living cells. Cell
149, 1447–1460.
Huh, W.-K., Falvo, J.V., Gerke, L.C., Carroll, A.S., Howson, R.W., Weissman,
J.S., and O’Shea, E.K. (2003). Global analysis of protein localization in budding
yeast. Nature 425, 686–691.
Chang, K., Elledge, S.J., and Hannon, G.J. (2006). Lessons from Nature:
microRNA-based shRNA libraries. Nat. Methods 3, 707–714.
Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Tsai, S.Q., Sander, J.D., Peterson, R.T., Yeh, J.-R.J., and Joung, J.K. (2013). Efficient genome editing in
zebrafish using a CRISPR-Cas system. Nat. Biotechnol. 31, 227–229.
Cho, S.W., Kim, S., Kim, J.M., and Kim, J.-S. (2013). Targeted genome
engineering in human cells with the Cas9 RNA-guided endonuclease. Nat.
Biotechnol. 31, 230–232.
Jiang, W., Bikard, D., Cox, D., Zhang, F., and Marraffini, L.A. (2013). RNAguided editing of bacterial genomes using CRISPR-Cas systems. Nat.
Biotechnol. 31, 233–239.
Chylinski, K., Le Rhun, A., and Charpentier, E. (2013). The tracrRNA and Cas9
families of type II CRISPR-Cas immunity systems. RNA Biol. 10, 10.
Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier,
E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive
bacterial immunity. Science 337, 816–821.
Conaway, J.W. (2012). Introduction to theme ‘‘Chromatin, epigenetics, and
transcription’’. Annu. Rev. Biochem. 81, 61–64.
Cong, L., Zhou, R., Kuo, Y.-C., Cunniff, M., and Zhang, F. (2012). Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional
repressor domains. Nat Commun 3, 968.
450 Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc.
Jinek, M., East, A., Cheng, A., Lin, S., Ma, E., and Doudna, J. (2013). RNA-programmed genome editing in human cells. Elife 2, e00471.
Joung, J.K., and Sander, J.D. (2013). TALENs: a widely applicable technology
for targeted genome editing. Nat. Rev. Mol. Cell Biol. 14, 49–55.
Kasten, M.M., Ayer, D.E., and Stillman, D.J. (1996). SIN3-dependent transcriptional repression by interaction with the Mad1 DNA-binding protein. Mol. Cell.
Biol. 16, 4215–4221.
Levskaya, A., Weiner, O.D., Lim, W.A., and Voigt, C.A. (2009). Spatiotemporal
control of cell signalling using a light-switchable protein interaction. Nature
461, 997–1001.
Maeder, M.L., Linder, S.J., Reyon, D., Angstman, J.F., Fu, Y., Sander, J.D.,
and Joung, J.K. (2013). Robust, synergistic regulation of human gene expression using TALE activators. Nat. Methods 10, 243–245.
Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E.,
and Church, G.M. (2013). RNA-guided human genome engineering via Cas9.
Science 339, 823–826.
Margolin, J.F., Friedman, J.R., Meyer, W.K., Vissing, H., Thiesen, H.J., and
Rauscher, F.J., 3rd. (1994). Krüppel-associated boxes are potent transcriptional repression domains. Proc. Natl. Acad. Sci. USA 91, 4509–4513.
Marraffini, L.A., and Sontheimer, E.J. (2008). CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322, 1843–
1845.
Marraffini, L.A., and Sontheimer, E.J. (2010). CRISPR interference: RNAdirected adaptive immunity in bacteria and archaea. Nat. Rev. Genet. 11,
181–190.
Millau, J.-F., and Gaudreau, L. (2011). CTCF, cohesin, and histone variants:
connecting the genome. Biochem. Cell Biol. 89, 505–513.
Perez-Pinera, P., Ousterout, D.G., Brunger, J.M., Farin, A.M., Glass, K.A.,
Guilak, F., Crawford, G.E., Hartemink, A.J., and Gersbach, C.A. (2013). Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nat. Methods 10, 239–242.
Phillips-Cremins, J.E., Sauria, M.E.G., Sanyal, A., Gerasimova, T.I., Lajoie,
B.R., Bell, J.S.K., Ong, C.-T., Hookway, T.A., Guo, C., Sun, Y., et al. (2013).
Architectural Protein Subclasses Shape 3D Organization of Genomes during
Lineage Commitment. Cell 153, 1281–1295.
Qi, L.S., Larson, M.H., Gilbert, L.A., Doudna, J.A., Weissman, J.S., Arkin, A.P.,
and Lim, W.A. (2013). Repurposing CRISPR as an RNA-guided platform for
sequence-specific control of gene expression. Cell 152, 1173–1183.
Sadowski, I., Ma, J., Triezenberg, S., and Ptashne, M. (1988). GAL4-VP16 is an
unusually potent transcriptional activator. Nature 335, 563–564.
Schreiber-Agus, N., Chin, L., Chen, K., Torres, R., Rao, G., Guida, P.,
Skoultchi, A.I., and DePinho, R.A. (1995). An amino-terminal domain of Mxi1
mediates anti-Myc oncogenic activity and interacts with a homolog of the
yeast transcriptional repressor SIN3. Cell 80, 777–786.
Thurman, R.E., Rynes, E., Humbert, R., Vierstra, J., Maurano, M.T., Haugen,
E., Sheffield, N.C., Stergachis, A.B., Wang, H., Vernot, B., et al. (2012). The
accessible chromatin landscape of the human genome. Nature 489, 75–82.
Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F.,
and Jaenisch, R. (2013). One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153,
910–918.
Wiedenheft, B., Sternberg, S.H., and Doudna, J.A. (2012). RNA-guided genetic
silencing systems in bacteria and archaea. Nature 482, 331–338.
Zhang, L., Spratt, S.K., Liu, Q., Johnstone, B., Qi, H., Raschke, E.E., Jamieson,
A.C., Rebar, E.J., Wolffe, A.P., and Case, C.C. (2000). Synthetic zinc finger
transcription factor action at an endogenous chromosomal site. Activation of
the human erythropoietin gene. J. Biol. Chem. 275, 33850–33860.
Zhang, Y., Heidrich, N., Ampattu, B.J., Gunderson, C.W., Seifert, H.S.,
Schoen, C., Vogel, J., and Sontheimer, E.J. (2013). Processing-Independent
CRISPR RNAs Limit Natural Transformation in Neisseria meningitidis. Mol.
Cell 50, 488–503.
Cell 154, 442–451, July 18, 2013 ª2013 Elsevier Inc. 451