Dear Healthcare Colleague:
Welcome and thank you for participating in The Multifaceted Frontiers of
Sepsis Research and Management symposium jointly sponsored by CMEducation
Resources, LLC and the University of Massachusetts Medical School (UMMS). The
program is funded by an independent educational grant from Eisai, Inc.
We are excited that you have joined us and we are confident that you will benefit from
your participation. CMEducation Resources has put together an excellent program that
will measurably enhance the quality of care you provide for patients with Infectious
Disease.
The UMMS designates this continuing medical education activity for a maximum of 3.5
hours in Category 1 toward the Physician’s Recognition Award of the American Medical
Association.
With the cooperation of our distinguished faculty, this comprehensive course syllabus has
been assembled to be an educational resource that you may consult during the course of
this program, and as a guide to challenging clinical decisions that you must make in your
day-to-day practice. In addition, we invite you to continue with our CME programming –
including webcasts, HealthWRAPS®, SlideCASTs and ConsultCASTs – by linking on to
www.CLINICALWEBCASTS.COM.
To comply with continuing education requirements, the symposium evaluation form is
enclosed in this notebook. At the conclusion of the symposium, please complete this form
and return it to a CMEducation Resources representative at the registration desk. Please be
sure to indicate additional program topics with specific focus areas that you wish to see
covered in future CME programming.
This information is important to us as it provides us with data to use in developing highquality programs for the future as well as verifying your shipping address for your CME
Certificate.
Once again, we thank you for attending our symposium. If you have any questions during
the symposium, please do not hesitate to contact one of the CMEducation Resources
representatives at the registration desk.
Sincerely,
CMEducation Resources, LLC
All Rights Reserved. No part of this publication may be reproduced in any form without express written permission from CMEducation
Resources. In some instances, ownership in specific articles (handouts, papers, etc.) is held by the specific author.
CMEducation Resources, LLC
The Multifaceted Frontiers of
Sepsis Research and Management
Agenda
Friday, October 22, 2010
Vancouver Convention Centre – Vancouver, BC Canada
TIME
6:00 – 6:30 p.m.
6:30 – 6:45 p.m.
6:45 – 7:10 p.m.
LOCATION
Conference Room
211 -214 W.
Conference Room
211 – 214 W.
Conference Room
211 – 214 W.
SESSION
Dinner Buffet, Distribution of Program Materials
Chairman’s Introduction
New Perspectives in Sepsis Research: The Role of
Immune Response and Inflammation: The Infectious
Disease Specialist’s Perspective
Conference Room
211 – 214 W.
Douglas Golenbock, MD
The Multifaceted Interfaces of Innate Immunity, the
Inflammatory Cascade, and Clinical Manifestations of
Severe Sepsis
7:35 – 8:00 p.m.
Conference Room
211 – 214 W.
H. Shaw Warren, MD
The Foundation Role of Toll-Like Receptors (TLRs)
Signaling Systems in the Sepsis Cascade: The Frontiers of
Translational Research
8:00 – 8:25 p.m.
Conference Room
211 – 214 W.
Steven M. Opal, MD
Mission Possible: “Killing Bugs, Disarming
Messengers”—Optimizing Outcomes in Sepsis with
Evidence-Based Antimicrobial Therapy
8:25 – 8:35 p.m.
Conference Room
211 – 214 W.
Anand Kumar, MD
Take Home Messages and Vision Statement on Current
Status of Translational Research and Evolving
Interventions for Sepsis
8:35 – 8:50 p.m.
Conference Room
211 – 214 W.
7:10 – 7:35 p.m.
Program Co-Chairs
Interactive Question and Answer Session
CMEducation Resources, LLC
The Multifaceted Frontiers of
Sepsis Research and Management
Faculty Roster
Friday, October 22, 2010
Vancouver Convention Centre – Vancouver, BC Canada
Douglas Golenbock, MD (Co-Chair)
Professor and Chairman
Division of Infectious Diseases and Immunology
Department of Medicine
Department of Molecular Genetics and Microbiology
University of Massachusetts Medical School
Worcester, Massachusetts
______________________________________________________________________________
Steven M. Opal, MD (Co-Chair)
Professor of Medicine
The Infectious Disease Division
Memorial Hospital of Rhode Island, The Warren Alpert School of Medicine of Brown University
Providence, Rhode Island
H. Shaw Warren, MD
Associate Professor
Harvard Medical School
Infectious Disease Unit
Massachusetts General Hospital for Children
Boston, Massachusetts
______________________________________________________________________________
Anand Kumar, MD
Associate Professor of Medicine
Infectious Diseases and Critical Care Medicine
Medical Microbiology and Pharmacology/Therapeutics
University of Manitoba
Associate Professor of Medicine
Critical Care Medicine and Infectious Diseases
Robert Wood Johnson Medical School/Cooper Hospital
Camden, New Jersey
CMEducation Resources, LLC
The Multifaceted Frontiers of
Sepsis Research and Management
Faculty Roster
Friday, October 22, 2010
Vancouver Convention Centre – Vancouver, BC Canada
LEARNING AND PROGRAM OBJECTIVES
Upon completion of this activity, infectious disease specialists attending the program should be
able to:
●
Understand and deploy practice-focused management principles and guidelines in
patients with severe sepsis, including risk stratification of patients, initial antibiotic
selection, and indications for other interventions
●
Understand the status of current studies and trials evaluating a wide range of immunemodulating strategies that may be useful in specific subsets of patients with sepsis
●
Detail the heterogeneity of patients with sepsis, and how treatment options are best
aligned with risk stratification scores, clinical history, and other features unique to the
individual patient
●
Describe the complex, multifaceted dimensions of sepsis pathophysiology, and the need
to address multiple pathogenic mechanisms and triggers (bacterial invasion), immunemediated signaling systems (TLRs and innate immune response) in order to mitigate
adverse clinical manifestations of the sepsis syndrome
●
Discuss the science that supports potential interventions through which infectious disease
specialists can both “kill bacteria” and “disarm the messengers” that play pivotal roles in
the adverse clinical manifestations of the sepsis disease state
●
Describe the role that ID specialists may play in managing sepsis patients with immunemodulating therapies
●
Risk stratify sepsis patients using the APACHE scoring system; and better identify
intervention strategies based on ATS practice statements and guidelines for sepsis
●
Apply evidence-based treatment protocols for sepsis, focusing antibiotic selection, and
interventions targeted on the coagulation system and/or inflammatory cascade
CMEducation Resources, LLC
The Multifaceted Frontiers of
Sepsis Research and Management
Faculty Roster
Friday, October 22, 2010
Vancouver Convention Centre – Vancouver, BC Canada
ACCREDITATION STATEMENT
This activity has been planned and implemented in accordance with the Essential Areas and
policies of the Accreditation Council for Continuing Medical Education through the joint
sponsorship of The University of Massachusetts Medical School, Office of CME and
CMEducation Resources, LLC. The University of Massachusetts Medical School is accredited
by the ACCME to provide continuing medical education for physicians.
CREDIT DESIGNATION STATEMENT
The University of Massachusetts Medical School designates this educational activity for a
maximum of 3.5 AMA PRA Category 1 Credit(s). Physicians should only claim credit
commensurate with the extent of their participation in the activity.
POLICY ON FACULTY AND PROVIDER DISCLOSURE
It is the policy of the University of Massachusetts Medical School to ensure fair balance,
independence, objectivity and scientific rigor in all activities. All faculty participating in CME
activities sponsored by the University of Massachusetts Medical School are required to present
evidence-based data, identify and reference off-label product use and disclose all relevant
financial relationships with those supporting the activity or others whose products or services are
discussed. Faculty disclosure will be provided in the activity materials.
Supported by an independent educational grant from Eisai, Inc.
University of Massachusetts Medical School Office of Continuing Medical Education Summary of Faculty Disclosure Information Faculty Disclosures: As a sponsor accredited by the ACCME, The University of Massachusetts Medical School Office of Continuing Medical Education (UMMS‐OCME) must ensure balance, independence, objectivity, and scientific rigor in all its individually sponsored and jointly sponsored educational activities. All faculty participating in a sponsored activity are expected to disclose to the activity audience any discussion of off‐label use or investigations use of a product, and any relevant financial interest or other relationship which they, or their spouse/partner, have (a) with the manufacture(s) of any commercial product(s) and/or provider(s) of commercial services discussed in an educational presentation and (b) with any commercial supporters of the activity. (Relevant financial interest or other relationship can include such things as grants or research support, employee, consultant, major stockholder, member of speaker’s bureau, etc.) The following faculty members have indicated their financial interests and/or relationships with commercial manufacture(s) (and/or those of their spouse/partner) below. Faculty with no relevant financial relationships are listed with N/A. FINANCIAL INTERESTS OR RELATIONSHIPS Faculty Member Relationship Corporation/Manufacturer Douglas Golenbock, MD Consultant:
Speaker’s Bureau: Grant/Research: Consultant:
Speaker’s Bureau: Grant/Research: N/A
N/A N/A N/A
N/A Eisai Preclinical Grant and Institutional Grant for Clinical Coordinating Center with Eisai N/A
N/A N/A N/A
N/A N/A Steven M. Opal, MD H. Shaw Warren, MD Anand Kumar, MD Consultant:
Speaker’s Bureau: Grant/Research: Consultant:
Speaker’s Bureau: Grant/Research: The speaker must disclose any discussion of off‐label use and/or investigational products to the audience during the presentation. Committee/Staff Disclosure The following CME program planners have indicated their financial interests and/or relationships with commercial manufacturer(s) (and/or those of their spouse/partner below. Planners with no relevant financial relationships are listed with N/A. COMMITTEE / STAFF Gideon Bosker Milo Falcon RELATIONSHIP N/A N/A The University of Massachusetts Medical School Office of Continuing Medical Education (UMMS‐OCME) has reviewed the appropriate documentation provided by the individuals who are in a position to control the content of this educational activity. The UMMS‐OCME has determined that any potential relevant conflict of interest has been resolved. For more information about faculty and planner disclosures, contact the UMMS‐OCME at continuingeducation@umassmed.edu CMEducation Resources, LLC
The Multifaceted Frontiers of
SEPSIS RESEARCH and MANAGEMENT
Chairman’s Introduction and Overview
Faculty: Douglas Golenbock, MD
Notes:
Time: 6:30 – 6:45 p.m.
Mission Possible:
Killing Bugs, Disarming the Messengers
The Multifaceted Frontiers of
Sepsis
p Research and
Management
Focus on the Foundation Role of TollToll-Like Receptors
and the Inflammatory Cascasde
D
Douglas
l G
Golenbock,
l b k MD
St h
Stephen
M
M. O
Opal,
l MD
Professor and Chairman
Division of Infectious Diseases
and Immunology
Department of Medicine
University of Massachusetts
Medical School
Professor of Medicine
The Infectious Disease Division
Memorial Hospital of Rhode Island,
The Warren Alpert School of Medicine of
Brown University
Co--Chair
Co
Co--Chair
Co
1
Welcome and Program Overview
CME--certified symposium jointly
CME
sponsored by the University of
Massachusetts Medical School and
CMEducation Resources, LLC
Commercial Support: Sponsored by
an unrestricted educational grant
from Eisai,, Inc.
Faculty disclosures: Listed in
program syllabus
We Request That You…
►PLEASE FILL OUT
QUESTION AND ANSWER
(Q&A) CARDS as program proceeds
so we can collect them and discuss
during the Q&A session
COURSE SURVEY AND EVALUATION
forms to obtain CME credit
credit. Please
hand all survey forms to the staff at
the desk outside following the
program
2
Program Faculty
Douglas Golenbock, MD
H. Shaw Warren, MD
Co--Chair
Co
Professor and Chairman
Division of Infectious Diseases and
Immunology
Department of Medicine
Department of Molecular Genetics and
Microbiology
University of Massachusetts Medical School
Associate Professor
Harvard Medical School
Infectious Disease Unit
Massachusetts General Hospital for
Children
Boston, Massachusetts
Stephen M. Opal, MD
Associate Professor of Medicine
Infectious Diseases and Critical Care
Medicine
Medical Microbiology and
Pharmacology/Therapeutics
University of Manitoba
Associate Professor of Medicine
Robert Wood Johnson Medical
School/Cooper Hospital
Co--Chair
Co
Professor of Medicine
The Infectious Disease Division
Memorial Hospital of Rhode Island
The Warren Alpert School of Medicine of
Brown University
Providence, Rhode Island
Anand Kumar, MD
CME Program Agenda
6:30 PM – 6:45 PM
Chairman’s Introduction
6:45 PM – 7:10 PM
New Perspectives in Sepsis Research: The Role
of Immune Response and Inflammation: The
Infectious Disease Specialist’s Perspective
“Killing the Messengers”—What Do We Know?
How Can We Best Translates Emerging
Knowledge to the Clinical Practice of
Infectious Diseases
Focus on Infection, Immunity, and Inflammation:
Impact of New Research for Targeted, Intensive
Intervention in Patients with Sepsis
Douglas Golenbock, MD—Professor and
Chairman
3
CME Program Agenda
7:10 PM – 7:35 PM
The Multifaceted Interfaces of Innate Immunity,
the Inflammatory Cascade, and Clinical
Manifestations of Severe Sepsis
A Target-Based and Systems Approach to Mitigating
Sequential Organ Failure in Severe Sepsis: What
Patho-Immunological Interfaces and Signaling
Systems Hold the Key?
H. Shaw Warren, MD—Harvard Medical School
7:35 PM – 8:00 PM
The Foundation Role of Toll-Like Receptors
(TLRs) Signaling Systems in the Sepsis Cascade:
The Frontiers of Translational Research
Analyzing the Pathophysiology of Sepsis and
Identifying TLR Targets for Mitigating the
Inflammatory Response
Current Clinical Investigations Focused on TLR-4
Receptor Antagonists and the Implications for ID
Specialty Practice
CME Program Agenda
8:00 PM – 8:25 PM
Mission Possible: “Killing Bugs, Disarming
Messengers”—
Messengers”
—Optimizing Outcomes in Sepsis with
Evidence--Based Antimicrobial Therapy
Evidence
Anand Kumar, MD
Associate Professor of Medicine │Infectious Diseases and Critical Care
Medicine │Medical Microbiology and Pharmacology/Therapeutics
│University of Manitoba │Associate Professor of Medicine │Robert
Wood Johnson Medical School/Cooper Hospital
8:25 PM – 8:35 PM
Take Home Messages
g and Vision Statement on Current
Status of Translational Research and Evolving
Interventions for Sepsis
Program Co
Co--Chairs
8:35 PM – 8:50 PM
Interactive QUESTION and ANSWER Session
4
CMEducation Resources, LLC
The Multifaceted Frontiers of
SEPSIS RESEARCH and MANAGEMENT
The Foundation Role of Toll-Like Receptors (TLRs) Signaling Systems
in the Sepsis Cascade: The Frontiers of Translational Research
Faculty: Steven M. Opal. MD
Notes:
Time: 7:35 – 8:00 p.m.
The multifaceted frontiers of
sepsis research: Immunity,
infection, inflammation and
intervention
TLR Targets for
f mitigating
i i i the
inflammatory response
IDSA meeting
g
Vancouver, BC
Oct. 22, 2010
- S. Opal
21
PAMPs
DAMPs
Microorganisms
Mi
croorganisms
PRRs
PRR
s
Immune cells
NLRs
TLRs
HSP
Heparan
Sulfate
Hyaluronic
acid
Fibrinogen
Biglycan
Surfactant A
HMGB-1
Heme
MRP8/14
mtDNA
RLHs
ASC
Caspase-1 & 5
ASC
NALP1 & 3
Pyrin
NF-κB
Host-derived
Hostmedia
ediators
tors
Cinel and Opal CCM 2009;291
-courtesy of T. Calandra
Traditional view of sepsis and its pathophysiology
Virulentpathogens:
pathogens (pneumococci,
meningococcus,
• Virulent
pneumococcus,
S. aureus,
Group A strep, S. aureus, Clostrida spp.)
Group A strep, Clostridia, meningococci
Pro-inflammatory markers-cytokines, chemokines
• Proinflammatory
mediators-cytokines,
C’
chemokines,
h
ki
procoagulants,
l
kinins,
ki i
ROI,
ROI RNI
RNI, C’
C, ROS RNS kinins, procoagulants
• Young,
previously healthy patients with rapid
Early onset septic shock, MODS
onset septic shock - fits our animal models
(Hotchkiss and Karl N Engl J Med 2003;348:138)
22
Realistic view of sepsis and its pathophysiology
Virulent pathogens (pneumococci, meningococcus,
Groupvirulent
A strep,pathogens:
S. aureus, Clostrida
spp.)
•Less
Stenotrophomonas,
enterococci,
Acinetobacter,
CMV, Candida
Pro-inflammatory
markers-cytokines,
chemokines
C’
Innate
immunity
•Anti-inflammatory
Anti inflammatory state
state-cytokines,
cytokines apoptosis,
apoptosis
C, ROS
RNS kinins, procoagulants
LPS
reprogramming,
Decreased HLA DR, TNFR,
TLR4,
cells,
MDSCs
Early expanded
onset septicTreg
shock,
MODS
• gradual deterioration and progressive organ
failure-fits most of our patients
Adaptive immunity
Sepsis-induced immunosuppression
(Hotchkiss
(Hotchkissand
andKarl
Karl N
N Engl
Engl JJ Med
Med 2003;348:138)
2003;348:138)
Treat early and preemptively to avoid immune dysregulation and tissue
injury by targeting pathogen-derived mediators
LPS is 75% of the outer membrane
>1 million LPS molecules/bacterial cell
23
TLR4
LPS
LPS signaling pathways
in human monocytes
CD14
LBP
MD2
TRAM
IFNβ
MyD88
Mal P
IRAK1
IRAK4
“Fast” LPS
signaling
pathway
RIP-1
TRAF6
PI3K
IKK
MKK6
α
NFκB
TAB1,2
γ
JAKLPS
“Slow”
signaling
pathway
P
TAK1
TRAF6
β
IRAK1
MKK7
Stat 1
p65 p
p
p50
IκB
P38, ERK1
P
p300
p65 p50
CD80, CD83
Lin et al. Nature
2010;465:885
Cytokines,
APP, NOS
TBK1
JNK
IRF-3
c-Jun
p300
p300
IRF-3IRF-3
IFN-response genes
2-LPS
2-MD2
The stoichiometry of LPS
signaling
2-TLR4
6-MyD88
4-IRAK4
4-IRAK1/2
2-TIR
TRAF6
24
The main
trimerization
interface
of the TLR4–MD-2–
LPS complex via the
β-OH Myristic acid
at the R2 position of
Li id A
Lipid
Hydrophobic
pocket
BS Park et al. Nature (2009);7830
E. coli Lipid A versus eritoran (E5564) as a Lipid A antagonist
TLR4
binding
site
Hexa-acyl
format
β hydroxyl myristic acid
(3)
E. coli
E
lipid A
C-length
(2)
Tetra-acyl
format
((1))
BS Park et al. Nature (2009); 7830:1-5
25
E5564 blocks the LPS-MD2-TLR4 dimer signaling complex
Lipid A
Kim et al. Cell 2007;130:905
LPS
2 TLR4 TM and IC domains fail to dimerize
for adaptor engagement and signaling
Eritoran is a signal terminator in normal
human volunteers challenged with LPS
–Chills
–Fever
–Headache
–Myalgia
–Tachycardia
• 100 and 250 μg doses
of eritoran completely
blocked all biochemical
effects of LPS challenge
400
Plas
sma TNF α (pg/mL)
• 100 and 250 μg doses
of eritoran completely
bl k d allll clinical
blocked
li i l signs
i
and symptoms of LPS
toxicity
350
300
250
200
Placebo
150
100
100, 250 ug E5564
50
0
0
2
4
6
8
10
Time after LPS infusion (hr)
Lynn M, et al. J Infect Dis. 2003 Feb 15;187(4):63115;187(4):631-9
26
Eritoran
II clinical
trial
E5564 K-M
plot Phase
high risk
group
(high risk patients: APACHE II >50%)
Prob
bability of Survival (% )
100%
High-dose
g
eritoran
80%
P=0.07
60%
Placebo
40%
Placebo (n=53)
Low dose 45 mg/6 days (n=58)
High dose 105 mg/6 days (n=51)
20%
0%
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
Study Day
(Tidswell et al. CCM 2010; 38: 72-83)
Relative Reduction in Risk of Death
at 28 Days and 95% CI
Xigris Used
Yes
No
Baseline Endotoxin
Detectable
Elevated > 0.2 endotoxin status
Baseline HDL
< 25 mg/dL
> 25 mg/dL
Rx must be
given early
Time to drug infusion
8 hours or less
More than 8 hours
0.10
1.0
Eritoran better
10
Placebo better
Tidswell et al. Crit Care Med 2010; 38:7238:72-83
27
Infectious Adverse Events
Infectious
Adverse
Events
Investigatorreported
infectious
complication
CEC
determination of
infectious
complication
(n=96)
Eritoran
45 mg
Eritoran
105 mg
(n=103)
(n=94)
50.5
45.6
37.0
.2001
36 8
36.8
35 0
35.0
38 0
38.0
.8967
8967
Placebo
Overall p
value
Infectious adverse events were defined as either: 1) recurrent infectioninfection-relapse
or superinfection; or 2) new infection at a different site after the onset of sepsis
Tidswell et al. Crit Care Med 2010; 38:7238:72-83
Endogenous TLR4 ligands can activate cells via a MD2
independent linkage with TLR4 –Heme
mAb to TLR4MD2 complex
Figueiredo et al. JBC
2007;282;20221
Protoporphyrin IX
antagonizes Heme
activation but not LPS
28
Prophylactic and Salvage Rx with anti-TLR4 antibodies protect mice
from lethal Gram-negative bacterial sepsis (E. coli 018 given i.p.)
-15 min
109cfu
-15 min
109cfu
+13 hr
109cfu
+13 hr
105cfu
With gentamicin and ceftriaxone
Roger T et al. PNAS 2009;106:2348-2352
Variable lymphocyte
receptor
TLR4 decoy
soluble
receptors
(Toy)
Hu:Fc
IgG1
g
TLR4 Full length
ectodomain
N’ terminal
d
i
ectodomain
N’ and central
D
Domain
i
Jung et al. PLoS
One2009;4(1):e704
29
- 30 min
+1 hr
- 1 hr
+ I hr
+1 and 12 hr
+1 and 12 hr
Jung et al. PLoS One
2009;4(1):e704
Can Sepsis-induced immunosuppression be treated?
The main dimerization interface
of the TLR4–MD-2–LPS complex.
Φreprograming
Regulate costimulators: CD28/80
Block co-inhibitors:
PD1, BTLA, CTLA4
Support immune
cells:IL-7, IL-15, GMCSF
#3 Protect Cells-Sirt1, ERβ, caspase inh.
BS Park et al. Nature 000, 1-5 (2009) doi:10.1038/nature07830
(Hotchkiss
and and
Opal N
Engl N
J Med
Hotchkiss
Opal
Engl2010;361(1):87)
J Med 2010
30
PDL1
PD1
Anti-PD1
Some Parting thoughts
Current and future therapies for severe sepsis
• Sepsis will continue to be a major problem – the
incidence will increase in the next several decades,
antibiotic resistance will become more prevalent and
efforts to regulate the host immune response will assume
greater importance
• Immunotherapy, biotherapy, nanotechnology and
supportive care technologies will assume greater
importance – improved monitoring and improved process
of care will help as will intelligent use of chemotherapy
• Systems biology will merge with P4 medicine and
eventually improve the recognition and Rx for sepsis
• Eritoran will have an impact – the first MD2-TLR4
inhibitor to finish phase 3 testing will be highly informative
31
CMEducation Resources, LLC
The Multifaceted Frontiers of
SEPSIS RESEARCH and MANAGEMENT
Mission Possible: “Killing Bugs, Disarming Messengers”—Optimizing Outcomes
in Sepsis with Evidence-Based Antimicrobial Therapy
Faculty: Anand Kumar, MD
Notes:
Time: 8:00 – 8:25 p.m.
Optimizing Outcomes in Sepsis and Septic
Shock with Evidence-Based Antimicrobial
Therapy
Maximizing Patient Outcomes through Antibiotic
Selection, Timing, and Dosing
`
Anand Kumar MD, FRCPC, FCCP, FCCM
Associate Professor of Medicine
University of Manitoba
Health Sciences Centre
S B
St.
Boniface
if
H
Hospital
i l
Winnipeg, Manitoba
Email: akumar61@yahoo.com
64
32
An Injury Paradigm of Septic Shock:
The Golden Hours
DEATH
Cellular dysfunction/tissue injury
Inflammatory response
Shock
Threshold
Toxic burden
Microbial load
akumar61@yahoo.com
TIME
69
Speed is Life
• The speed of clearance of the
microbial pathogen is the critical
determinant of outcome in
septic shock
akumar61@yahoo.com
70
33
An Injury Paradigm of Sepsis and
Septic Shock
Antimicrobial
therapy
Cellular dysfunction/tissue injury
Inflammatory response
Shock
Threshold
Toxic burden
Microbial load
akumar61@yahoo.com
TIME
71
An Injury Paradigm of Sepsis
and Septic Shock
earlier
antimicrobial
therapy
Cellular dysfunction/tissue
y
injury
j y
Shock
Threshold
Inflammatory response
Toxic burden
Microbial load
akumar61@yahoo.com
TIME
72
34
An Injury Paradigm of Sepsis and
more intense
Septic Shock
antimicrobial
therapy
Cellular dysfunction/tissue injury
Inflammatory response
Shock
Threshold
Toxic burden
Microbial load
akumar61@yahoo.com
TIME
73
• Synergy ie 2 drugs
• Static vs cidal
• PK/PD:
-time above MIC
-AUIC
AUIC
akumar61@yahoo.com
76
35
Monotherapy
vs
Combination
Therapy: Gram
Negative
Bacteremia
Safdar N,
Handelsman
J, Maki DG,
Lancet ID
2004
akumar61@yahoo.com
77
RCT Monotherapy vs Combination
Therapy: Sepsis
Paul et al, BMJ 2004
akumar61@yahoo.com
79
36
Change in Log10 CFU/mL bllood
Cefotaxime and Gentamicin
in Rat E. coli Bacteremia
1
0
no antibiotic
Cf
Ge
Cf → Ge
Ge → Cf
Cf + Ge
-1
-2
-3
-4
0
1
2
3
4
5
6
Time from Antibiotic Administration (hr)
81
Kumar et al, ICAAC 2004
Monotherapy vs Combination Therapy in
Severe Bacteremic Pneumococcal Pneumonia
100
Survival, %
95
n=102
n
102
90
85
n=99
80
SET Group
DET Group
75
0
2
4
6
8
10
12
14
15
Time After Admission, d
Waterer et al, Arch Intern Med 2001
akumar61@yahoo.com
82
37
vival
% surv
All Patients
Monotherapy vs Combination Therapy
in Gram Negative Bacteremia
80
*
60
40
20
%s
survival
Sev
verely Ill
0
†
80
60
Monotherapy
Combination therapy
*
40
20
0
83
akumar61@yahoo.com
Combination Antimicrobial Therapy in Bacteremic
Pneumococcal Pneumonia: Effect of Combination
Therapy in the Critically Ill
Baddour LM et al, AJRCCM 2004
akumar61@yahoo.com
84
38
Combination Antimicrobial Therapy in ICURequiring CAP: Effect of Combination Therapy in
Shock vs Non-shock
Non-shock
Shock
Rodriguez A et al. CCM 2007;35:1493-1498
85
akumar61@yahoo.com
Monotherapy
Mortality (%)
scoulier et al 1982
kamad et al 1985
vasquez et al 2005
dwyer et al 2006
baddour et al 2004
rodriquez et al 2007
chow et al 1991
kim et al 2003
chokshi et al 2007
martinez et al 2003
damas et al 2006
korvick et al 1992
cometta et al 1994
kreger et al 1980
mccue et al 1985
bouza et al 1987
carbon et al 1987
harbath et al 2005
mccue et al 1987
siegman-igra et al 1998
gullberg et al 1989
leibovici et al 1997
heyland et al (mod) 2008
waterer et al 2001
dupont et al
patterson et al 2003
kim et al 2002
fernandez-guerrero et al 1991
kuikka et al 1998
piccart et al 1984
bodey et al 1985
gamacho-montero et al 2007
mendelson et al 1994
vasquez et al 2005
chamot et al 2003
kljucar et al 1990
hilf et al 1989
harbarth et al 2005
aspa et al 2006
katersky et al 1973
montgomerie et al 1980
graninger et al 1992
fainstein et al 1983
maki et al 1988
dwyer et al 2005
gamacho-montero et al 2007
heyland et al (mod) 2008
chow et al 1991
korvick et al 1992
bodey et al 1989
baddour et al (rev) 2004
rodriquez et al 2007
feldman et al 1990
bodey et al 1985
chamot et al 2003
hilf et al 1989
tapper et al 1974
hammond et al 1990
combined (random)
0
0
4.4
4.6
6.1
6.3
7.1
8.9
9.5
9.9
10.0
12.0
12.7
13.3
13.5
14.3
16.0
16.7
16 2
16.2
16.7
16.7
17.0
17.1
18.2
18.9
19.1
20.3
21.1
21.9
22.7
23.1
24.1
24.4
26.7
27.3
28.0
29.0
21.1
39.4
31.8
32.1
32.3
40.6
41.2
44.0
45.8
50.0
50.0
50.0
54.2
33.3
57.7
71.4
75.0
81.1
91.7
100
100
.001
Meta-analysis of
studies of
combination vs
monotherapy
th
off
life-threatening
infections
associated with
sepsis
p
and septic
p
shock
Kumar et al, Crit Care Med
2010;38:1651–64
.01
.1 .2 .5 1 2 5 10
100
odds ratio (95% confidence interval)
86
39
Monotherapy
mortality 15-25%
Monotherapy
mortality >25%
Monotherapy
mortality <15%
Odds ratio meta-analysis plot [random effects]
Vazquezb
Chamota,c
Kljucar
D'Antonio
Hilfa
Watanakunkorn
Klatersky
Montgomerie
Graninger
Baddourb,c
Ko
Aspa
Fainstein
Maki
Dwyerb
Mendelson
Garnacho-Monterob
Chowb
Heylandb,c
Korvickb
Bodey2
Rodriguezb
Feldman
Bodey1b
Chamotb,c
Hilfb
Tapper
Hammond
combined
.001
Carbon
Sculier
McCue
Karnad
Kuikka
Vazqueza
Harbarthb,c
Dwyera
Gullberg
ac
Baddoura,c
Siegman-Igra
Rodrigueza
Leibovici
Chowa
Heylanda,c
Waterer
Kim
Dupont
Chokshi
Patterson
Martinez
Kim
Damas
Harbartha,c
Korvicka
Fernandez-Guerrero
Cometta
Kuikka
Kreger
Piccart
McCue
Bodey1a
Bouza
Garnacho-Monteroa
combined
combined
.01
.1 .2
.5 1 2
5 10
100
.001
.01
.1 .2 .5 1 2
5 10
100
1000
.01
.1 .2
.5
1
2
ratio (95% confidence interval)
Favors odds
combination
Favors monotherapy
Kumar et al, Crit Care Med 2010;38:1651–64
5
10
100
87
Metaregression: All studies
Odds Ratio of Dea
ath
(C
Combination Thera
apy)
OR 1.304 (1.205-1.412) per 10% mortality increment, p<.0001
4
1
0.25
0.0625
0
20
40
60
80
100
Monotherapy Mortality Risk (%)
Kumar et al, Crit Care Med 2010;38:1651–64
88
40
Metaregression: RCTs
Odds Ratio of Dea
ath
(C
Combination Thera
apy)
OR 1.425 (1.121-1.811) per 10% mortality increment, p=.0159
4
1
0.25
0 0625
0.0625
0
20
40
60
80
100
Monotherapy Mortality Risk (%)
Kumar et al, Crit Care Med 2010;38:1651–64
89
Meta-analysis (shock/critically ill stratified):
Combination vs Monotherapy
Group
Odds Ratio
I 2(%)
P-value
non-shock
1.11 (0.77-1.58)
11.1
.5786
shock
0 54 (0
0.54
(0.36
36-0
0.80)
80)
0
.0020
0020
non-critically ill
1.10 (0.46-2.60)
45.3
.8321
critically ill
0.33 (0.15-0.74)
0
.0067
non-shock/non-critically ill
1.10 (0.80-1.53)
17.7
.5566
shock/critically ill
0.49 (0.35-0.70)
0
<.0001
overall
0.76 (0.57-1.02)
34.3
.0654
0.1
1
Combo Therapy
Favored
10
Monotherapy
Favored
Kumar et al, Crit Care Med
Odds Ratio of Death
2010;38:1651–64
90
41
MT vs CT: 28 day survival
100
Kumar et al, Crit Care Med
2010;38:1773–85
% Surviviing
75
50
Combination Therapy (CT)
Monotherapy (MT)
25
Log-rank p-value: 0.0002
0
0
5
10
15
20
25
28 day
CT
1223
1077
996
937
895
881
868
MT
1223
1046
939
867
826
801
779
Number at risk
91
Pressor depende
P
ence (%)
MT vs CT: 28 day pressor liberation
100
Kumar et al, Crit Care Med
2010;38:1773–85
80
60
Combination Therapy (CT)
Monotherapy (MT)
40
Log rank p-value = 0.03
20
0
0
MT 1223
CT 1223
5
10
15
Time (days)
319
300
108
90
47
43
Number at risk
20
25
28
21
18
16
12
15
12
92
42
Pressor depende
P
ence (%)
MT vs CT: 28 day pressor liberation
100
Kumar et al, Crit Care Med
2010;38:1773–85
80
60
Combination Therapy (CT)
Monotherapy (MT)
40
Log rank p-value = 0.03
20
0
0
MT 1223
CT 1223
5
10
15
Time (days)
319
300
108
90
47
43
20
25
28
21
18
16
12
15
12
Number at risk
93
Combination vs Monotherapy:
Primary Antibiotic
n
β-lactams
p value
1858
.0002
penicillin/ampicillin
791
133
.05
19
.19
anti-staph penicillin
β-lactam/inhibitor
76
.13
582
.28
1060
.0007
1st gen ceph
39
.049
2nd gen ceph
122
.01
non-Ps 3rd gen ceph
671
.02
anti-Ps 3rd/4th gen ceph
235
.54
306
.77
158
.66
110
.79
12
.30
penicillins
cephalosporins
carbapenem
vancomycin
fluoroquinolone
macrolide/clindamycin
0.01
Kumar et al, Crit Care Med
2010;38:1773–85
0.1
1
Hazard Ratio
10
94
43
Combination vs Monotherapy:
Secondary Antibiotic
β-lactams (n=930)
AG
FQ
ML/CL
other
Vancomycin (n=82)
AG
FQ
ML/CL
other
Fluoroquinolones (n=50)
AG
ML/CL
All primary drugs (n=1223)
AG
FQ
ML/CL
0.1
Kumar et al, Crit Care Med
2010;38:1773–85
1
n
p value
1289
1349
1072
938
.04
.002
01
.01
.51
145
89
87
90
.78
.69
.98
.43
91
62
.38
.65
65
1749
1781
1403
.046
.0009
.006
10
95
Hazard Ratio
Combination vs Monotherapy:
Organisms n p value
GAS
non-GAS strep
viridans strep
S. pneumoniae
S. aureus
Enterococcus sp
94
63
60
282
267
59
829
.56
.16
.68
.01
.10
.30
.008
E. coli
Klebsiella sp
Enterobacter sp
other enterobacteriaciae
759
283
106
138
1286
200
63
47
310
1617
.14
.25
.36
.69
.04
.27
.30
.74
.12
.009
all gram +
all enterobacteriaciae
Ps. aeruginosa
Hemophilus sp
other non-enterobacteriaciae
all non-enterobacteriaciae
all gram -
0.1
Kumar et al, Crit Care Med
2010;38:1773–85
1
Hazard Ratio
10
96
44
Combination vs Monotherapy:
Clinical Syndrome
n p value
Primary BSI
CRI
RTI
138
102
888
.62
.45
.003
UTI
IAI
453
547
15
.15
.42
CNSI
SSTI
25
235
SSI
ITI (non-resp)
32
15
.20
.25
.07
.64
1558
966
.02
.04
1480
1249
1197
.0009
.003
.02
all non-resp inf
SC+ inf
SC- inf
bacteremic inf
non-bacteremic inf
0.01
Kumar et al, Crit Care Med
2010;38:1773–85
0.1
1
10
Continuous vs Intermittent
Cefamandole +
Intermittent Carbenicillin
Intermittent cefamandole
Continuous cefamandole
*
100
% response
24
*
80
74
60
40
29
92
14
†
8
24
31
14
20
6
20
97
Hazard Ratio
7
30
28
7
5
0
Bodey et al, Am J Med 1979
98
45
99
Outcome of S. aureus Septic Shock in
Relationship to Nature of Antibiotic Therapy
% Survival
50
n =133
40
n=92
30
n = 75
20
10
0
B-lactam
Vancomycin
Clindamycin
/macrolide
Primary Therapy 1st 24 hours
100
46
Eventually, Billy
came to dread his
father’s lectures
over all
ll other
th forms
f
of punishment.
101
47
Phase 2 trial of eritoran tetrasodium (E5564), a Toll-like receptor 4
antagonist, in patients with severe sepsis*
Mark Tidswell, MD; William Tillis, MD; Steven P. LaRosa, MD; Melvyn Lynn, PhD; Alec E. Wittek, MD;
Richard Kao, MS; Janice Wheeler BS, RN; Jagadish Gogate, PhD; Steven M. Opal, MD; and the Eritoran
Sepsis Study Group
Objectives: Endotoxin is a potent stimulus of proinflammatory
response and systemic coagulation in patients with severe sepsis.
Endotoxin is a component of Gram-negative bacteria that triggers
an innate immune response through Toll-like receptor 4 signaling
pathways in myeloid cells. We evaluated safety and tolerability of
two dose regimens of eritoran tetrasodium (E5564), a synthetic
Toll-like receptor 4 antagonist, and explored whether it decreases
28-day mortality rate in subjects with severe sepsis.
Design: Prospective, randomized, double-blind, placebo-controlled, multicenter, ascending-dose phase II trial.
Setting: Adult intensive care units in the United States and
Canada.
Patients: Three hundred adults within 12 hrs of recognition of
severe sepsis, with Acute Physiology and Chronic Health Evaluation
(APACHE) II-predicted risk of mortality between 20% and 80%.
Interventions: Intravenous eritoran tetrasodium (total dose of
either 45 mg or 105 mg) or placebo administered every 12 hrs for
6 days.
Measurements and Main Results: Prevalence of adverse events
was similar among subjects treated with 45 mg or 105 mg of
E
eritoran tetrasodium or with placebo. For modified intent-to-treat
subjects, 28-day all-cause mortality rates were 26.6% (eritoran
tetrasodium 105 mg), 32.0% (eritoran tetrasodium 45 mg), and
33.3% in the placebo group. Mortality rate in the eritoran tetrasodium 105-mg group was not significantly different from placebo (p ⴝ .335). In prespecified subgroups, subjects at highest
risk of mortality by APACHE II score quartile had a trend toward
lower mortality rate in the eritoran tetrasodium 105-mg group
(33.3% vs. 56.3% placebo group, p ⴝ .105). A trend toward a
higher mortality rate was observed in subjects in the lowest
APACHE II score quartile for the eritoran 105-mg group (12.0% vs.
0.0% placebo group, p ⴝ .083).
Conclusions: Eritoran tetrasodium treatment appears well tolerated. The observed trend toward a lower mortality rate at the
105-mg dose, in subjects with severe sepsis and high predicted
risk of mortality, should be further investigated. (Crit Care Med
2010; 38:72– 83)
KEY WORDS: severe sepsis; eritoran tetrasodium; E5564; Toll-like
receptor; sepsis; endotoxin antagonist
ndotoxin (lipopolysaccharide)
is the major constituent of the
outer membrane of both
Gram-negative pathogenic
bacteria and normal enteric Gramnegative flora. Endotoxin, when administered intravenously to healthy volunteers, stimulates proinflammatory and
thrombotic responses observed in severe
sepsis patients (1, 2). Patients with severe
sepsis initiated by Gram-negative organ-
isms, Gram-positive organisms, and fungi
have high plasma levels of endotoxin (3).
Release of endogenous endotoxin from
the gut and liver due to splanchnic hypoperfusion is thought to explain this phenomenon (3). Sepsis patients with high
levels of plasma endotoxin activity have
an increased mortality rate (1). Although
the immune response initiated by endotoxin may be protective and act as an
early warning sign of microbial invasion,
*See also p. 306.
From the Division of Critical Care Medicine, Baystate Medical Center, Springfield, Massachusetts (MT);
University of Illinois, College of Medicine, Peoria, Illinois (WT); Warren Alpert School of Medicine, Brown
University, Providence, Rhode Island (SPL, SMO); and
Eisai Medical Research, Ridgefield Park, New Jersey
(ML, AEW, RK, JW, JG).
Supported, in part, by Eisai Medical Research,
Ridgefield Park, New Jersey.
Dr. Tidswell has consulted for Eisai Medical Research. Dr. Lynn has employment and patents with
Eisai Medical Research. Dr. LaRosa has received honoraria from the Clinical Evaluation Committee. Dr. Kao
has been employed with Eisai Medical Research. Dr.
Wittek has employment from Eisai Medical Research.
Dr. Wheeler has received employment and has stock
ownership in Eisai Medical Research. Dr. Opal has
received grant support from Eisai Preclinical grant. The
remaining authors have not disclosed any potential
conflicts of interest.
For information regarding this article, E-mail:
mark.tidswell@baystatehealth.org
Copyright © 2009 by the Society of Critical Care
Medicine and Lippincott Williams & Wilkins
72
DOI: 10.1097/CCM.0b013e3181b07b78
the adverse effects of widespread inflammation, coagulopathy, and vascular compromise seen in severe sepsis are often
detrimental. Endotoxin is transferred
from the bacterial cell wall by a human
lipopolysaccharide binding protein to
membrane-bound CD-14 found on the
cell surface of myeloid cells of the innate
immune system. A signaling complex
forms, consisting of endotoxin, an adaptor protein (MD-2), and a transmembrane
protein known as Toll-like receptor 4
(TLR4) (4 –7). The lipid A portion of endotoxin binds to a complex of TLR4 and
MD-2 via hydrophobic and electrostatic
forces (8, 9). Subsequent dimerization of
these complexes of endotoxin bound to
TLR4-MD-2 leads to intracellular signaling, production of nuclear factor-␬ B, and
ultimately proinflammatory cytokines.
In the past, therapies designed to interfere with endotoxin did not improve
outcome (10 –21). However, new therapeutic targets are suggested by recent
discoveries that reveal how endotoxin
Crit Care Med 2010 Vol. 38, No. 1
triggers cell signaling and inflammation
by interacting with TLR4.
Eritoran tetrasodium (E5564) is a synthetic lipopolysaccharide designed to interfere with endotoxin signaling via the
TLR4 receptor. The structure of the molecule is based on the lipid A portion of a
naturally occurring, weakly agonistic endotoxin found in Rhodobacter sphaeroides (22–25). Eritoran tetrasodium is
a potent in vitro antagonist of endotoxin
(24, 25) that directly binds to the hydrophobic pocket of MD-2, competitively inhibits the lipid A component of endotoxin
from binding to the same site, and
thereby prevents dimerization of TLR4
and intracellular signaling (4, 9).
Eritoran tetrasodium is significantly
protective in animal models of sepsis
(24). In a placebo-controlled human endotoxin challenge model in healthy volunteers, eritoran tetrasodium blocked
the signs and symptoms of endotoxemia
in a dose-dependent manner. Elevations
in temperature, heart rate, white blood
cell count, and serum levels of inflammatory markers (C-reactive protein, tumor
necrosis factor-␣, and interleukin [IL]-6)
were reduced or prevented in eritoran
tetrasodium-treated volunteers compared
with placebo (26).
This randomized, double-blind, placebo-controlled phase II trial was designed
to assess the safety and efficacy of eritoran tetrasodium in early severe sepsis and
to determine a potential therapeutic
dose. Pharmacokinetic modeling, based
on the data from phase I studies, was
used to select the two dose levels, the
dosing schedule (every 12 hrs), and the
6-day treatment duration used in this
study. This report summarizes the
safety and efficacy outcomes for eritoran tetrasodium-treated patients with
severe sepsis.
MATERIALS AND METHODS
the recognition of severe sepsis. Eligible subjects had an Acute Physiology and Chronic
Health Evaluation (APACHE) II score that predicted a risk of mortality within the range of
20% to 80%. APACHE II scores were determined using physiologic data from a 24-hr
period before randomization, and risk of mortality was calculated from the score by applying weights based on intensive care unit admitting diagnosis (27).
Severe sepsis was defined as the presence
of at least three of four criteria for systemic
inflammatory response syndrome due to a
presumed or known site of infection Appendix 1) (28) in association with at least one of
the following sepsis-induced organ dysfunctions: refractory shock, renal dysfunction,
hepatic dysfunction, or metabolic acidosis
(Appendix 2). Key exclusion criteria are
listed in Appendix 3.
The primary efficacy end point was the
28-day all-cause mortality rate in the modified
intent-to-treat (MITT) group. The MITT group
included all randomized subjects who received
any amount of eritoran tetrasodium or placebo.
A clinical evaluation committee determined a clinically evaluable population, a subset of the MITT population, after subjects
completed 28 days of study but before data
unblinding, based on six characteristics defined a priori: 1) subjects who were study drug
compliant (received two loading doses and at
least four maintenance doses or until resolution of all signs and symptoms of sepsis if this
occurred earlier), including subjects who died
or discontinued study drug for a serious adverse event (SAE) regardless of duration of
dosing; 2) subjects who met all inclusion criteria, including those for organ failure and
objective evidence of infection; 3) subjects
who were given appropriate antibiotics and
other sepsis therapy; 4) subjects who had a
predicted mortality rate of 20% to 80% by
APACHE II score at screening; 5) subjects who
did not have major surgery through day 10
(this was for assessment of organ failure only);
and 6) subjects who had no serious protocol
violation.
Study Design
Subjects
Between January 2002 and April 2005, we
enrolled eligible adult patients from intensive
care units in 99 hospitals in the United States
and Canada. Independent ethics committees
or institutional review boards at each study
center approved the study protocol. Each subject, or a legally authorized surrogate, gave
written informed consent. Eligible subjects
were nonpregnant women and men aged 18 to
85 yrs with severe sepsis thought to be caused
by bacterial or fungal pathogens. Study medication was to be administered within 12 hrs of
Crit Care Med 2010 Vol. 38, No. 1
Study Drug and Administration. Eritoran
tetrasodium was synthesized by Eisai Research
Institute of Boston (Andover, MA) as previously described (22, 25). Two dose regimens
were compared with placebo. The dose regimens were 45 mg or 105 mg total dose administered over 6 days. Both regimens were
initiated with two loading doses, followed by
nine maintenance doses, all given at 12-hr
intervals. Both doses were anticipated to
achieve plasma concentrations that exceeded
the 100% inhibitory concentration of eritoran
tetrasodium in ex vivo assays of endotoxin
challenge and were ⱖ50% less than the max-
imum dose previously tested in humans (29).
The infusion volumes for the eritoran tetrasodium and placebo groups were identical regardless of the dose. Investigators were encouraged to deliver the drug only through a
central venous catheter of a brand compatible
with the formulation of the drug. Catheters
with chlorhexidine-coated lumens were contraindicated.
Randomization and Blinding. This was a
double-blind, placebo-controlled phase II clinical trial. Allocation concealment was maintained using a central phone office qualification and randomization center. To use the
available drugs at each site efficiently, block
randomization was conducted at a site level
within the APACHE II-predicted mortality
strata (low, 20% to 50%; high, 51% to 80%).
Each site had two sequences of drug assignment based on APACHE II-predicted mortality
rate: one sequence for subjects with predicted
mortality rate 20% to 50%, and another sequence for subjects with predicted mortality
rate 51% to 80%. This was done to yield a
balanced allocation of high and low APACHE
II-predicted mortality rate within the three
treatment groups. The study was conducted in
three stages to establish safety of a total dose
of 45 mg of eritoran tetrasodium before proceeding to the higher dose of 105 mg. In the
first stage, 50 subjects were randomized 1:1 to
placebo or eritoran tetrasodium 45 mg, after
which an independent data monitoring committee conducted a planned, grouped, but
blinded interim safety analysis. In the second
stage, 75 subjects were randomized (1:1:1) to
placebo, eritoran tetrasodium 45 mg, or eritoran tetrasodium 105 mg, and another safety
analysis was conducted. In the third stage, 175
subjects were randomized (2:2:3) to placebo,
eritoran tetrasodium 45 mg, or eritoran tetrasodium 105 mg to attain 100 subjects per
group for the entire study. Interval analyses by
the data monitoring committee included mortality rate in each group without unblinding
the groups. Unblinding would only have been
done if there were statistical differences in
groups, but there were none. The data monitoring committee adopted no predesignated p
values for analyzing the 28-day SAE rate and
used clinical judgment during review of the
first 125 trial subjects. Because of multiple
blinded looks, a small statistical penalty would
have been taken on the composite p value if
significant.
Sepsis Management. With the exception of
the study drug infusion, treating physicians
dictated care, including all decisions regarding the volume of fluid resuscitation given,
choice and dosage of vasopressors, choice and
duration of antibiotics, mechanical ventilation
settings, use of corticosteroids and drotrecogin alfa (activated) (DAA; recombinant human
activated protein C, Xigris, Eli Lilly & Co.,
Indianapolis, IN).
Data Collection. After informed consent,
but before randomization, a physical examination, APACHE II score, documentation of in-
73
1029 calls to randomization center
615 Subjects lacked one or more inclusion criteria:
89 Unable to obtain informed consent
6 Age above 85 or below 18 years of age
2 Pregnant
152 No qualifying organ failure of severe sepsis
44 Did not meet SIRS criteria
183 More than 8 or 12 hours from time severe sepsis
recognized
139 APACHE II predicted mortality outside 20−80%
114 Subjects with principal exclusion criteria:
15 Cardiogenic or hypovolemic shock
1 Acute 3rd-degree burns involving ≥20% BSA
1 Nonautologous organ transplant within past year
7 Hemorrhage requiring transfusion of >2 units of
blood/platelets in previous 24 hours
17 Classified as “do not resuscitate” or “do not treat”
37 SIRS and organ failure less than 36 hours after
trauma or surgery
12 Planned or current use of DAA for subjects with
APACHE II score <25
24 Other
300 subjects randomized
Placebo
Low Dose (45 mg)
High Dose (105 mg)
100 subjects
103 subjects
97 subjects
No drug given, n = 4
Modified
i t tt t
intent-to-treat
t
96 subjects
Clinically
evaluable
78 subjects
No drug given, n = 3
103 subjects
80 subjects
Safety and Efficacy Measures
The safety and tolerability end points included the frequency of treatment-emergent
AEs (TEAEs) and SAEs, clinically significant
laboratory values, changes in vital signs, and
physical examination findings. AEs and SAEs
74
Statistical Analysis
94 subjects
77 subjects
Figure 1. Flow diagram showing the total number of study participants with severe sepsis randomized
to receive eritoran tetrasodium (45 mg or 105 mg) or placebo. Four patients randomized to placebo
and three patients randomized to eritoran tetrasodium 105 mg did not receive any study medication.
These seven patients were not included in the modified intent-to-treat population for analyses. BSA,
body surface area; SIRS, systemic inflammatory response syndrome; APACHE, Acute Physiology and
Chronic Health Evaluation; DAA, drotrecogin alfa (activated).
fection, and laboratory determinations (including human chorionic gonadotropin) were done.
After randomization, but before study drug administration, the baseline data were collected.
All patients were followed for the 28-day study
period for organ failure, adverse events (AEs),
and concomitant medications. Blood cultures
were collected until eradication of pathogen was
documented. Clinical laboratory tests were performed on days 1–10, 14, and 28, except for IL-6,
which was collected on days 1–3. Daily arterial
blood gas determinations were performed until
subjects were removed from mechanical ventilation or day 28. All-cause mortality rate was
determined on day 28.
rum chemistry values at baseline and on days
1–10, 14, and 28.
Endotoxin and IL-6 Measurements. Samples for baseline measurement of endotoxin
(whole blood, chromogenic Limulus amebocyte lysate assay, detection limit 0.01 endotoxin unit (EU)/mL; Associates of Cape Cod,
East Falmouth, MA) were collected in an
endotoxin-free tube (Chromogenix, Franklin,
OH), centrifuged to separate plasma, and frozen until analysis. Serum samples for endotoxin and for baseline IL-6 (baseline, 12 hrs,
and 48 hrs after the start of study drug infusion; chemiluminescence assay, detection
limit 5 pg/mL) were analyzed by a central
referral laboratory (Specialty Laboratories, Valencia, CA).
E5564 Pharmacokinetics. Blood samples
were obtained at three different time points to
measure eritoran tetrasodium levels by reverse-phase liquid chromatography-tandem
mass spectrometry assay for the purposes of
performing population pharmacokinetic analysis (29). A sparse sampling design (three samples per patient) was obtained according to a
randomization scheme throughout the 6 days
of the dosing period and during the elimination phase up to 238 hrs after the last dose.
were defined according to standard regulatory
definitions. TEAEs were defined as events that
were new in onset or aggravated in severity or
frequency and abnormal results of diagnostic
procedures between randomization and day 28
or the end of treatment. Abnormal laboratory
values were considered AEs if they led to any
type of intervention, as determined by investigators. A clinical evaluation committee reviewed all infectious AEs and classified these
as either worsening of preexisting infection, a
new infection (a distinct infectious episode
after resolution of the sepsis-defining episode), or a superinfection (a distinct infectious
episode beginning before the sepsis-defining
infection had resolved).
Safety Laboratory Measures
Hematology and Chemistry Measurements. Local laboratories measured complete
blood cell counts, coagulation tests, and se-
Data were analyzed by a prospectively defined plan. Separate analysis compared mortality rates of subjects treated with placebo
with mortality rates of a) all subjects treated
with eritoran tetrasodium; b) subjects treated
with low-dose (45 mg) eritoran tetrasodium; and
c) subjects treated with high-dose (105 mg) eritoran tetrasodium. Statistical inference for the
primary end point was based on the CochranMantel-Haenszel (CMH) chi-square test. One
subject who completed a treatment course of
eritoran tetrasodium 105 mg refused study participation after day 8 but was known to be alive
at day 28 and was included in the MITT analysis.
Sample size selected for this study was anticipated to have a statistical power of 0.55 to detect
a 15% difference in mortality rates. An explicit
power calculation was not performed.
Six variables were identified a priori to
define subgroups for further analysis of 28-day
mortality rate: four APACHE II score quartiles
and the presence of shock or absence of shock
at baseline. The MITT population was divided
into roughly equal quartiles based on APACHE
II scores: quartile 1, score ⬍21; quartile 2,
score 21–24; quartile 3, score 25–28; quartile
4, score ⬎28. An APACHE II score of 24.5 was
the mean score for the MITT population. The
APACHE II score quartiles and predicted mortality rate were correlated, in that for all patients with an APACHE II score ⱖ25, predicted
mortality rate was in the range of 51% to 80%.
Statistical testing of subgroups compared
mortality rate in subjects treated with placebo
Crit Care Med 2010 Vol. 38, No. 1
Table 1. Baseline characteristics of modified intent-to-treat patients
Characteristic
Placebo
(n ⫽ 96)
Eritoran
Tetrasodium
45 mg
(n ⫽ 103)
Eritoran
Tetrasodium
105 mg
(n ⫽ 94)
Mean age, yrs (SD)
60.6 (16.7)
57.5 (16.3)
59.1 (15.8)
Female gender, %
41.7
54.4
47.9
Caucasian race, %
77.1
68.0
73.4
Mean weight, kg (SD)
86.0 (28.0)
89.1 (38.0)
86.0 (24.8)
Mean APACHE II score (SD)
24.9 (5.8)
24.7 (5.5)
24.0 (5.2)
Mean predicted mortality
53.1 (18.6)
52.6 (18.0)
52.5 (17.6)
rate by APACHE
II score, % (SD)
Met SIRS criteria at baseline, %
Heart rate
95.8
96.1
94.7
Respiratory
90.6
92.2
94.7
Temperature
70.8
70.9
72.3
White blood count
88.5
79.6
70.2
SOFA cardiovascular
72.9
76.7
80.9
component ⱖ2, %
Organ failure qualifying
subject for study, %
Refractory shock
45.8
52.4
52.1
Respiratory failure
20.8
17.5
19.1
Acute renal failure
21.9
17.5
20.2
Acute metabolic acidosis
11.5
12.6
8.5
Acute liver dysfunction
0
0
0
Number of organ failures, n (%)a
0
0 (0.0)
1 (1.0)
1 (1.1)
1
23 (24.0)
14 (13.6)
15 (16.0)
2
27 (28.1)
38 (36.9)
35 (37.2)
3
25 (26.0)
36 (35.0)
25 (26.6)
4
19 (19.8)
8 (7.8)
10 (10.6)
5
2 (2.1)
4 (3.9)
7 (7.4)
6
0 (0.0)
2 (1.9)
1 (1.1)
Day 0 detectable but not
22
28
21
b
elevated endotoxin level (%)
Day 0 detectable and elevated
69
66
77
endotoxin level (%)b
Mean day 0 serum IL-6, pg/mL (SD) 27,192 (99,329) 16,667 (75,074) 37,789 (124,806)
Concomitant therapies
Drotrecogin alfa (activated), n (%)
16 (16.7)
26 (25.2)
16 (17.0)
Systemic corticosteroids, n (%)
50 (52.1)
59 (57.3)
56 (59.6)
Overall p
Valuec
.4020
.2041
.4116
.7221
.5736
.9711
.8810
.5508
.9729
.0072
.4342
Crit Care Med 2010 Vol. 38, No. 1
RESULTS
Baseline Characteristics
.9076
.0502
.2160
.3503
.2428
.5459
APACHE, Acute Physiology and Chronic Health Evaluation; SIRS, systemic inflammatory response
syndrome; SOFA, Sequential Organ Failure Assessment; IL, interleukin.
a
Number of patients with each sum (1– 6) of the number of organ failures, where organ failure is
defined as a SOFA score ⱖ2 for an organ system (cardiovascular, respiratory, liver, renal, coagulation,
central nervous system); bEndotoxin was detectable in the range of 0.01– 0.2 endotoxin units (EU)/mL.
Endotoxin levels were considered elevated when ⱖ0.2 EU/mL; cOverall p value, the result of statistical
comparison of placebo-treated subjects vs. all (pooled) subjects treated with eritoran tetrasodium. P
values were derived from Fisher’s exact test (gender, race, SIRS, SOFA, organ failure, endotoxin level,
drotrecogin alfa 关activated兴 therapy, corticosteroid therapy), Chi-square test (number of organ failures)
or analysis of variance (age, height, weight, APACHE II score, IL-6).
to subjects who received high-dose (105 mg)
eritoran tetrasodium, using Fisher’s exact test.
Bonferroni multiplicity adjustment required
␣ ⱕ .008 for statistical significance.
We also performed exploratory sensitivity
analyses on the primary end point of 28-day
mortality rate based on three variables: clinically evaluable subjects (CMH chi-square test),
subjects with no use of DAA (CMH chi-square
test), and survival distribution (Kaplan-Meier
product limit and log-rank test).
Additional exploratory tests were planned
to identify which of the following categorical
After conclusion of the study, it became
known that unblinding information might
have been included in shipment of study
drug for up to 40 subjects at 14 study sites.
However, pharmacy personnel at these study
sites stated that unblinded information was
not given to investigators and clinical personnel. Mortality analysis of the MITT population excluding these potentially unblinded patients produced results similar to
those of the entire MITT population.
Statistical testing was performed with version 8.02 of the Statistical Analysis System
(SAS Institute, Cary, NC).
covariates might interact on the primary end
point: APACHE II-predicted mortality rate
(low or high), type of pathogen, age (ⱕ65 or
⬎65 yrs), stage of study (I, II, or III), use of
DAA during the study period, baseline endotoxin level (detectable or ⱖ0.2 EU/mL), baseline high-density lipoprotein level (⬍25 or
ⱖ25 mg/dL), time to drug infusion (⬍8 or
8 –12 hrs), center by geographical location
(United States or Canada), and center by size
(small, medium, large). Construction of a
multivariate model was planned for any covariates with statistical significance p ⬍ .05.
A total of 300 subjects were randomly
assigned to the three intervention
groups. Seven subjects did not receive
any study drug. The 293 MITT subjects
(Fig. 1) were randomized as follows: 96
subjects to placebo, 103 subjects to eritoran tetrasodium 45 mg, and 94 subjects
to eritoran tetrasodium 105 mg.
Baseline characteristics for eritoran
tetrasodium- and placebo-treated subjects are shown in Table 1. There were no
significant differences in baseline demographics, acute physiologic abnormalities, chronic health problems, and number of organ failures. Refractory shock
was present at baseline in 76.8% of all
subjects. Shock was the most common
qualifying organ system failure (50.1% of
all study subjects), followed by acute renal dysfunction and respiratory failure.
The groups did not differ significantly in
mean baseline APACHE II scores and had
similar proportions of subjects with high
APACHE II-predicted risk of mortality.
Stress-dose corticosteroids were given by
treating physicians in 27.6% of all subjects. Circulating endotoxin (ⱖ0.01 EU/
mL) was detected at baseline in ⱖ71% of
subjects from each group. Median baseline endotoxin levels were similar between groups, with a wide range of values
within each of the three groups. Endotoxin values were higher in subjects with
high APACHE II-predicted mortality rate.
Baseline IL-6 values varied widely in the
three groups but were not statistically
different between treatment groups.
The most common focus of infection
(Table 2) was the lung in all groups,
followed by intra-abdominal and urinary tract infections. Culture results
75
Table 2. Characteristics of infection
Placebo
(n ⫽ 96)
Characteristic
Primary focus of
infection, n (%)
Pulmonary
Intra-abdominal/gynecologic
Urinary tract
Skin/soft tissue
Indwelling catheter
Unknown
Other
No evidence of infection
Infection type, n (%)
Gram-negative
Gram-positive
Mixed bacterial
Fungal
Viral
Unknown
Bacteremia, without focal
infection, n (%)
Bacteremia, with focal
infection, n (%)
Adequate antimicrobial
therapy, n (%)
Subject Disposition
Eritoran
Tetrasodium 45 mg
(n ⫽ 103)
Eritoran
Tetrasodium 105 mg
(n ⫽ 94)
Overall
p Valuea
.5054
38 (39.6)
20 (20.8)
13 (13.5)
5 (5.2)
2 (2.1)
3 (3.1)
7 (7.2)
8 (8.3)
39 (37.9)
14 (13.6)
13 (12.6)
7 (6.8)
8 (7.8)
8 (7.8)
4 (3.9)
10 (9.7)
29 (31.2)
15 (16.1)
18 (19.4)
7 (7.5)
5 (5.4)
9 (9.7)
5 (5.4)
5 (5.4)
26 (27.1)
30 (31.3)
10 (10.4)
1 (1.0)
1 (1.0)
17 (17.7)
3 (3.1)
23 (22.3)
38 (36.9)
7 (6.8)
4 (3.9)
2 (1.9)
18 (17.5)
10 (9.7)
29 (31.2)
29 (31.2)
13 (14.0)
1 (1.1)
0 (0)
15 (16.1)
8 (8.5)
25 (26.1)
29 (28.1)
26 (27.7)
87 (91)
91 (88)
85 (90)
.6944
Safety
a
Overall p value, the result of statistical comparison of placebo-treated subjects vs. all (pooled)
subjects treated with eritoran tetrasodium, derived from Cochran-Mantel-Haenszel chi-square test.
Table 3. Treatment-emergent signs and symptoms occurring in ⬎5% of patients in the 105-mg dose
group
Anemia
Thrombocytopenia
Atrial fibrillation
Bradycardia
Constipation
Diarrhea
Pneumonia
Sepsis
Urinary tract infection
Hyperglycemia
Hypoglycemia
Hypokalemia
Hypomagnesemia
Agitation
Insomnia
Acute renal failure
Pleural effusion
Pulmonary edema
Respiratory failure
Rash
Hypertension
Hypotension
a
Placebo
(n ⫽ 96)%
Eritoran
Tetrasodium
45 mg
(n ⫽ 103)%
Eritoran
Tetrasodium
105 mg
(n ⫽ 94)%
p Valuea Eritoran
Tetrasodium vs.
Placebo
16.7
8.3
7.3
5.2
2.1
8.3
9.4
13.5
15.6
7.3
5.2
13.5
9.4
9.4
1.0
1.0
5.2
5.2
14.6
5.2
4.2
11.5
18.4
8.7
4.9
3.9
10.7
9.7
6.8
14.6
8.7
7.8
3.9
12.6
10.7
5.8
2.9
3.9
1.9
5.8
6.8
8.7
9.7
7.8
23.4
5.3
12.8
9.6
9.6
11.7
5.3
13.8
17.0
6.4
7.4
8.5
7.4
8.5
5.3
6.4
5.3
5.3
8.5
9.6
7.4
6.4
.3333
.4202
.1807
.2248
.0442
.4466
.2828
.9304
.3863
.8027
.5151
.3218
.6672
.7787
.0941
.0533
.9967
.9838
.1626
.2547
.3686
.1715
Overall p value derived from Cochran-Mantel-Haenszel chi-square test.
demonstrated a higher rate of Grampositive (34.2% overall) than Gram-negative (26.5% overall) infection. In all MITT
subjects, bacteremia was identified in 101
subjects across all treatment groups
76
Of the 293 subjects who received study
drug, 195 (67%) completed the 28-day
observation period. Ninety-eight subjects
(33%) discontinued treatment before
study completion because of AEs, including death (29.7%), consent withdrawal
(1.4%), or other reasons (2.4%). Overall,
30.7% (n ⫽ 90) of all subjects died during
the 28-day observation period, and 47.8%
of the deaths occurred during the 6-day
infusion period.
(34.5%), definite bacterial focal site of infection was identified in 66.9%, definite or
possible fungal infections were identified in
1.0%, and no evidence of infection (or unlikely focal infection) was present in 8.5%.
Drug Exposure. Four of the 293 MITT
subjects received fewer than four doses of
study drug (one placebo, two in the
45-mg group, one in the 105-mg group).
All other subjects received at least four
doses or died during the 6-day infusion
period. Median plasma drug levels were
2206 ng/mL in the eritoran tetrasodium
45-mg group and 4338 ng/mL in the
eritoran tetrasodium 105-mg group,
which would have been sufficient to
completely block amounts of endotoxin
usually observed in patients with severe
sepsis (3, 29).
Adverse Events. A total of 280 subjects
(95.6% of all subjects) had at least one
TEAE (Table 3). TEAEs did not prevent
any subjects from receiving the full dose
of study drug for 6 days. In the eritoran
tetrasodium-treated subjects, anemia, diarrhea, insomnia, acute renal failure, and
rash were observed more frequently than
in placebo-treated subjects, although not
at a statistically significantly higher rate.
SAEs occurred in 71.9% of placebo
subjects, 95.1% of eritoran tetrasodium
45-mg subjects, and 74.5% of eritoran
tetrasodium 105-mg subjects. SAEs that
occurred in 5% of subjects in one or
more treatment groups included cardiac
arrest, multiorgan failure, sepsis, respiratory failure, and deep vein thrombosis. Four eritoran tetrasodium-treated
subjects experienced a hepatobiliary
SAE, compared with none in the placebo group. Three of the four subjects
with hepatic SAEs had preexisting liver
disease.
Atrial fibrillation occurred at a higher
rate in the eritoran tetrasodium 105-mg
group compared with the placebo group
(p ⫽ .18). Instances of atrial fibrillation
were mild or moderate and unrelated to
study drug administration.
Phlebitis occurred in 3.0% of eritoran
tetrasodium-treated groups and did not
Crit Care Med 2010 Vol. 38, No. 1
Table 4. Infectious adverse events (%)
Infectious Adverse Events
Placebo
(n ⫽ 96)
Eritoran
Tetrasodium
45 mg
(n ⫽ 103)
Eritoran
Tetrasodium
105 mg
(n ⫽ 94)
Overall
p Valuea
50.5
45.6
37.0
.2001
36.8
35.0
38.0
.8967
Investigator-reported infectious
complication
Clinical evaluation committee
determination of infectious
complicationb
a
Overall p value is based on the approximation of count; bFisher’s exact test was used.
Infectious adverse events were defined as either a) recurrent infection at the same site as the
sepsis-initiating infection, either relapse of the same organism, or superinfection by a different
organism; or b) new infection occurring at a different site than the sepsis-initiating infection.
Mortalityy in
Modified intent-to-treat population
(n = 293)
p = 0.335
Percent 28--day Morta
P
ality
50
p = 0.846
40
33.3
32.0
26.6
30
20
10
0
Placebo
45 mg
105 mg
Treatment Group
Figure 2. All-cause mortality rate at day 28 by treatment group. In the modified-intent-to-treat population, eritoran tetrasodium 105 mg did not result in a
statistically significant decrease compared with placebo (Cochran-Mantel-Haenszel chi-square test, p ⫽
.335).
a
occur in the placebo-treated group (p ⫽
.21, chi-square). The frequency of phlebitis was 1.5% and 1.6% in the eritoran
tetrasodium 45-mg and 105-mg treatment groups, respectively, when the drug
was administered via a central venous
catheter. The rate was higher (5.7% to
6.7%) among the 65 subjects who received one or more doses of eritoran tetrasodium through a peripheral venous
catheter. Venous thrombosis occurred in
26 subjects (8.9%) and was independent
of eritoran tetrasodium treatment status
(10.4% placebo group, 10.7% eritoran
tetrasodium 45-mg group, and 5.3% eritoran tetrasodium 105-mg group).
The occurrence of infectious complications (AEs) reported by study investigators did not differ significantly among
groups (Table 4). Infectious AEs included
worsening of sepsis, new infection, and
b
Mortality by APACHE II Quartile
p= 0.105
60
50
Percent 28-Day M
Mortality
Percen
nt 28-Day M
Mortality
60
p= 0.913
p= 0.503
40
30
20
Mortality by Presence of Shock
p= 0.083
10
0
50
40
p=0.598
p=0.434
34.6%
28.9%
30
31.8%
24.5%
20
10
0
1
2
3
APACHE II Quartile
4
No Shock
Shock
Presence of Shock at Baseline
Figure 3. Prespecified subgroup analyses. Mortality rate in subjects treated with 105 mg of eritoran tetrasodium (n ⫽ 94, black bars) compared with placebo (n ⫽ 96, white bars). a, Effect of Acute Physiology and Chronic
Health Evaluation (APACHE) II score quartile on 28-day all-cause mortality rate in modified intent-to-treat
population. Quartile 1 corresponds to score ⬍21 (105-mg subjects, n ⫽ 25; placebo, n ⫽ 23); quartile 2, score
21–24 (105-mg subjects, n ⫽ 22; placebo, n ⫽ 22); quartile 3, score 25–28 (105-mg subjects, n ⫽ 26; placebo,
n ⫽ 19); quartile 4, score ⬎28 (105-mg subjects n ⫽ 21; placebo n ⫽ 32). b, effect of presence or absence of shock
on 28-day all-cause mortality rate in modified-intent-to-treat population.
Crit Care Med 2010 Vol. 38, No. 1
superinfection. The clinical evaluation
committee found insufficient objective
data for 55% of the investigator-reported
infectious AEs.
Safety Laboratory Tests. The three
groups had similar mean values of aspartate transaminase, 5⬘-nucleotidase, and
leucine aminopeptidase throughout the
28-day study. Compared with placebo, the
eritoran tetrasodium 105-mg group had
more episodes of leukocytosis (p ⫽ .029),
more episodes of elevated creatinine (p ⫽
.03), and more episodes of elevated alanine transaminase (p ⫽ .086). Autopsies,
or postmortem liver tissue samples from
11 (12.2%) of the 90 subjects who died,
showed no pathologic findings related to
eritoran tetrasodium treatment.
Mortality Analyses
In the MITT population, all-cause 28day mortality rate did not differ significantly between the subjects treated with
eritoran tetrasodium 45 mg or 105 mg
compared with placebo (Fig. 2). While the
observed 28-day mortality rate in the
MITT population was 6.7% lower in subjects treated with eritoran tetrasodium
105 mg compared with placebo, this observation was not statistically significant
(p ⫽ .335).
Subgroup Analyses. The effect of
treatment with the higher dose (105 mg)
on 28-day all-cause mortality rate was
further analyzed in prespecified subgroups (Fig. 3). Although lower mortality
rates were observed in subjects treated
with eritoran 105 mg compared with placebo, within APACHE II quartiles 2 and 4,
the differences observed were not statistically significant. Mortality rates for subjects in APACHE II quartiles 1 and 3 were
higher for the group that received eritoran tetrasodium 105 mg compared with
placebo, but these differences also were
not significant statistically. For the subjects in the lowest quartile of APACHE II
scores (⬍21), mortality rate was higher
in the eritoran tetrasodium 105-mg
treated group (12.0% vs. 0.0% placebo,
CMH chi-square test, p ⫽ .083).
In subgroups of the MITT population,
based on the presence of shock or no
shock at baseline, mortality rate was not
significantly lower for subjects who received 105 mg of eritoran tetrasodium
compared with placebo (Fig. 3b).
Sensitivity Analyses. We performed
three predefined sensitivity analyses to
investigate the primary end point. These
analyses were intended to be exploratory
77
only, and all observations of lower mortality rates were not statistically significant. First, in the population of clinically
evaluable subjects (Fig. 4a and Methods),
28-day mortality rate was 12.5% lower in
the eritoran tetrasodium 105-mg group
compared with placebo. Second, in the
population that did not receive DAA, 28day mortality rate was 6.9% lower in the
eritoran tetrasodium 105-mg group com-
Mortality in Important Subpopulations
Clinically Evaluable Population,
n=235
a
40
34.6
p = 0.36
50
Pe
ercent 28-D
Day Mortality
Pe
ercent 28-d
day Mortallity
b
p = 0.094
50
No DAA (Xigris) Population,
n=225
32.5
30
22 1
22.1
20
10
40
35.1
31.3
30
24.4
20
10
0
0
Placebo
45 mg
105 mg
Placebo
45 mg
105 mg
Treatment Group
Figure 4. Additional sensitivity analyses. Twenty-eight day all-cause mortality rate by treatment
group. a, the clinically evaluable population, n ⫽ 235. A mortality difference of 12.5% was observed
between the 105-mg group (black bars) and placebo (white bars); exploratory analysis, p ⫽ .094. b,
subgroup of subjects in whom drotrecogin alfa (activated) (DAA, Xigris, Eli Lilly & Co., Indianapolis,
IN) was not used, n ⫽ 225. A mortality difference of 6.9% was observed between the 105-mg group
(n ⫽ 78) vs. placebo (n ⫽ 80); exploratory analysis p ⫽ .36.
100
80
60
40
c
Placebo
20
Low dose
High dose
0
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
Study Day
Probab
bility of Survival (%)
b
100
80
Probab
bility of Survival (%)
Probab
bility of Survival (%)
a
pared with placebo (Fig. 4b). Third,
graphic representation of survival by
Kaplan-Meier survival-time curves of the
three treatment groups were analyzed by
log-rank tests (Fig. 5a). There were no
differences in survival time in the MITT
population. Additional post hoc analyses
of survival time in subgroups defined by
predicted mortality rate calculated from
APACHE II score (Fig. 5, b and c), or by
APACHE II score ⱖ21 (not shown), suggested a trend toward lower mortality
rate in subjects who received 105 mg of
eritoran tetrasodium and had a higher
risk of death at baseline that was not
statistically significant.
Covariates of possible clinical importance were evaluated for effect on 28-day
mortality rate (Fig. 6). Upon individual
testing, none of the following prespecified variables demonstrated a significant
effect in patients treated with eritoran
tetrasodium 105 mg compared with placebo: APACHE II-predicted mortality
risk, type of pathogen (Gram-negative,
Gram-positive, mixed bacterial), or other
baseline covariates (age, gender, study
stage, use of DAA, elevated endotoxin
level, low level of high-density lipopro-
100
80
60
40
Placebo
20
Low dose
High dose
0
60
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
Study Day
40
Placebo
20
Low dose
High dose
0
0
2
4
6
8
10
12
14
16
18
20
22
24
26
28
Study Day
Figure 5. Kaplan-Meier survival-time curves through day 28. a, the modified intent-to-treat population consisting of placebo (n ⫽ 96), eritoran tetrasodium 45-mg (n ⫽
103), or 105-mg (n ⫽ 94) groups. Survival in the eritoran tetrasodium 105-mg group was not statistically significantly greater than in the placebo group (p ⫽ .366). b,
subgroup of subjects with high predicted risk of mortality (51% to 80%) by Acute Physiology and Chronic Health Evaluation (APACHE) II score: placebo (n ⫽ 53), eritoran
tetrasodium 45-mg (n ⫽ 58), or 105-mg (n ⫽ 51) groups (p ⫽ .0733, 105 mg of eritoran tetrasodium vs. placebo). c, subgroup of subjects with low predicted risk of
mortality (20% to 50%) by APACHE II score (p ⫽ .314, eritoran 105 mg vs. placebo).
78
Crit Care Med 2010 Vol. 38, No. 1
MITT population
APACHE II predicted mortality
Low (20-50%)
High (51-80%)
Type of pathogen
Gram Neg
Gram Pos
Mixed Bacterial
Other/Unknown
Age
65 and younger
66 and older
Stage of Study
Stage II
Stage III
Xigris Used
Yes
No
Baseline Endotoxin
Detectable
Elevated ≥ 0.2 endotoxin units/mL
Baseline HDL
<25 mg/dL
≥25 mg/dL
Time to drug infusion
8 hours or less
More than 8 hours
0.10
1.00
10.00
Figure 6. Relative reduction in risk of death at 28 days and 95% confidence interval of effect. Relative
risk of death for patients who received eritoran tetrasodium 105 mg vs. placebo. An x-axis value of 1
signifies no effect. Values to the left of 1 indicate a relative risk reduction in favor of 105 mg of eritoran
tetrasodium. The relative risk for the modified intent-to-treat (MITT) population is shown at the top.
APACHE, Acute Physiology and Chronic Health Evaluation; HDL, high-density lipoprotein.
tein, hours from recognition of severe
sepsis to randomization, or enrollment
site). In addition, the site and type (focal,
disseminated, and/or bacteremia) of infection had no detectable influence on
28-day mortality rate (Table 5).
Serum IL-6. Mean and median IL-6
values were elevated at baseline and were
not significantly different among the
three groups. There was a wide range of
baseline values within each group. IL-6
baseline values decreased in each group
at 12 and 48 hrs after study drug infusion
(Fig. 7).
DISCUSSION
This phase II clinical study is the first
to evaluate the safety and efficacy of eritoran tetrasodium in subjects with severe
sepsis. Eritoran tetrasodium is a specific,
competitive, small-molecule antagonist
of activation of TLR4 by bacterial endotoxin. Eritoran tetrasodium dose regimen
or placebo was initiated within 12 hrs of
recognition of severe sepsis and repeated
every 12 hrs for 6 days. Eritoran tetrasoCrit Care Med 2010 Vol. 38, No. 1
dium was generally well tolerated, with
few TEAEs. In the MITT population, although mortality rate was 6.7% lower
among subjects treated with eritoran tetrasodium 105 mg compared with placebo, this difference in mortality rate was
not statistically significant. Additional
planned analyses were done to define the
target population for a future phase III
trial. In subgroups of the MITT population, subjects at higher risk of death
based on APACHE II score quartile, and
subjects in shock at baseline, there was a
not statistically significant trend toward
lower mortality rate among subjects
treated with 105 mg of eritoran tetrasodium compared with placebo. While mortality rate trended lower in exploratory
analyses of clinically evaluable subjects
treated with eritoran tetrasodium 105 mg,
this observation was statistically significant. Mortality rates did not appear to be
influenced by whether the infection was
caused by Gram-negative organisms,
Gram-positive organisms, or fungal sepsis.
There was no evidence that endotoxin
levels (either within the normal range or
elevated) were associated with different
mortality rates for the eritoran tetrasodium 105-mg group compared with the
respective placebo group (Fig. 6).
Our findings notwithstanding, endotoxin is a major microbial mediator of
septic shock, and this pathogen-associated microbial pattern molecule remains
an attractive target for the treatment of
sepsis for many reasons. Endotoxin in
human and animal models produces
rapid inflammatory and coagulopathic
changes seen during sepsis, and in animals endotoxin can produce lethal multiorgan failure (26, 30, 31). Circulating
endotoxin levels are frequently detectable
in the bloodstream of intensive care unit
patients, and in those with severe sepsis,
high endotoxin levels are associated with
increased mortality rate (1, 3).
In this trial, clinical criteria for severe
sepsis identified subjects with endotoxemia. Endotoxin was detected in serum at
baseline in 80% of subjects and exceeded
the normal range in 55% of subjects.
Consistent with prior reports (1, 3), endotoxin was present in the blood sera of
subjects with infection caused by Grampositive bacteria or fungi and not only
Gram-negative bacterial infections. Mortality rates did not appear to be influenced by the type of infecting pathogen.
There was no indication that subjects
with differing sites of infection (pulmonary or intravascular) responded differently to the doses of eritoran tetrasodium
administered, as suggested by recent rat
experiments (32). As intended, the
plasma levels of eritoran tetrasodium attained in subjects in this trial were similar to the levels observed in previous
phase 1 pharmacokinetic trials, in which
eritoran tetrasodium was administered to
normal volunteers before endotoxin challenge and shown to inhibit signs and
symptoms of endotoxemia (26).
Despite evidence for the role of endotoxin in producing sepsis syndrome, previous trials of other seemingly promising
drugs targeting endotoxin in subjects
with severe sepsis did not lead to lower
mortality rates. Antibody-based approaches against endotoxin that used
low-affinity and poly-specific immunoglobulin regimens with variable biological activity resulted in inconsistent clinical benefits. Although antiendotoxin
antisera against the mutant Escherichia
coli J5 initially appeared to improve outcome in septic shock (10), these favorable
results could not be reproduced in a large
phase III trial (33). Specific monoclonal
79
Table 5. Mortality by site of infection
Type of Infection
Bacteremia only, n
28-day mortality rate (%)
Possible/definite focal only, n
28-day mortality rate (%)
Possible/definite focal plus
bacteremia, n
28-day mortality rate (%)
Neither possible/definite focal nor
bacteremia, n
28-day mortality rate (%)
Pulmonary, n
28-day mortality rate (%)
Intra-abdominal/gynecologic
28-day mortality rate (%)
Urinary tract, n
28-day mortality rate (%)
Skin and soft tissue
28-day mortality rate (%)
Other/unknown/no infection
28-day mortality rate (%)
Placebo
(n ⫽ 96)
Eritoran
Tetrasodium
45 mg
(n ⫽ 103)
Eritoran
Tetrasodium
105 mg
(n ⫽ 94)
3
33.3
59
37.3
25
10
40
51
33.3
29
8
50
54
22.2
26
24
9
27.6
13
30.8
6
33.3
38
30.8
20
55.0
14
7.1
5
40.0
20
31.6
30.8
39
30.8
14
35.7
13
30.8
7
42.9
30
30.0
16.7
29
27.6
15
20.0
18
27.8
7
42.9
23
20.8
Figure 7. Values of serum interleukin (IL)-6 in each of the three treatment groups at baseline and at
12 and 48 hrs after start of administration of study drug grouped by treatment assignment for the
modified intent-to-treat population (n ⫽ 293 at baseline). Box plots represent median, 10th, 25th,
75th, and 90th percentiles.
antibodies directed against the lipid A
component of endotoxin (the monoclonal
immunoglobulin M antibodies HA-1A and
E5) also failed to demonstrate mortality
benefit (16, 17, 19). Subsequent investigations indicated that these were lowaffinity antibodies that only weakly bound
and neutralized endotoxin (34). Another
endotoxin antagonist is bacterial permeability-increasing protein (BPI), an antibacterial protein produced within the
azurophilic granules of human neutrophils. A recombinant, 21-kD, truncated
form of the N-terminal domain of human
BPI (rBPI21), which binds endotoxin with
high affinity and efficiently neutralizes
endotoxin activity, has been extensively
80
studied in human endotoxin challenge
studies and clinical sepsis studies. This
recombinant form of BPI improved some
morbidity indices but did not significantly decrease the mortality rate in a
phase III trial in children with meningococcemia (13).
In contrast, eritoran tetrasodium differs structurally from endotoxin-blocking
antibodies, antisera, and recombinant
proteins used in previous studies. Eritoran tetrasodium is a small, modified lipid
A antagonist generated by chemical synthesis that competes with the lipid A
component for endotoxin from Gramnegative bacteria for binding to the
TLR4-MD-2 complex (4). In addition, eri-
toran tetrasodium is functionally unique
in its ability to interfere with the interaction of endotoxin with the TLR4-MD-2
transmembrane signaling complex found
on the cell surface of endotoxin-responsive cells. Therefore, eritoran tetrasodium, in contrast to many previous therapeutic agents designed to interfere with
endotoxin, has the ability to block the
effects of endotoxin in a human volunteer
model of endotoxemia (26).
We analyzed predefined covariates for
possible effects of eritoran tetrasodium
on mortality rate (Fig. 6). The inflammatory and coagulopathic effects of endotoxin are believed to play a key role in the
pathogenesis of severe sepsis and are
known to occur within hours. In this
study, treatment with eritoran tetrasodium or placebo was started as soon as
possible. Initially, the protocol called for
a time window of 8 hrs from recognition
of severe sepsis; however, the protocol
was later amended to permit a window of
ⱕ12 hrs. There was no statistical difference in outcome for the initiation of eritoran tetrasodium within 8 hrs, or 8 –12
hrs, after identification of severe sepsis. A
time window of 12 hrs for administration
of eritoran tetrasodium appears to be
both feasible and appropriate, although
we could not determine precisely how
long subjects had severe sepsis before diagnosis, because severe sepsis usually
started before arrival at the hospital. We
cannot rule out the possibility that a
shorter window for administration may
improve outcome, especially given the
benefits observed with early administration of fluids and antibiotics in patients
with severe sepsis (35).
Our results suggest that the APACHE
II severity of illness score (and predicted
mortality) is not only an indicator of 28day mortality rate in study subjects but
also could be a predictor of positive response to eritoran tetrasodium. For subjects in APACHE II quartile 1, eritoran
tetrasodium appeared to have no or possibly a negative effect on mortality rate.
These results are in line with the outcome of subjects with low APACHE II
scores observed in the PROWESS (36, 37)
and ADDRESS (38) trials. In these previous trials, placebo mortality rate was 12%
to 17% among subjects with low severity
of illness. Our finding of a placebo mortality rate of 0% in the subjects with the
lowest APACHE II quartile scores (compared with 12% for subjects treated with
105 mg of eritoran tetrasodium) is unexpected and likely reflects small sample
Crit Care Med 2010 Vol. 38, No. 1
size. However, we cannot entirely rule
out the possibility that eritoran tetrasodium had a deleterious effect in septic
subjects with a low predicted mortality
risk. A meta-analysis of human clinical
trials of anticytokine therapies suggested
an effect only in subjects with the highest
risk of death (39), raising the possibility
that anticytokine and other therapies for
severe sepsis block inflammation that
could be beneficial in some subjects.
Based on analyses of subgroups in this
study, a phase III trial of eritoran tetrasodium will use the 105-mg dose of eritoran tetrasodium and limit enrollment
to subjects with severe sepsis and a significant risk of mortality (APACHE II
scores ⱖ21, quartiles 2, 3, and 4).
As expected in subjects with severe
sepsis, the frequency of AEs was high in
all three study arms. There were no significant differences in SAES, TEAEs, or
clinically significant laboratory values attributed to study drug. There was no increase in the rates of new infections in
the subjects treated with eritoran tetrasodium. Endotoxin responsiveness via
TLR4 is an important “alarm” mechanism that initiates a protective innate immune response against microbial invasion (40, 41), yet excess and persistent
endotoxin levels can also provoke severe
sepsis and shock. Although we did not
directly assess whether eritoran tetrasodium adversely affected immune function, there were no indications that eritoran tetrasodium interfered with
recovery from primary infection or increased secondary infections.
A small number of subjects in each
group had hepatic failure or new renal
failure requiring hemodialysis. Future
studies with eritoran tetrasodium will include close monitoring of subjects with
preexisting hepatic or renal disease and
preferential administration of this intravenous agent via a central venous catheter to minimize the risk of phlebitis.
The principal limitation of this exploratory phase II trial is that the small number
of subjects enrolled and the staged study
design prevent definitive conclusions about
the safety and efficacy effects of eritoran
tetrasodium. This phase II trial was intended to assess dose and whether to proceed to a phase III trial. Calculation was not
used to determine the sample size. Other
limitations of this trial include many found
in other comparable therapeutic trials for
severe sepsis, including a heterogeneous
population; variable time from the onset of
severe sepsis to administration of study
Crit Care Med 2010 Vol. 38, No. 1
drug; a wide range of severity of illness
scores; differences in delivery of care
among different institutions; and difficulties determining the level of supportive
care, withdrawal of supportive measures,
and appropriateness of medical care (42).
These factors will be addressed in part by
using a clinical evaluation committee again
for subjects enrolled in the phase III trial.
The APACHE II score, although it is less
likely than other scoring systems to accurately predict mortality, was selected for
this trial to stratify randomization and to
ensure that subjects were not at too low or
too high a risk of death after discussion
with the Food and Drug Administration,
shortly after release of the results of the
PROWESS study of drotrecogin alfa (activated). APACHE II is also nonproprietary
and allows comparisons with the patient
populations enrolled in sepsis trials during
the last 20 yrs.
The in vivo biological activities of eritoran tetrasodium previously seen in phase I
trials of normal volunteers were not observed in this phase II trial in the target
population of patients with severe sepsis.
Possibly, this was due to differences of patients, endotoxin source, timing of severe
sepsis and endotoxemia, or other uncontrolled factors. Only one marker of inflammation due to severe sepsis, IL-6, was measured in this study. It may have been
important to measure other markers.
There was no change in IL-6 from baseline
levels specific to the administration of 105
mg of eritoran tetrasodium (Fig. 7) when
compared with placebo. Interpretation of
the IL-6 levels and changes was limited by
the large variation in values in all groups at
all time points. While a significant change
in IL-6 would have coincided with current
concepts of the mechanism of action of
eritoran tetrasodium, the precise role of
IL-6, and myriad other inflammatory mediators seen in severe sepsis, has not been
fully elucidated. Inflammatory markers can
provide additional support for a phase 3
study (43). However, the intended end
point of this therapy for severe sepsis is the
patient-centered benefit of decreased mortality rate.
CONCLUSIONS
The dosing strategy used in this study
achieved plasma levels of eritoran tetrasodium previously shown to block signs
and symptoms of endotoxemia in healthy
adults. There were no major safety concerns when eritoran tetrasodium at 45
mg or 105 mg was administered to sub-
jects early in the course of severe sepsis.
Despite the known antagonism of the
TLR4-MD-2 receptor by eritoran tetrasodium, there did not appear to be an adverse effect on immune protection. We
consistently observed a favorable, but not
statistically significant, trend toward a
lower mortality rate in subjects who received eritoran tetrasodium 105 mg in
several predefined subsets of the study
population. A trend toward a higher mortality rate was noted for subjects with low
risk of mortality (APACHE II scores ⬍21,
first quartile). These results support the
pursuit of further clinical trials that are
powered to demonstrate an outcome benefit in patients with a high risk of mortality. Due to potential therapeutic benefit, the dose of eritoran tetrasodium 105
mg was selected to be used in a larger,
international phase III clinical trial of patients with severe sepsis.
ACKNOWLEDGMENT
We acknowledge Alison Carter for supplying supplemental statistical analyses.
The authors gratefully acknowledge the
contributions by George Rogan of Phase
Five Communications Inc., who helped to
edit and finalize this manuscript for submission, with funding provided by Eisai
Inc.
REFERENCES
1. Marshall JC, Foster D, Vincent J-L, et al:
Diagnostic and prognostic implications of
endotoxemia in critical illness: Results of the
MEDIC study. J Infect Dis 2004; 190:527–534
2. Calvano SE, Xiao W, Richards DR, et al: A
network-based analysis of systemic inflammation in humans. Nature 2005; 437:
1032–1037
3. Opal SM, Scannon PJ, Vincent J-L, et al:
Relationship between plasma levels of lipopolysaccharide (LPS) and LPS-blinding protein in patients with severe sepsis and septic
shock. J Infect Dis 1999; 180:1584 –1589
4. Kim HM, Seok B, Kim J-I, et al: Crystal
structure of the TLR4-MD-2 complex with
bound endotoxin antagonist eritoran tetrasodium. Cell 2007; 130:906 –917
5. Murol M, Tanamoto K-I. Structural regions
of MD-2 that determine the agonist-antagonist activity of lipid IVa. J Biol Chem 2006;
281:5484 –5491
6. Beutler B, Rietschel ET. Innate immune
sensing and its roots: The story of endotoxin.
Nat Rev Immunol 2003; 3:169 –176
7. Beutler B, Poltorak A. Sepsis and evolution of
the innate immune response. Crit Care Med
2001; 29(7 Suppl):S2–S6
8. Ohto U, Fukase K, Miyake K, et al: Crystal
structures of human MD-2 and its complex
81
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
82
with antiendotoxic lipid IVa. Science 2007;
316:1632–1634
Visintin A, Halmen KA, Latz E, et al: Pharmacological inhibition of endotoxin responses is achieved by targeting the TLR4
coreceptor, MD-2. J Immunol 2005; 175:
6465– 6472
Ziegler EJ, McCutchan JA, Fierer J, et al:
Treatment of Gram-negative bacteremia and
shock with human antiserum to a mutant
Escherichia coli. N Engl J Med 1982; 307:
1225–1230
The French National Registry of HA-1A (Centoxin) in septic shock: A cohort study of 600
patients. Arch Intern Med 1994; 154:
2484 –2491
Wortel CH, von der Mohlen MAM, van Deventer SJH, et al: Effectiveness of a human
monoclonal anti-endotoxin antibody (HA-1A)
in Gram-negative sepsis: Relationship to endotoxin and cytokine levels. J Infect Dis
1992; 166:1367–1374
Levin M, Quint PA, Goldstein B, et al: Recombinant bactericidal/permeability-increasing protein (rBPI21) as adjunctive treatment
for children with severe meningococcal sepsis: A randomized trial. Lancet 2000; 356:
961–967
Von der Mohlen MAM, Kimmings AN, Wedel
N, et al: Inhibition of endotoxin-induced cytokine release and neutrophil activation in
humans using recombinant bactericidal/
permeability increasing protein. J Infect Dis
1995; 172:144 –151
Von der Mohlen MAM, van Deventer SJH, Levi
M, et al: Inhibition of endotoxin–induced activation of the coagulation and fibrinolytic pathways using a recombinant endotoxin-binding
protein (rBPI21). Blood 1995; 85:3437–3443
Ziegler EJ, Fisher CJ, Sprung CL, et al: Treatment of Gram-negative bacteremia and septic shock with HA-1A human monoclonal
antibody against endotoxin: A randomized,
double-blind, placebo-controlled trial.
N Engl J Med 1991; 324:429 – 436
McCloskey RV, Straube RC, Sanders C, et al:
Treatment of septic shock with human
monoclonal antibody HA-1A: A randomized,
double-blind, placebo-controlled trial. Ann
Intern Med 1994; 121:1–5
Warren HS, Amato SF, Fitting C, et al: Assessment of ability of murine and human
anti-lipid A monoclonal antibodies to bind
and neutralize lipopolysaccharide. J Exp Med
1993; 177:89 –97
Greenman RL, Schein RMH, Martin MA, et
al: A controlled clinical trial of E5 murine
monoclonal IgM antibody to endotoxin in the
treatment of Gram-negative sepsis. JAMA
1991; 266:1097–1102
Bone RC, Balk RA, Fein AM, et al: A second
large controlled clinical study of E5, a monoclonal antibody to endotoxin: Results of a
prospective, multicenter, randomized, controlled trial. Crit Care Med 1995; 23:
994 –1006
Angus DC, Birmingham MC, Balk RA, et al:
E5 murine monoclonal antiendotoxin anti-
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
body in Gram-negative sepsis: A randomized
controlled trial. JAMA 2000; 283:1723–1730
Rossignol DP, Lynn M. Antagonism of in vivo
and ex vivo response to endotoxin by E5564,
a synthetic lipid A analogue. J Endotoxin Res
2002; 8:483– 488
Lien E, Chow JC, Hawkins LD, et al: A novel
synthetic acyclic lipid A-like agonist activates
cells via the lipopolysaccharide/toll-like receptor 4 signaling pathway. J Biol Chem
2001; 276:1873–1880
Mullarkey M, Rose JR, Bristol J, et al: Inhibition of endotoxin response by E5564, a
novel toll-like receptor 4-directed endotoxin
antagonist. J Pharmacol Exp Ther 2003; 304:
1093–1102
Hawkins LD, Christ WJ, Rossignol DP. Inhibition of endotoxin response by synthetic
TLR4 antagonists. Curr Top Med Chem 2004;
4:1147–1171
Lynn M, Rossignol DP, Wheeler JL, et al:
Blocking of responses to endotoxin by E5564
in healthy volunteers with experimental endotoxemia. J Infect Dis 2003; 187:631– 639
Knaus WA, Draper EA, Wagner DP, et al:
APACHE II: A severity of disease classification system. Crit Care Med 1985; 13:
818 – 829
Bone RC, Balk RA, Cerra FB, et al: Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in
sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest
Physicians/Society of Critical Care Medicine.
Chest 1992; 101:1644 –1655
Rossignol DP, Wasan KM, Choo E, et al:
Safety, pharmacokinetics, pharmacodynamics and plasma lipoprotein distribution of
eritoran (E5564) during continuous intravenous infusion into healthy volunteers. Antimicrob Agents Chemother 2004; 48:
3233–3240
Opal SM. The host response to endotoxin,
antilipopolysaccharide strategies, and the
management of severe sepsis. Int J Med Microbiol 2007; 297:365–377
Taylor FB. Staging of the pathophysiologic
responses of the primate microvasculature to
Escherichia coli and endotoxin: Examination
of the elements of the compensated response
and their links to the corresponding uncompensated lethal variants. Crit Care Med 2001;
29:S78 –S89
Solomon SB, Cui X, Gerstenberger E, et al:
Effective dosing of lipid A analogue E5564 in
rats depends on the timing of treatment and
the route of Escherichia coli infection. J Infect Dis 2006; 193:634 – 644
Calandra T, Glauser MP, Schellekens J, et al:
Treatment of Gram-negative septic shock with
human IgG antibody to Escherichia coli J5: a
prospective, double-blind, randomized trial.
J Infect Dis 1988; 158:312–319
Marra MN, Thornton MB, Snable JL, et al:
Endotoxin binding and neutralizing properties
of recombinant bactericidal permeability protein and monoclonal antibodies HA-1A and E5.
Crit Care Med 1994; 22:559 –565
35. Dellinger RP, Levy MM, Carlet JM, et al:
Surviving Sepsis Campaign: International
guidelines for management of severe sepsis
and septic shock. Crit Care Med 2008; 36:
296 –327
36. Bernard GR, Vincent JL, Laterre PF, et al:
Recombinant human protein C Worldwide
Evaluation in Severe Sepsis (PROWESS)
study group: Efficacy and safety of recombinant human activated protein C for severe
sepsis. N Engl J Med 2001; 344:699 –709
37. US Food and Drug Administration: FDA clinical review, Drotrecogin alfa (activated), recombinant human activated protein C
(rhAPC), XIGRIS™, BLA# 125029/0. Availabale
at: http://www.fda.gov/cder/biologics/review/
droteli112101r1.pdf. Accessed January 16, 2009
38. Abraham E, Laterre PF, Garg R, et al: Administration of Drotrecogin Alfa (Activated) in
Early Stage Severe Sepsis (ADDRESS) Study
Group. Drotrecogin alfa (activated) for adults
with severe sepsis and a low risk of death.
N Engl J Med 2005; 353:1332–1341
39. Eichaker PQ, Parent C, Kalil A, et al: Risk and
efficacy of anti-inflammatory agents: retrospective and confirmatory studies of sepsis.
Am J Respir Crit Care Med 2002; 166:
1197–1205
40. O’Brien AD, Rosenstreich DL, Scher I, et al:
Genetic control of susceptibility to Salmonella typhinurium in mice: role of the LPS
gene. J Immunol 1980; 124:20 –24
41. Wurfel MM, Monks BG, Ingalls RR, et al:
Targeted deletion of the lipopolysaccharide
(LPS)-binding protein gene leads to profound suppression of LPS responses ex vivo,
whereas in vivo responses remain intact. J
Exp Med 1997; 186:2051–2056
42. Sprung CL, Eidelman LA, Pizov R, et al:
Influence of alterations in foregoing lifesustaining treatment practices on a clinical
sepsis trial. The HA-1A Sepsis Study Group.
Crit Care Med 1997; 25:383–387
43. Marshall JC, Vincent J-L, Guyatt G, et al:
Outcome measures for clinical research in
sepsis: A report of the 2nd Cambridge Colloquium of the International Sepsis Forum.
Crit Care Med 2005; 33:1708 –1716
APPENDIX 1
Definition of Severe Sepsis
(Ref. 28)
Severe sepsis was defined as evidence of
newly developed respiratory failure, refractory shock, renal dysfunction, hepatic dysfunction, or metabolic acidosis, presumed
to be due to infection, in combination with
at least three of four of the following signs
of systemic inflammatory response syndrome within the 12 hrs preceding recognition of organ dysfunction:
●
Fever or hypothermia (⬎38°C or
⬍36°C)
Crit Care Med 2010 Vol. 38, No. 1
●
●
●
Tachycardia (heart rate ⬎90 beats/
min)
Tachypnea (respiratory rate ⬎20
breaths/min while breathing spontaneously, or PaCO2 ⬍4.3 kPa, or use of
mechanical ventilation for an acute respiratory process)
Leukocytosis (ⱖ12⬘ 103/mm3) or leukopenia (⬍4⬘ 103/mm3) or ⬎10% immature forms
●
●
APPENDIX 2
Sepsis-Induced Organ
Dysfunction
●
●
Refractory shock: systolic blood pressure ⬍90 mm Hg or a decrease in
systolic pressure of ⬎40 mm Hg in
the absence of other causes of hypotension. The decrease in blood pressure did not respond adequately to
fluid challenge of 500 mL over 20
mins and required the use of vasopressors (excluding dopamine ⬍5
␮g/kg/min) to maintain a systolic
blood pressure of ⬎90 mm Hg.
Respiratory failure: for subjects without pneumonia or other preexisting
lung disease, acute lung injury
(PaO2/FIO2 ⬍300 and diffuse bilateral
pulmonary infiltrates in the absence
of elevated left atrial pressure-related
Crit Care Med 2010 Vol. 38, No. 1
●
pulmonary edema). For subjects with
pneumonia without shock, evidence
of acute respiratory distress syndrome (PaO2/FIO2 ⬍200)
Acute renal dysfunction: serum creatinine of ⱖ2 mg/dL and, if known, at
least twice the value before sepsis, in
the absence of primary renal disease
Acute liver dysfunction: elevation of
total bilirubin to ⬎3 mg/dL and elevation of alanine transaminase or aspartate transaminase to at least three
times the upper limit of normal secondary to acute hepatic dysfunction
and not related to other entities such
as preexisting liver disease, biliary
obstruction, or acute hemolysis
Acute metabolic acidosis: pH ⱖ 7.30,
or a base deficit of ⱖ5.0 mmol/L, in
association with a plasma lactate
level 1.5 times the upper limit of
normal
APPENDIX 3
Key Exclusion Criteria
Subjects with any of the following
were excluded from study participation:
●
Individuals who, in the opinion of their
physician, were unlikely to regain premorbid health status, or individuals for
●
●
●
●
●
●
●
●
●
●
whom commitment to aggressive
treatment was uncertain
Cardiogenic or hypovolemic shock
Acute third-degree burns involving
ⱖ20% of body surface area
Receipt of a nonautologous organ
transplant within the past year
Chronic vegetative state
Uncontrolled serious hemorrhage requiring transfusion of ⬎2 units of
blood/platelets in the previous 24 hrs
(if bleeding stopped and subjects
were still otherwise qualified, they
were considered for enrollment)
Unwillingness or inability to be fully
evaluated for all follow-up visits
Classification as “do not resuscitate” or
“do not treat” (subjects could be enrolled
if all other means of resuscitation, including intubation and vasopressors,
were part of treatment options)
Development of systemic inflammatory
response syndrome and organ failure
⬍36 hrs after trauma or surgery
Predicted risk of mortality score of
⬍20% or ⬎80% after recognition of
qualifying organ failure
Planned or current use of drotrecogin
alfa [activated] (recombinant human
activated protein C, Xigris) for subjects
with an Acute Physiology and Chronic
Health Evaluation (APACHE) II-predicted risk of mortality of 20% to 50%
(i.e., APACHE II score ⬍25)
83
The Pathophysiolo gy
of Septic Shock
O. Okorie Nduka, MDa,b,*, Joseph E. Parrillo, MDc
KEYWORDS
Sepsis Severe sepsis Septic shock
Myocardial depression Vasodilation
The word ‘‘sepsis’’ comes from the Greek word sepo meaning decay or putrefaction,
and its original usage described the decomposition of organic matter in a manner that
resulted in decay and death.1 In the Hippocratic model of health and disease, living
tissues broke down by 1 of 2 processes. Pepsis was the process through which
food was digested, leading to health. Sepsis, however, denoted tissue breakdown
that resulted in disease. Hippocrates used this term to describe the process of
abnormal tissue breakdown that resulted in a foul odor, pus-formation, and sometimes dead tissue.2 This usage of the term sepsis persisted for almost 3 millennia,
and subsequent work establishing a causal link between microbes and suppurative
infections, or systemic symptoms from infection, did not change the use of the term
as a description of a constellation of clinical findings, but rather established infection
as the underlying cause.3 The term ‘‘shock’’ comes from the French word choquer
meaning ‘‘to collide with,’’ and aptly describes the body’s response to invading
microbes and, to a large extent, its disruptive effect on normal physiology. Initially
used in the medical literature in the 1700s, its earliest uses connoted a sudden jolt
that often led to death (the initial physical injury). This definition evolved to describe
widespread circulatory dysfunction following injury.4
Sepsis is the systemic maladaptive response of the body to the invasion of normally
sterile tissue by pathogenic, or potentially pathogenic, microorganisms. Shock may be
defined as a ‘‘state in which profound and widespread reduction of effective tissue
perfusion leads first to reversible, and then, if prolonged, to irreversible cellular
injury.’’5 From a clinical standpoint, this progressive cellular dysfunction manifests
as a continuum from sepsis, to severe sepsis, and finally to septic shock (Box 1).
a
Division of Critical Care Medicine, Department of Internal Medicine, Cooper University
Hospital, Camden, NJ, USA
b
Altru Hospital, Grand Forks, ND 58206-6003, USA
c
Robert Wood Johnson Medical School, Department of Medicine, University of Medicine and
Dentistry of New Jersey, NJ, USA
* Corresponding author. Division of Critical Care Medicine, Department of Internal Medicine,
Cooper University Hospital, Camden, NJ.
E-mail address: Okorie-Okorie@CooperHealth.edu (O.O. Nduka).
Crit Care Clin 25 (2009) 677–702
doi:10.1016/j.ccc.2009.08.002
criticalcare.theclinics.com
0749-0704/09/$ – see front matter ª 2009 Elsevier Inc. All rights reserved.
678
Nduka & Parrillo
Box 1
Definitions of sepsis, severe sepsis, and septic shock
Sepsis: sepsis is defined as infection plus systemic manifestations of infection
Severe sepsis: sepsis with sepsis-induced organ dysfunction or tissue hypoperfusion
Sepsis-induced hypotension: a systolic blood pressure (SBP) less than 90 mm Hg or mean arterial
pressure less than 70 mm Hg, or an SBP decrease of greater than 40 mm Hg or greater than 2 SD
less than normal for age in the absence of other causes of hypotension
Septic shock: sepsis-induced hypotension persisting despite adequate fluid resuscitation.
Sepsis-induced tissue hypoperfusion: septic shock, lactate elevation beyond the upper limits of
normal or oliguria
Acute oliguria: urine output less than 0.5 mL/kg/h for at least 2 hours, despite adequate fluid
resuscitation
Data from Dellinger RP, Levy MM, Carlet JM, et al. Surviving Sepsis Campaign: international
guidelines for management of severe sepsis and septic shock: 2008. Crit Care Med 2008;36:296–27.
Severe sepsis and septic shock are the end result of complex interactions between
infecting organisms and several elements of the host response, and reflect a primarily
inappropriate response by the host to a microbial pathogenic insult. The key term that
describes the pathophysiologic events in septic shock at any point in time is the
‘‘mismatch’’ of the host response to the intensity of the pathogenic stimuli ultimately
leading to organ injury or dysfunction with or without hypotension. This mismatch
results in, amongst other derangements, an immune profile that could be predominantly proinflammatory (systemic inflammatory response syndrome [SIRS]), mixed
(mixed antagonistic response syndrome [MARS]), or predominantly anti-inflammatory
(compensatory anti-inflammatory syndrome [CARS]). The nature of the interactions
between the microbial pathogen and the host is complex and, at the tissues, results
in excessive inflammation or immunosuppression, abnormal coagulation and blood
flow, and microcirculatory dysfunction leading to organ injury and cell death (Fig. 1).
The complex events that occur in septic shock can be broadly divided into microorganism-related components and host-related components. The broad categories
are further subdivided into cellular and humoral components. Pathogen-related events
in the pathophysiology of septic shock include the mechanisms by which microbes
evade host defenses and subvert aspects of the host immune response, resulting in
significantly increased morbidity. Concerning the host-related events in septic shock,
multiple derangements involving several biologic systems contribute to different
degrees to the development of septic shock. A meaningful review of every proven
or proposed pathogenetic mechanism for septic shock is near impossible, and this
article focuses on selected dysfunctions believed to play more significant roles in
the development of septic shock. These are outlined below, and include aspects of
microbial pathogenicity, key cellular and humoral aspects of the maladaptive immunoinflammatory response, the interactions between the immunoinflammatory and
coagulation systems, and their cardiocirculatory consequences, resulting in the clinical picture of septic shock.
- The role of the pathogen
- Immunoinflammatory dysfunction leading to severe sepsis
Pathogen recognition
Pro- and anti-inflammatory cellular signaling/signal transduction
The Pathophysiology of Septic Shock
Fig. 1. Pathophysiology of severe sepsis and septic shock. (Adapted from Cinel I, Opal SM.
Molecular biology of inflammation and sepsis: a primer. Crit Care Med 2009;37(1):293;
with permission.)
Release of pro-and anti-inflammatory mediators
Immune and non-immune effector cell dysfunction
Interactions with other biologic systems in sepsis
- Cardiocirculatory dysfunction in severe sepsis resulting in progression to septic shock
THE ROLE OF THE PATHOGEN
The initial event in severe sepsis and septic shock involves the invasion of normally
sterile tissue by pathogenic microbes. The interactions between the pathogens and
the host immune system may result in either a contained infectious process with
minimal tissue injury or severe sepsis and septic shock. The abnormal host response
seen in septic shock can be triggered by bacteria, viruses, or fungi.
Historically, our understanding of the pathophysiologic events in sepsis has focused
on the maladaptive responses by the host, minimizing the role, if any, played by the
pathogen invaders. Emerging evidence suggests a more significant role for pathogens
than was previously believed.6 The development of modern imaging techniques with
differential spatial and temporal resolution has provided the means to study the
complex interactions between pathogens and their mammalian hosts, leading to
advances in our understanding of bacterial pathogenicity. It is known that bacterial
and nonbacterial pathogens possess an array of specific mechanisms (virulence
factors) that confer the ability to evade host defense mechanisms and proliferate in
host tissues (Box 2, Fig. 2). Bacterial virulence factors are better studied than their
nonbacterial counterparts, and these mechanisms vary across species, classes,
and strains of bacteria. Despite wide variation in the nature of the pathogens and their
virulence factors, some common themes have emerged with regard to how pathogens
subvert the early immune response and exert their full pathogenic potential.
679
680
Nduka & Parrillo
Box 2
Virulence characteristics of bacterial pathogens
Mechanisms of bacterial adherence to host epithelial surfaces
Adhesins: bacterial protein products (integral or secreted) that enable pathogenic organisms to
bind onto host tissue elements (eg, collagen fibers)
Flagella, fimbrae, and pili: bacterial appendages whose primary role is mobility, but they enable
pathogens to directly attach themselves to host cells and extracellular matrix components
Type III secretion system: functions as a molecular conduit, enabling bacteria to introduce
proteins into host cells, altering their function to enhance bacterial survival
Ligand mimicry: by producing proteins similar to host-derived proteins, bacteria are able to
bind to relevant ligand receptors
Mechanisms of bacterial invasion following adherence
Bacterial protein secretion systems I, II, III, IV: specialized transporter systems that enable the
delivery of bacterial products into the extracellular matrix (I and II) or intracellularly (III and IV),
facilitating tissue invasion and intracellular infection
Lipidrafts: avoiding the apical areas of epithelial cells exposed to commensals and resistant to
pathogen invasion, pathogenic bacteria bind to the baso-lateral aspects of the host cell plasma
membrane. This area is rich in cholesterol and pathogen recognition receptors. Following
binding to plasma membrane cholesterol, the pathogens form intracellular vacuoles,
rendering them immune to lysosomal endocytosis.
Bacterial host defense evasion mechanisms
Anti-phagocytosis: bacterial pathogens have several mechanisms to avoid phagocytosis: (1)
inhibition of opsonization by encapsulation; (2) surface antigenic variation that prevents
recognition as pathogens; (3) inhibition of uptake via the release of toxic protein effectors; (4)
intracelluar survival and replication in the cytosol and also within lysosomes; (5) induction of
immune effector cell apoptosis.
Biofilm formation: a biofilm is a polysaccharide matrix that encapsulates entire bacterial
colonies. In addition to being protected from phagocytosis, these bacterial colonies are largely
immune to antibiotic drug action by existing in a dormant state. Dead tissue and foreign bodies
provide optimal conditions for biofilm formation.
Virulence factor-mediated host immune dysfunction
Discussed in section on immunoinflammatory dysfunction
Virulence factor-induced host tissue injury
Discussed in sections on immunoinflammatory dysfunction and host organ/cellular injury/
dysfunction in septic shock
Quorum-sensing, Cell-to-cell Signaling and Coordinated Gene Expression
Following pathogen adherence to an epithelial surface, specific mucosal defense
mechanisms are triggered by the host to suppress pathogen proliferation and prevent
invasion of the epithelial barrier. These include secretion of a mucus layer, epithelial
cell shedding, and secretion of enzymes such as lysozyme. To establish infection,
bacteria must be able not only to evade these additional host defense mechanisms
but also to produce virulence factors to facilitate invasion. Expression of virulence
factors by a single bacterium is highly unlikely to lead to established infection, much
less tissue damage. Therefore the bacterial innoculum or population density to
some extent affects the development and severity of infection. The critical bacterial
density needed to initiate an infectious process is referred to as a quorum. Bacteria
have developed systems of cell-to-cell communication that enable them to assess
The Pathophysiology of Septic Shock
Fig. 2. Sequence of events leading to established infection in human hosts.
their population density and react to their environment as a population, increasing their
chances of overwhelming host defense mechanisms and establishing infection.
These bacterial cell-to-cell signaling systems are called quorum-sensing systems
(QSSs), and result in coordinated gene activation and expression of high concentrations
of extracellular virulence factors by the entire bacterial population. QSSs are described
in Gram-positive and Gram-negative bacteria involved in human sepsis, and involve the
secretion of signaling molecules called autoinducers, with the autoinducer concentration tightly linked to the regulation of key aspects of genetic expression.7,8
Quorum sensing allows both intra- and interspecies bacterial cell-to-cell communication. Animal experiments have demonstrated loss of microbial virulence with deletion of bacterial quorum-sensing genes and restoration of virulence following plasmid
insertion. The ability to have virulence gene expression regulated by a global control
system (ie, the QSS) prevents virulence factor expression or excessive proliferation
when population densities are low, preventing premature pathogen detection. Thus
QSSs play a major role in the regulation of biofilm synthesis.9 Once the critical population density is attained, virulence genes are expressed along with cellular proliferation signals, with swift tissue invasion and establishment of infection.
Recent experiments have shown that QSSs are capable of facilitating host-pathogen communication leading to pathogen-mediated modulation of host immune
responses. Some QSSs can recognize and bind to human interferon-g leading to
subsequent expression of QSS genes.10 This suggests that the critical threshold for
QSS gene expression may be somewhat host-dependent, with earlier activation if
the host is sensed as being more susceptible.11
There are 2 main bacterial QSSs. Gram-positive bacteria synthesize cytosolic
autoinducers that are actively transported to the extracellular environment, where
they bind to specific receptor proteins on neighboring bacteria, initiating a signaling
cascade resulting in QSS control of relevant aspects of cellular function.12
681
682
Nduka & Parrillo
Gram-negative autoinducers are termed acyl-homoserine lactones (AHL) and are
produced by a different enzyme system (LuxI enzyme). After they are synthesized
they diffuse passively between intra- and extracellular environments until critical population density (high signal molecule concentration) is achieved. At this point, the AHL
proteins bind to the intracellular LuxR enzymes, forming a complex that acts on the
promoter regions of QSS genes, leading to relevant gene expression.
Virulence Gene Upregulation and Increased Expression of Virulence Factors
QSS-regulated gene expression results in the synthesis and release of a variety of virulence factors. Despite coordinated gene expression, the ability of a given pathogen to
invade host tissue is dependent on the quantity and quality of the virulence factors it
produces. Given the heterogeneity of the host immune response, pathogens need to
be able to express a variety of virulence factors in large quantities following QSS activation of transcriptional regulators.13 Given that virulence factors act synergistically,
the pathogen must be able to coordinate the transcription of individual genes to maximize virulence potential. Finally, it must be able to maintain virulence despite changes
in the host response. To achieve all of the above, genes responsible for the expression
of microbial virulence are housed in discrete genetic units in close proximity to specific
sequences of chromosomal DNA (direct repeats, insertion sequences, tRNA genes).
These genetic units differentiate pathogenic bacteria from their nonpathogenic counterparts. They are the products of lateral gene transfer and are referred to as pathogenicity islands. These pathogenicity islands represent unstable DNA regions, and
changes in their genetic sequences can result in huge clinical consequences.
Recently, a genetic alteration involving the pathogenic locus of Clostridium difficile
resulted in severe cases of Clostridium difficile-associated colitis in North America
by increasing the strain’s toxigenic potential. In addition, these islands may possess
gene capture systems (integrons), facilitating the incorporation and dissemination
by lateral transfer of antibiotic-resistance genes. A clinically relevant example is the
development of a clone of community-acquired methicillin-resistant Staphylococcus
aureus (MRSA) with genetic alterations leading to increased toxigenic potential and
an epidemic of necrotizing soft tissue infections.
With the aid of virulence factors, pathogens penetrate extraepithelial and epithelial
barriers and invade host tissue, establishing infection. Further innate immune system
activation occurs with recruitment of immune effector cells to the site of infection, with
significant host-pathogen interaction. This recruitment represents the initial significant
interaction between the host immune cells and the invading pathogen.
IMMUNOINFLAMMATORY DYSFUNCTION IN SEPTIC SHOCK
Although the dysfunctional events that lead to septic shock involve multiple biologic
systems, immune response remains central to the development of septic shock.
Normal Immune Response
The immune system includes a structural component consisting of mucosal barriers to
host tissue invasion, a nonspecific early response system (the innate immune
response) and a more pathogen-specific response system (the adaptive immune
response) activated later following the presence of pathogenic stimuli. Normal
immune function requires the coordinated action of these components, resulting in
early recognition of a potential pathogen and its subsequent elimination with minimal
host tissue damage or disruption to physiologic processes. The structural barriers
consist of mucocutaneous membranes (including appendages) and the endogenous
The Pathophysiology of Septic Shock
colonizing flora on these surfaces. Optimal function requires proper appendage function and stability of the endogenous flora population.
The innate immune system must be able to recognize invading pathogens early
following tissue invasion and mount a response of sufficient intensity to contain the
threat. It must also be able to regulate this intense nonspecific response to protect
host tissue from injury and facilitate repair.
The adaptive response is charged with ‘‘fine-tuning’’ the later aspects of the immune
response. This fine-tuning ensures that, for any given stimulus, the immune response
is focused and measured. To understand the degree of host dysfunction and, thus, the
pathophysiology of septic shock, one must appreciate certain features of a normal
host immune response to microbial infection.
Temporal variation
The normal immune response may be characterized as an initially nonspecific, highly
proinflammatory phase, with a subsequent complementary anti-inflammatory
response necessary for the restoration of immune homeostasis and prevention of
collateral immune-medicated host tissue injury.
Biologic redundancy
In experimental situations, a single pathogenic stimulus triggers the transcription of
proinflammatory genetic material, producing a few proinflammatory mediators. In
a 1:1 transmission system, the inactivity of any 1 of these pathways can seriously
affect the ability of the host to respond adequately to microbial pathogens. To mount
effective immune responses a single stimulus to the mammalian innate immune
system results in the transcription of hundreds of proinflammatory genes. In addition,
different immune effector pathways exhibit pathogenic cross-reactivity with markedly
different types of injury stimulating the same pathways. Furthermore, it is likely that, in
the clinical setting, there may be multiple injurious stimuli of different durations. The
expression of innate immunity becomes biologically redundant and not prone to
dysfunction by the inhibition of a few mediators, which protects the system as a whole
from being paralyzed by otherwise trivial subunit dysfunction.
Interaction with other biologic systems (cross talk)
The host response to infection extends beyond the immune system to include other
biologic systems (coagulation system, autonomic nervous system [ANS]) that interact
with the immune system to reduce the potential for host tissue injury, despite a robust
immune response, by maintaining organ perfusion (coagulation system) or by appropriately down-regulating the immune response (ANS).
Heterogeneity (genetic and nongenetic)
The immune response to a given pathogen in a given individual is determined by many
factors including, but not limited to, the virulence of the pathogen, the individual’s
genetic composition, and pre-existing comorbidities. Staphylococcal infection of
native cardiac valves should elicit a different host immune response from that in
response to the common cold, although they both might be febrile illnesses with
a cough. After an invading pathogen triggers an immune response, its severity
depends on the degree to which the innate immune system is expressed, which in
turn depends on genetic and acquired factors. The physiologic response to ongoing
infection in the setting of pre-existing comorbidities differs from the response in the
otherwise healthy host. Evidence for genetic differences in the immune response is
supported by the observation that, with regard to dying from infection, a strong association exists between adoptees and their natural, but not adoptive, parents.5 Genetic
683
684
Nduka & Parrillo
polymorphisms in septic shock are discussed elsewhere in the issue of the critical care
clinics.
Septic shock is often characterized by dysfunction involving all aspects of the
immune response. From a structural standpoint, the disruption may be modifiable
and transient (intestinal bacterial overgrowth) versus nonmodifiable factors (mucocilliary dysfunction in cystic fibrosis). Immunodysfunction in sepsis may present as an
uncontrolled (too intense or too long) early response with subsequent host tissue
injury, or as an inadequate response later in the course of the disease. This dysfunction involves cellular and humoral components of the innate and adaptive immune
response systems.
Pathogen Recognition
Pattern recognition receptors, pathogen-associated molecular patterns,
and danger-associated molecular patterns
The initial event in the innate immune response is the recognition of an invading pathogenic threat. Bacteria and viruses (prokaryotic life forms) have molecular structures
that are (largely) not shared with their host, are common to related pathogens, and are
invariant. These molecular signatures are also expressed by nonpathogenic and
commensal bacteria and, depending on the context, may be referred to as pathogen-associated molecular patterns (PAMPs), or microbial-associated molecular
patterns (MAMPs).14 From a functional standpoint, the endogenous equivalents of
these PAMPs are intracellular proteins expressed or released following host tissue
injury. These proteins are known as alarmins and, together with PAMPs, are referred
to as damage-associated molecular patterns (DAMPs).15
Immune cells express a set of receptors known as pattern recognition receptors
(PRRs) that can recognize and bind to DAMPs expressed by invading pathogens and
injured host tissue. At least 4 families of PRRs are recognized: toll-like receptors
(TLRs); nucleotide oligomerization domain leucine-rich repeat (NOD-LRR) proteins;
cytoplasmic caspase activation and recruiting domain helicases such as retinoicacid-inducible gene I (RIG-I)-like helicases (RLHs); and C-type lectin receptors expressed on dendritic and myeloid cells.16,17 These receptors initiate the innate immune
response and regulate the adaptive immune response to infection or tissue injury.
In humans, the TLRs are a family of 10 cell receptors expressed on immune effector
cell surfaces and constitute the prototype PRRs; their structure and function illustrate
many of the steps involved in initial host-pathogen interaction in sepsis. The TLRs are
transmembrane proteins with leucine-rich repeat extracellular domains and an intracellular (cytoplasmic) domain composed of the toll interleukin-1 receptor resistance domain
(TIR domain). PAMPs and DAMPs bind to PRRs, such as TLRs, expressed on the surface
of host cells. In addition, intracellular PRRs exist and interact with intracellular pathogens, viral particles, and proteins released from damaged tissue (Fig. 3, Table 1).
In sepsis, there is a full-blown activation of immune responses due to the release of
high levels of DAMPs from invading microorganisms or damaged host tissue, which
leads to upregulation of TLR expression. This response has been noted in experimental models and in septic patients.18,19 TLR interaction with DAMPs from host
tissue injury primes the innate immune system for enhanced TLR reactivity, resulting
in excess lipopolysaccharide (LPS)-induced mortality.20 Positive feedback loops
between DAMPs/PAMPs and their respective receptors may lead to excessive immunoactivation, characterized by a markedly imbalanced cytokine response with resultant tissue injury. In contrast, polymorphisms in the TLRs have been linked to
increased risks of infection. This association applies equally to polymorphisms in
the downstream signaling cascades. Single nucleotide polymorphisms (SNPs)
The Pathophysiology of Septic Shock
Fig. 3. Innate recognition of pathogens by toll-like (and related) receptors (TLRs). (A) The
complexity of the interaction between innate immune receptors and fungi. Three distinct
components of the cell wall of Candida albicans are recognized by 4 different host receptors: N-linked mannosyl residues are detected by the mannose receptor, O-linked mannosyl
residues are sensed by TLR4, and B-glucans are recognized by the dectin 1-TLR2 complex. (B)
Gram-positive and Gram-negative bacteria are recognized by partly overlapping and partly
distinct repertoire of TLRs. Gram-positive pathogens exclusively express lipoteichoic acid,
Gram-negative pathogens exclusively express LPS; common PAMPs include peptidoglycan,
lipoproteins, flagellin, and bacterial DNA. (Data from van der Poll T, Opal SM. Host-pathogen interactions in sepsis. Lancet Infect Dis 2008;8:35; with permission.)
Table 1
Role of toll-like and other PRRs in the pathophysiology of sepsis
Pattern Recognition
Receptor
Pathogen or Disease
State
TLR 1
Lymedisease
Neisseria meningitides
Triacyl lipopeptides
TLR 2
Gram-positive bacteria
Mostbacteria
Neisseria meningitides
Candida albicans
Hostproteins (DAMPs)
Lipoteiechoic acid
Peptidoglycan, triacyl lipopeptides
Porins
Phospholipomannan, B-glucans
HMGB1
TLR-4
Gram-negative bacteria
Candida albicans
Hostproteins (DAMPs)
Lipopolysaccharide (LPS)
O-linked mannosyl residues
Heatshock proteins, fibrinogen, HMGB1
TLR5
Salmonella (flagellated
bacteria)
Flagellin
NOD proteins
(NOD1 and NOD2)
Gram-negative bacteria
Bacterial peptidoglycan
fragmentsdiamino-pimelate (NOD1)
and muramyl dipeptide (NOD2)
Cytoplasmic caspase
activation and
recruiting domain
helicases
Viruses
Viral nucleic acids
Relevant PAMPs/DAMPs
D-Mannan,
Data from Dellinger RP, Levy MM, Carlet JM, et al. Surviving Sepsis Campaign: international guidelines for management of severe sepsis and septic shock: 2008. Crit Care Med 2008;36:296–327.
685
686
Nduka & Parrillo
identified in TLR4-CD14 have been linked to LPS hyporesponsiveness.21 Higher rates
of Gram-negative septic shock were noted in carriers of these SNPs in a medical intensive unit population.22 It is believed that these SNPs predispose affected individuals to
endotoxin tolerance with inadequate early expression of proinflammatory cytokines.
Pro- and Anti-inflammatory Cellular Signaling/signal Transduction
Signal transduction describes the sequence of intracellular events in response to the
engagement of ligands to their specific receptors (eg, bacterial LPS, cytokines) or
changes in the immediate extracellular environment. These molecular interactions
trigger the induction of specific cellular responses ranging from the expression of
specific gene products (ie, protein production) to adhesion and chemotaxis.
Virtually all intracellular signaling pathways have, as their initial event, activation by
phosphorylation of a target protein. Their target proteins could be transcription factors
or regulatory (cytoplasmic or nuclear) proteins. This activation is typically accomplished by the binding of an enzyme (a kinase) to the target protein, and can lead
to: (1) activation or alteration of its enzymatic activity; (2) changes in the stability of
the target protein; (3) subcellular localization of the protein; and (4) interactions with
other proteins. Many signaling pathways involve a cascade of 2 or more kinases in
series (signaling cascades), involving an upstream kinase involved in enzyme activation and a downstream kinase whose substrate(s) are the protein products of
upstream kinase-substrate interaction. Kinase cascades are activated following
engagement of ligand-specific receptors (eg, Gram-negative LPS 1 TLR-4). In addition, certain disruptions of cellular homeostasis (eg, changes in state of oxidation)
can lead to activation of kinase cascades.
Kinases are able to phosphorylate other kinases, leading to signal amplification.
Thus, a given stimulus may activate multiple kinase cascades, and several kinase
cascades may be activated by different stimuli, leading to some measure of redundancy in a cellular signaling pathway. The natural consequence of amplification and
redundancy in cellular signaling is a significant degree of overlap and lack of specificity
in downstream effects and a requirement for intracellular regulation for effective, hostprotective, stimulus-appropriate signal transduction. This negative regulation with
resultant transcriptional downregulation is accomplished by dephosphorylation of
relevant enzymes leading to a return to baseline levels of activity. Interactions occur
between kinase cascades in such a way that increased activity of a given cascade
produces suppression of activity in ‘‘opposite’’ cascades. This effect is termed cross
talk. In addition, efficient kinase-kinase interaction is facilitated by co-localization of
kinases on anchoring or adaptor proteins at relevant intracellular sites. An understanding of the above aspects of cellular signaling is essential to understanding the
initial events that occur following host-pathogen interaction in sepsis.
Following the attachment of DAMPs/PAMPs to their specific ligands (TLRS) in
severe sepsis, and the subsequent activation of signaling cascades (Fig. 4), there is
modification of the activity of key intracellular proteins, primarily transcription factors
and nuclear and cytoplasmic regulating proteins. For the TLRs, signaling depends
primarily on 4 adaptor proteins: the myeloid differentiation primary-response protein
88 (MyD88); and 3 non-MyD88 proteins: (1) toll/interleukin 1 (IL-1) receptor homology
(TIR) domain-containing adaptor protein (TIRAP); (2) TIR domain-containing adaptor
protein–inducing interferon-b (TRIF); and (3) TRIF-related adaptor molecule (TRAM).
These MyD88-dependent and MyD88-independent signal-transduction pathways
result in the activation of the prototypical transcription factor, nuclear factor-kB
(NFkB). In addition, important enzyme systems regulating several key cellular
The Pathophysiology of Septic Shock
Fig. 4. Binding of toll-like receptors (TLRs) activates intracellular signal-transduction pathways that lead to the activation of transcriptional activators such as interferon regulator
factorsp13K/Akt, activator protein-1, and cytosolic nuclear factor-kappa[b] (NF-[k][b]). Activated NF-[k][b] moves from the cytoplasm to the nucleus, binds to transcription sites and
induces activation of an array of genes for acute phase proteinsiNOS, coagulation factors,
proinflammatory cytokinesand enzymatic activation of cellular proteases. TLR9 DNA, TLR
3 dsRNA, and TLR7/8 ssRNA are endosomal. TLR10 ligand is not defined and TLR1 forms heterodimers with TLR2. LPS, lipopolysaccharide; IRF, interferon regulatory factor; JNK; c-Jun
N- terminal kinase. (Adapted from Cinel I, Opal SM. Molecular biology of inflammation
and sepsis: a primer. Crit Care Med 2009;37(1):291–304; with permission.)
functions and aspects of cellular signaling (the caspases, phosphoinositide 3-kinase
[PI3K] and Rho GTPases) are activated.
NFkB
NFkB is the prototypical transcription factor involved in modulating the expression of
many of the inflammatory responses associated with severe sepsis and septic shock.
It exists as homo- or heterogenous dimers composed of members of the Rel family of
proteins (P50, P105, P52, P100, P65 [Rel A], C-Rel). The Rel family of proteins plays
pivotal roles in inflammation, and various combinations of NFkB differ in their degree
of transcriptional activity (NFkB1-P50 1 P105, NFKB2-P52 1 P100, Rel A [P65]).
In the absence of cellular activation, NFkB exists in the cytoplasm maintained in a
latent form by interacting with inhibitors of the IkB family (IkB-a, IkB-b, IkB-g, IkB-3,
Bcl-3, p100, p105). MyD88-dependent and MyD88-independent kinase pathways
activate NFkB following TLR ligation by diverse stimuli, including bacterial products
(LPS, peptidoglycans), cytokines (tumor necrosis factor-a [TNF-a], IL-8, IL-1b), reactive oxygen species, and changes in the cellular environment, such as ischemia.
Regardless of the nature of the stimuli, activation occurs by phosphorylation of IkB
molecules followed by their degradation by the 26S proteosome. This step results
in nuclear translocation of NFkB, its binding to specific gene promoter regions, and
gene transcription. NFkB is involved in the induction of several predominantly proinflammatory gene products (Table 2).
The degree of NFkB activation in septic patients seems to correlate with patient
survival and outcome in septic shock.23–25 In addition to the pathophysiologic
687
688
Nduka & Parrillo
Table 2
NFkB-inducible genes involved in sepsis
Class
NFkB-Dependent Genes
Acute phase proteins
C-reactive protein
LPS-binding protein
Cytokines
TNF-a
G-CSF, GM-CSF
IL-1a, IL-1B, IL-2, IL-6, IL-12
IFN-b
Chemokines
MIP-1a
MIP-2
Coagulation factors
Tissue factor
Tissue factor pathway inhibitor
Adhesion molecules
ICAM-1
VCAM-1
E-selectin
ELAM-1
Enzymes
Inducible nitric oxide synthase
Cyclo-oxygenase-2
C3 complement
Phospholipase A2
Matrix metalloproteinases
Immunoreceptors
IL-2 receptor-a
Major histocompatibility complex class 1
consequences of excessive NFkB activation, inadequate stimulation can also lead to
increased morbidity in septic shock. Studies support the observation that defective
NFkB signaling leads to immunosuppression in sepsis, favoring apoptosis in immune
effector cells with undesirable consequences.26,27 Thus, excessive activation, especially early in the disease course, or excessive negative regulation in sepsis may
produce either excess inflammation with collateral host tissue damage or immunoparalysis and consequent direct tissue damage.
The caspases
Caspases are a family of cysteine proteases synthesized as proenzymes and activated by proteolysis. They are further subdivided into initiator caspases, activated
by autocleavage, and executioner caspases, activated by cleavage induced by their
initiator counterparts. The caspases play important roles in the cellular processes of
inflammation and apoptosis following PAMP/DAMP-PRRs interaction. Following
cleavage, caspases produce many of the phenotypic changes seen in apoptosis,
including cytoskeletal disintegration, DNA fragmentation, and disruption of cellular
DNA repair molecular machinery. Although the TLRs are the most studied PRPs, the
cytoplasmic NOD-like receptors (NLRs) are the most ubiquitous. Three members of
the NLR family (NALP3, ICE protease-activating factor [IPAF], and apoptosis-associated speck-like protein [ASC]) are involved in caspase activation. It is believed that,
following pathogen recognition by TLRs, a signal is communicated intracellularly
that is recognized by the nucleotide-binding domains of the NLRs. This recognition
results in the activation of a multiprotein complex termed an inflammasome. The inflammasomes are multienzyme complexes (>70 KDa) that serve as molecular platforms for the activation of caspases 1 and 5, resulting in caspase-mediated
activation and secretion of the proinflammatory cytokines IL-1b and IL-18. The signals
The Pathophysiology of Septic Shock
and mechanisms leading to inflammasome assembly/activation are in general still
poorly understood. The inflammasome complexes assembled in sepsis are well characterized and consist of 2 different multiprotein complexes, the NALP1 and NALP3 inflammasomes (Fig. 5). IL-1b is a highly potent proinflammatory cytokine, requiring
inflammasome complex assembly as a prerequisite for caspase-1 activation before
its precursor, pro-IL-1b (p35), released following TLR ligation, can be converted to
its active form, which represents a mechanism to prevent uncontrolled expression
of IL-1b. In addition to the release of proinflammatory cytokines, the caspases target
the enzyme, caspase-activated DNase (CAD). CAD activation induces DNA fragmentation leading to apoptosis. Cytoskeletal caspase targets include spectrin, nuclear
lamin, and the enzyme gelosin, which cleaves actin.28,29 All these play roles in cytoskeletal disintegration. Inflammation-mediated caspase activation contributes to the
host response in septic shock. Experiments in murine sepsis models show that the
deletion of caspase-1 genes prevents the development of sepsis in affected mice.30
Phosphoinositide 3-kinases
Phosphatidylinositol 3-kinases (PI3Ks) are a group of enzymes that, when activated,
catalyze the production of membrane phosphatidylinositol triphosphate (PIP3). PI3K
Fig. 5. The NALP3 inflammasome complex. The NLAP3 inflammasome is composed of NALP3,
ASC, and caspase-1 (a second adaptor protein CADD is present in NALP 3 but lacking in
NALP). ASC interacts with 1 of the NALP proteins through Cognate pyrin domain (PYD)
interactions and with procaspase-1 through homotypic caspase recruitment domain
(CARD) interactions. The human inflammasome complex brings 2 molecules of procaspase-1 (the second via CARDINAL) into close proximity, leading to autocatalysis and the
subsequent release of the active catalytic p20 and p10 domains of caspase-1. NALP3 binds
ATP via the NACHT (nucleoside triphosphatase [NTPase] domain), is a precursor of IL-1B
into its biologically active fragment, and a potent mediator of fever and inflammation.
There is no CARDINAL homolog in the mouse and, hence, murine NALP3 is believed to
recruit only a single caspase-1 molecule. (TLRs, toll-like receptors; ATP, adenosine triphosphate; NLRs, nucleotide-binding oligomerization domain (NOD)-like receptors; ASC,
apoptosis-associated specklike protein containing a CARD; NALP, NACHT-, LRR-, and
PYD-containing protein; LRRs, leucine-rich repeats). (From Trendelenburg G. Acute neurodegeneration and the inflammasome: central processor for danger signals and the inflammatory response? J Cereb Blood Flow Metab 2008;28:867–81; with permission).
689
690
Nduka & Parrillo
is activated by a variety of growth factor, hormonal, and chemokine receptors and,
together with its downstream counterpart, the serine/threonine kinase Akt (protein
kinase B), regulates key aspects of cell proliferation and survival. The downstream
targets of PI3K/Akt signaling include direct regulators of neutrophil functioning,
including chemotaxis, adhesion, and apoptosis.26 Three isoforms of PI3Ks exist
(PI3K-a, PI3K-b, and PI3K-y) with PI3K-y found exclusively in leukocytes. PI3K can
function either as a positive or negative regulator of TLR signaling and, depending
on the cell type or specific TLR involved, activate either the NFKB or mitogen-activated protein kinase (MAPK) signaling pathways.31 The NFKB signaling pathway
has already been reviewed. The MAPK signaling pathway consists of 3 distinct pathways described in leukocytes: p38, extracellular signal-regulated kinase (ERK), and
c-jun NH2-terminal kinase (JNK). These are serine/threonine enzymes that act as
the final kinase in a 3-kinase cascade.
The p38 pathway is activated by a broad range of PAMPs (LPS, peptidoglycan)
and inflammatory cytokines (tumor necrosis factor [TNF], IL-1, platelet-activating
factor), and plays a role in neutrophil cytokine production, adhesion, chemotaxis,
respiratory burst, and apoptosis.32,33 The ERK pathway is activated by several mitogens (platelet-derived growth factor, insulin, epidermal growth factor, angiotensin II),
and in monocyte LPS and cellular adherence. Its primary role is as a regulator of
cellular proliferation and differentiation, but it plays significant roles in cytokine
(TNF-a) production and chemotaxis to C6a and IL-8. As a positive mediator of
TLR signaling, PI3K, together with p38 and ERK, mitogen-activated phosphokinases, leads to production of proinflammatory cytokines IL-1a, IL-6, and IL-8 on
microbial challenge.34,35 The JNK pathway is activated by ligand receptor GTPases,
cytokines (IL-1), and ultraviolet radiation. This pathway is important in cellular proliferation and apotosis.
In addition to enabling expression of the immune response, the PI3K/Akt signaling
pathway acts as an endogenous negative feedback mechanism that serves to limit
proinflammatory and apoptotic events, as seen in monocytes in response to endotoxin.36 It can also promote the generation of anti-inflammatory cytokine IL-10,37
and helps balance Th1 versus Th2 responses.38
The ability of PI3K to modulate events in sepsis in a bidirectional fashion suggests
that it could play a role in enhancing the efficacy of the innate immune response and
limiting excessive inflammation. This perspective is supported by recent experimental
evidence in which, following PI3K gene deletion, mice exposed to a pneumococcal
virulence factor developed more neutrophil-mediated alveolar injury despite inadequate alveolar macrophage recruitment.39
Rho GTPases
Cell surface ligand receptors consist of an extracellular ligand-binding domain connected by a single transmembrane region to an intracellular domain that possesses
either intrinsic enzyme activity or enzyme activation capabilities. The G-protein–linked
family of receptors are the most ubiquitous and are referred to as GTPases (GTP
hydrolysis is required for receptor activation and signal transduction). The Rho and
Rac subfamilies of GTPases play a central role in the regulation of cell motility by
controlling actin cytoskeleton rearrangement following the binding of specific proteases to the cell surface. Following DAMP-PRP interaction, Rho- and Rac-GTPases
help regulate the mechanical aspects of the cellular response by the innate immune
system. These include cellular migration, pathogen uptake, phagocytosis, and maintenance of endothelial integrity.40,41 Rac1 activation is required for PI3K activation on
TLR stimulation.42
The Pathophysiology of Septic Shock
Release of Pro- and Anti-Inflammatory Mediators
One of the immediate consequences of cellular signaling in severe sepsis and septic
shock is the synthesis and release of increased amounts of mediators into the
systemic circulation in an attempt to activate more immune effector cells and recruit
them to the site of infection. These highly potent molecules are normally present in
the circulation in low concentrations, but in high concentrations, or with prolonged
exposure, they can exert potentially harmful biologic effects. Over-expression of
inflammatory mediators early in the course of sepsis plays a significant role in the
eventual development of septic shock. This sequential release of mediators has
been termed the cytokine cascade. The availability of precise molecular tools, and
the ability to measure cytokine levels, has shed light on the patterns of cytokine
release in sepsis, with the earliest cytokines, highly proinflammatory TNF-a and IL1b, being responsible for the earliest clinical events in sepsis. The subsequent,
and sometimes concomitant, release of counterinflammatory mediators has also
been observed. In addition, a clearer understanding of the source, structure, and
actions of specific cytokines in the development of septic shock has emerged
(Table 3), and novel mediators have been discovered. Selected novel cytokine mediators and new ideas regarding the role of otherwise well-known mediators are reviewed below.
High-mobility group box 1 protein
High-mobility group box 1 protein (HMGB1) is a nuclear and cytoplasmic protein originally discovered 3 decades ago as a nuclear binding protein, and was so named
because of its rapid mobility on electrophoresis gels. HMGB1 is amongst the most ubiquitous, abundant proteins in eukaryotes, and plays a major role in facilitating gene transcription by stabilizing nucleosome formation. More recent findings suggest that
HMGB1 is active in DNA recombination, repair, replication, and gene transcription, facilitated by internal repeats of positively charged domains of the N terminus (HMG boxes).
HMGB1 is released passively by necrotic (but not apoptotic) cells, and from macrophages, dendritic cells, and natural killer cells, on activation by microbial pathogens.
The known biologic effects of HMGB1 are based on data obtained from cell
cultures. HMGB1 stimulates the release of proinflammatory cytokines, including
TNF and IL-8, in macrophages/monocytes and endothelial cells. HMGB1 can also
bind to and induce the expression of the cellular receptor for advanced glycation
end products (RAGE) and adhesion molecules (vascular cell adhesion molecule-1
[VCAM-1], intercellular adhesion molecule-1 [ICAM-1]) in human endothelial cells.
The induced expression of RAGE facilitates activation of the transcription factor
NFKB and MAPKs. These observations suggest a role for HMGB1 as a proinflammatory cytokine, with significant adverse effects on gut barrier function, and as a regulator
of the coagulation system.
At present, HMGB1 does not seem to contribute significantly to the development of
septic shock.
Macrophage migration inhibitory factor
Originally described as a T cell product, macrophage migration inhibitory factor
(MMIF) is a cytokine produced by various cell types including other immune effector
and neuroendocrine cells. MMIF is capable of activating T cells and inducing proinflammatory cytokine production in macrophages. Serum MMIF concentrations are
increased in septic patients and, in severe sepsis, elevated MMIF concentrations
seem to be an early indicator of poor outcome of septic patients in intensive care.
691
692
Nduka & Parrillo
Table 3
Cytokine and noncytokine mediators of septic shock
Class
Mediator
Source
Role in Septic Shock
Proinflammatory
Cytokines
Interleukin-1b
Monocytes
Macrophages
Lymphocytes
Endothelial cells
Activated macrophages
Fever, hypotension,
T cell and macrophage activation, myocardial suppression
Tumor necrosis factor-a
Interleukin-6
Interleukin-17
T cells
B cells
Endothelial cells
Activated macrophages
and monocytes
Kupffer cells
Activated T cells
Interleukin-18
Activated macrophages
Interferon-g
Macrophage inhibitory
factor/macrophage
migration inhibitory
factor (MIF)
Natural killer cells
Activated macrophages
Interleukin-8
Fever, hypotension, myocardial depression (myocytes in culture), neutrophil
and endothelial cell activation
Induction of lymphocyte (B and T cell) proliferation
Chemotactic for neutrophils and T cells
Induces the synthesis of other cytokines IL-6, G-CSF, GM-CSF, IL-1b, TGF-b,
TNF-a and chemokines
Alongwith IL-12, initiates the cell-mediated immune response.
Increased secretion of interferon-g
Defense against viral and intracellular bacterial pathogens
Increased TNF expression
Increased TLR4 expression
Anti-inflammatory
cytokines
Interleukin-10
IL-4
IL-1Ra
TGF-B
Epithelial cells
Monocytes
Lymphocytes
?
Monocytes
Various host cells
Downregulation of macrophage function leading to decreased TNF-a
Induces differentiation of naive helper T cells to Th2 cells
Block IL-1 activity
Interferes with phagocytic activation
Endothelial Factors
Nitric oxide
Increased microvascular permeability
Lossof vasomotor tone
Myocardial depression
Peripheral venous pooling
Hormones
Vasopressin
Glucocorticoids
Posterior pituitary gland
Hypothamic-pituitary axis
Relative deficiency may cause or worsen circulatory failure
Arachidonic acid
metabolites
Prostaglandins
Leukotrienes
Thromboxanes
Immune effector cells
Pancreas
Airway reactivity
Vasoconstriction
Platelet aggregation
Increased vascular permeability
Others
Platelet-activating factor
Endothelial cells
Macrophages
Neutrophils
Histamine release from platelets
Activation of endothelial cells
Myocardial depressant
factors
Histamine release,
Increased capillary permeability, vasodilation
Pancreas
Negative inotropy
Impaired phagocytosis
The Pathophysiology of Septic Shock
Complement proteins
C3a-C5a
693
694
Nduka & Parrillo
Based on our present understanding, MMIF does not seem to play a significant role in
the development of septic shock.
Immune and Nonimmune Effector Cell Dysfunction
The normal immune effector response in response to cytokine release is lost in severe
sepsis. The dysfunctions can involve every cell type from antigen-presenting cells
(dendritic cells) to neutrophils and macrophages. The nature of cellular dysfunction
is similar to the associated cytokine homeostatic imbalance with elements of
increased cellular activity and cellular hyporesponsiveness.
Neutrophil dysfunction in severe sepsis
Neutrophils are key cells in the innate immune system and act primarily by recognizing
and destroying pathogens by a coordinated series of steps including adhesion,
chemotaxis, phagocytosis, and the release of cytotoxic molecules, followed by
apoptotic cell death with the neutrophils spending approximately 7 hours in the
systemic circulation. In severe sepsis the tight regulation of neutrophil function is
lost, leading to excessive neutrophil activation and prolonged survival. These activated neutrophils induce endothelial dysfunction, release cytotoxic molecules, and
lead to inflammatory host organ injury.
Accelerated lymphocytic apoptosis
The T-helper lymphocytes play key roles in the adaptive immune response following
activation by antigen-presenting cells of the innate immune system. Following activation, the initial lymphocyte response is proinflammatory, with the emergence of a regulatory phenotype after several days. Severe sepsis is characterized by accelerated
apoptotic death of lymphocytes leading to lymphocyte depletion and loss of the T
lymphocyte regulatory function.43
In addition to immune effector dysfunction, there is widespread nonimmune cellular
dysfunction in severe sepsis. The alterations relevant to the development of cardiocirculatory failure in the setting of severe sepsis are discussed in a later section.
Interactions with Other Biologic Systems in Severe Sepsis
The coagulation cascade in severe sepsis
As much as 4 decades ago, it was apparent that the coagulation system was abnormally activated in septic patients,44–46 and, by 1970, Dr James Corrigan47 had published on the potential use of anticoagulant therapy (heparin) to treat disordered
coagulation in sepsis. Almost all patients with septic shock have coagulation abnormalities. The nature and degree of coagulation dysfunction ranges from clinically silent
biochemical evidence of dysfunction to full-blown disseminated intravascular coagulation (DIC). An understanding of the hemostatic system, including the blood coagulation pathways and the natural anticoagulant pathways, is necessary for any
meaningful review of sepsis-induced coagulation dysfunction.
Although the classic model of coagulation (extrinsic and intrinsic pathways) may
be helpful in the interpretation of commonly used laboratory tests of coagulation
disorders, it does not represent a clinically relevant model of hemostasis in physiologic and, more importantly, pathophysiologic states such as sepsis. Current
understanding of hemostasis describes the coagulation pathway as a 3-phase
process (initiation, amplification, and thrombin action), with considerable overlap
between the phases. These phases are counterbalanced by active natural anticoagulant systems targeting key steps in the coagulation cascade. The result is
a hemostatic system that begins to form a clot less than 30 seconds following
The Pathophysiology of Septic Shock
vascular injury, with the process of thrombolysis initiated as soon as a thrombus is
formed.
Initiation occurs shortly after vascular injury and is the result of increased tissue
factor (TF) expression by TF-bearing adventitial cells and platelets. Limited amounts
of TF bind to and activate factor VII (FVII). The TF-FVIIa complex leads to production
of a limited amount of thrombin.
Amplification consists of thrombin activating platelets and other coagulation cofactors during the amplification phase. There is release of significant amounts of
prothrombin (factor X) and, together with platelets and the other coagulation factors,
a prothrombinase complex (factor Xa and coagulation factors bound to activated
platelets) is formed and is primarily responsible for the burst of thrombin production
leading to the third phase of clot formation.
The final phase of coagulation involves thrombin-dependent recruitment of additional coagulation factors (FV and FXIII) into the coagulation process, maintaining
platelet activation and facilitating the conversion of fibrinogen to fibrin.
The natural anticoagulant systems serve to prevent clot formation in the absence of
vascular injury and prompt lysis of clots formed following vascular injury.
The balance between procoagulant and anticoagulant arms of the hemostatic
process is disrupted in severe sepsis. The inflammatory response to severe infection
results in a systemic dysfunction of the coagulation system. The events that constitute
coagulation dysfunction in septic shock can be divided into an initial activation, followed by a largely dysregulated response with suppression of the antifibrinolytic
systems. Cytokines released as part of the inflammatory response mediate many of
the hypercoagulable responses triggered in severe sepsis and septic shock, and
the available evidence suggests contributory roles for immune effector cells, endothelial dysfunction, and metabolic alterations in the tissue. It is now understood that, in
sepsis, the interaction between the coagulation and inflammatory systems is bidirectional (Fig. 6). Binding of coagulation proteases (thrombin or TF) or anticoagulant
proteins (activated protein C [APC]) to specific cell receptors on mononuclear cells
or endothelial cells may affect cytokine production or inflammatory cell apoptosis.
Endothelial cells respond to the cytokines expressed and released by activated leukocytes, but they can also release cytokines themselves. Endothelial cells are able to
express adhesion molecules and growth factors that promote the inflammatory
response and also affect the coagulation response. Endothelial cells play a prominent
role in all 3 major pathogenetic pathways associated with coagulopathy in sepsis: TFmediated thrombin generation, dysfunctional anticoagulant pathways, and inhibition
of fibrinolysis.
APC acts in conjunction with the cofactor protein S to deactivate clotting factors Va
and VIIIa, preventing ongoing thrombin generation by the prothrombinase complex.
APC may also inhibit inflammation by inhibiting cytokine production, preventing neutrophil activation, and inhibiting leukocyte adhesion and rolling. Other key mediators in the
hypercoagulable cascade in sepsis include antithrombin and TF pathway inhibitor.
This complex cross talk between the inflammatory and coagulation cascades represents a vicious cycle which, if uninterrupted, results in tissue injury, organ dysfunction,
and cellular death.
Neural regulation of the immunoinflammatory response: the vagal inflammatory
reflex and sympathetic effects on the host response
In addition to the humoral mechanisms that act to prevent tissue injury from
excessive release of proinflammatory mediators, emerging research suggests
a role for neural modulation of inflammation. One of the earliest documented
695
696
Nduka & Parrillo
Fig. 6. Schematic overview of the major pathways involved in the interrelation between
coagulation, anticoagulant pathways, and fibrinolysis and inflammation. 1, stimulatory
effect; –, inhibitory effect; IL, interleukin; PAI-1, plasminogen activator inhibitor-1; TAFI,
thrombin activatable fibrinolysis inhibitor; TNF, tumor necrosis factor; u-PA, urinary plasminogen activator; u-PAR, urokirlase-type plasminogen activator receptor. (From Levi M, van
der Poll T. The central role of the endothelium in the crosstalk between coagulation and
inflammation in sepsis. Adv Sepsis 2004;3:93; with permission).
observations supporting the existence of central autonomic interaction with the immunoinflammatory response involved a serendipitous finding that, with central
administration of a TNF inhibitor, efferent vagal activity was stimulated with
systemic anti-inflammatory action.48
Subsequent work in animal sepsis models demonstrated significant inhibition of
TNF expression following vagal stimulation and improved disease end points in these
models.49,50 In addition, rendering these animals immune to vagal stimulation either by
genetic manipulation or vagotomy led to an exaggerated proinflammatory cytokine
response.51 It is now understood that these cytokine-suppressive effects of vagal
stimulation are mediated by the release of its neurotransmitter acetylcholine (ACh)
and its subsequent interaction with ACh receptors expressed by macrophages and
other immune effector cells.52,53 The best characterized of these cholinergic receptors
that suppress cytokines is the a7 subunit of the nicotinic acetylcholine receptor (a7
nAChR).
This autonomic parasympathetic-mediated immune modulation system has been
termed the inflammatory reflex (Fig. 7), with an immunosensing afferent arm (cytokine
stimulation of vagal afferents) and an efferent immunosuppressing arm (the cholinergic
anti-inflammatory pathway).54 Recent studies suggest that the spleen plays a significant role as an effector organ for this pathway.
The Pathophysiology of Septic Shock
Fig. 7. Wiring of the inflammatory reflex. Inflammatory products produced in damaged
tissues activate afferent signals that are relayed to the nucleus tractus solitarius; subsequent
activation of vagus efferent activity inhibits cytokine synthesis through the cholinergic antiinflammatory pathway (‘the inflammatory reflex’). Information can also be relayed to the
hypothalamus and the dorsal vagal complex to stimulate the release of ACTH, thereby activating the humoral anti-inflammatory pathway. Activation of the sympathetic outflow by
flight-or-fight responses or pain, or through direct signalling, can increase local concentrations of adrenaline and noradrenaline, which can suppress inflammation further. (Data from
Tracey KJ. The inflammatory reflex. Nature 2002;420:857).
The sympathetic ANS consists of sympathetic neurons and the adrenal medulla,
with catecholamines as the neurotransmitter. In addition to the adrenal medulla and
sympathetic neurons, immune effector cells are also a source of catecholamines in
severe sepsis.55 Early uncomplicated sepsis is characterized by high circulating catecholamine levels with significant metabolic (catabolic state), immunomodulaory
(excessive inflammation), and cardiocirculatory (increased cardiac output) consequences. Prolonged elevation of circulating catecholamines is toxic to host cells, predisposing the patient to cardiocirculatory failure with hypotension resulting from
peripheral vasodilatation and compromised myocardial contractility.56 Septic shock
is more often characterized by depletion of endogenous catecholamine stores and,
possibly, catecholamine resistance.
697
698
Nduka & Parrillo
CARDIOCIRCULATORY DYSFUNCTION IN SEVERE SEPSIS RESULTING IN PROGRESSION
TO SEPTIC SHOCK
The widespread disruptions in severe sepsis can result in cardio-circulatory dysfunction manifesting as shock. The dysfunction involves the cardiac, peripheral vascular
(macrovascular) and microcirculatory elements of the circulation and, depending on
the degrees of cardiac or vascular dysfunction and the volume status of the patient,
a clinical picture ranging from cold, clammy and under-perfused to one of hyperdynamic shock, may be seen, although, in clinical medicine, hyperdynamic shock is
seen much more frequently. The situation in septic shock is further complicated by
widespread microcirculatory dysfunction, further impairing tissue oxygen delivery,
and diminished mitochondrial activity resulting in impaired oxygen extraction. A review
of characteristics and pathogenetic mechanisms that underlie cardiac and macrovascular dysfunction in septic shock follows. The microcirculatory alterations are discussed elsewhere in this issue.
Over 5 decades, multiple methods of myocardial function assessment have been
used to study ventricular performance in severe sepsis and septic shock.57–60 The
results have been largely similar and the characteristic pattern of cardiac performance
during septic shock has been proved to be one of reduced left and right ventricular
ejection fractions, increased end-diastolic and end-systolic volumes of both ventricles, and normal stroke volume; heart rate and cardiac output are elevated, and
systemic vascular resistance is reduced. The reduction in the ejection fraction and
the biventricular dilatation occur 24 to 48 hours after the onset of sepsis and, like
most other organs affected by the septic process, it is reversible with restoration of
myocardial function if patients survive up to 10 days after their onset. An inability to
maintain cardiac output during this critical period is associated with a poor outcome,61
and ventricular dilatation allows for an increased end-diastolic volume and helps maintain cardiac output. Thus, the decrease in ejection fraction with ventricular dilatation in
septic shock may be an appropriate adaptive response to myocardial dysfunction.
Myocardial depression results from the direct or indirect effects of 1 or more circulating myocardial depressant substances. In experiments, ultrafiltrates from patients
with severe sepsis show cardiotoxic effects.62 Several of the cytokines released in
severe sepsis probably contribute to this dysfunction.
TNF-a and IL-1
TNF-a and IL-1 are associated with myocyte dysfunction and may explain the early
myocardial depression seen in sepsis. In one series of studies using in vitro myocardial
cells and human septic shock serum, TNF and IL-1 were shown to be responsible for
the myocardial depressant activity present in human sera.63 These cytokines are
potent inducible nitric oxide synthase (iNOS) inducers, and this probably represents
one of the direct mechanisms for myocardial depression.
Nitric Oxide
Severe sepsis is associated with increased expression of iNOS and increased nitric
oxide production. NO interferes with myocyte calcium metabolism and may impair
contractile function. In addition, reactive nitrogen species such as peroxynitrite,
produced by NO interacting with superoxide ions, are directly toxic to myocytes.
Experimental observations support a role for NO-mediated myocardial depression
in sepsis. Cardiac function was preserved following LPS challenge in iNOS-deficient
mice.64
The Pathophysiology of Septic Shock
Vascular Dysfunction
Vascular alterations in septic shock are mainly due to the effects of mediators on
vascular smooth muscle and endothelial dysfunction.
The NO released seems to be primarily responsible for vascular smooth muscle
dysfunction in sepsis. NO causes a hyperpolarization of smooth muscle plasma
membranes, rendering them unresponsive to catecholamines and causing a vasodilatory state. In addition to the above, these patients may have relative vasopressin or
cortisol deficiencies, leading to further catecholamine unresponsiveness and refractory shock.
Endothelial dysfunction leads to an inability of the endothelial cells to maintain
vascular tone with loss of blood pressure. In addition, endothelial damage leads to
capillary leak with intravascular volume depletion and edema formation in involved
organs.
SUMMARY
Septic shock remains a significant challenge for clinicians. Recent advances in cellular
and molecular biology have significantly improved our understanding of its pathogenetic mechanisms. These improvements in understanding should translate to better
care and improved outcomes for these patients.
REFERENCES
1. Geroulanos S, Douka ET. Historical perspective of the word ‘‘sepsis.’’ Intensive
Care Med 2006;32:2077.
2. Vincent JL, Abraham E. The last 100 years of sepsis. Am J Respir Crit Care Med
2006;173:256–63.
3. Schottmueller H. Wesen und Behandlung der Sepsis [The nature and therapy of
sepsis]. Inn Med 1914;31:257–80 [in German].
4. Cannon WB. Traumatic shock. New York: D Appleton and Co; 1923.
5. Kumar A, Parrillo J. Shock: classification, pathophysiology, and approach to
management. In: Parillo JE, Dellinger RP, editors. Critical care medicine: principles of diagnosis and management in the adult. 3rd edition. Philadelphia: Mosby
Elsevier; 2008. p. 377–422.
de
ric, Glaichenhaus Nicolas. Imaging host–pathogen
6. Campisi Laura, Brau Fre
interactions. Immunol Rev 2008;221(1):188–99.
7. Bassler BL. Small talk. Cell-to-cell communication in bacteria. Cell 2002;109:
421–4.
8. Taga ME, Bassler BL. Chemical communication among bacteria. Proc Natl Acad
Sci U S A 2003;100(Suppl 2):14549–54.
9. Davies DG, Parsek MR, Pearson JP, et al. The involvement of cell-to-cell signals in
the development of a bacterial biofilm. Science 1998;280:295–8.
10. Shiner EK, Rumbaugh KP, Williams SC. Inter-kingdom signaling: deciphering the
language of acyl homoserine lactones. FEMS Microbiol Rev 2005;29:935–47.
11. Hooi DS, Bycroft BW, Chhabra SR, et al. Differential immune modulatory activity
of Pseudomonas aeruginosa quorum-sensing signal molecules. Infect Immun
2004;72:6463–70.
12. Miller MB, Bassler BL. Quorum sensing in bacteria. Annu Rev Microbiol 2001;55:
165–99.
699
700
Nduka & Parrillo
13. Whiteley M, Lee KM, Greenberg EP. Identification of genes controlled by quorum
sensing in Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 1999;96:
13904–9.
14. Cinel I, Dellinger RP. Advances in pathogenesis and management of sepsis. Curr
Opin Infect Dis 2007;20:345–52.
15. van der Poll T, Opal SM. Host-pathogen interactions in sepsis. Lancet Infect Dis
2008;8:32–43.
16. Creagh EM, O’Neill LA. TLRs, NLRs and RLRs: a trinity of pathogen sensors that
co-operate in innate immunity. Trends Immunol 2006;27:352–7.
17. Granucci F, Foti M, Ricciardi-Castagnoli P. Dendritic cell biology. Adv Immunol
2005;88:193–233.
18. Uematsu S, Akira S. Toll-like receptors and innate immunity. J Mol Med 2007;84:
712–25.
19. Mollen KP, Anand RJ, Tsung A, et al. Emerging paradigm: toll-like receptor
4-sentinel for the detection of tissue damage. Shock 2006;26:430–7.
20. Paterson HM, Murphy TJ, Purcell EJ, et al. Injury primes the innate immune
system for enhanced toll-like receptor reactivity. J Immunol 2003;171:
1473–83.
21. Arcaroli J, Fessler MB, Abraham E. Genetic polymorphisms and sepsis. Shock
2005;24:300–12.
22. Gibot S, Cariou A, Drouet L, et al. Association between a genomic polymorphism
within the CD14 locus and septic shock susceptibility and mortality rate. Crit Care
Med 2002;30:969–73.
23. Arcaroli J, Silva E, Maloney JP, et al. Variant IRAK-1 haplotype is associated with
increased nuclear factor-kappaB activation and worse outcomes in sepsis. Am J
Respir Crit Care Med 2006;173:1335–41.
24. Zaph C, Troy AE, Taylor BC, et al. Epithelial cell-intrinsic IKK-beta expression
regulates intestinal immune homeostasis. Nature 2007;446:552–6.
25. Liu YJ, Soumelis V, Watanabe N, et al. TSLP: an epithelial cell cytokine that
regulates T cell differentiation by conditioning dendritic cell maturation. Annu
Rev Immunol 2007;25:193–219.
26. Peck-Palmer OM, Unsinger J, Chang KC, et al. Deletion of MyD88 markedly
attenuates sepsis-induced T and B lymphocyte apoptosis but worsens survival.
J Leukoc Biol 2008;83:1009–18.
27. Adib-Conquy M, Moine P, Asehnoune K, et al. Toll-like receptor-mediated tumor
necrosis factor and interleukin-10 production differ during systemic inflammation.
Am J Respir Crit Care Med 2003;168:158–64.
28. Ayscough KR, Gourlay CW. The actin cytoskeleton: a key regulator of apoptosis
and aging. Nat Rev Mol Cell Biol 2005;6:583–9.
29. Fischer U, Jänicke RU, Schulze-Osthoff K. Many cuts to ruin: a comprehensive
update of caspase substrates. Cell Death Differ 2003;10(1):76–100.
30. Sarkar A, Hall MW, Exline M, et al. Caspase-1 regulates E. coli sepsis and splenic
B cell apoptosis independently of IL-1[beta] and IL-18. Am J Respir Crit Care
Med 2006;174:1003–10.
31. Cantley LC. The phosphoinositide 3-kinase pathway. Science 2002;296:1655–7.
32. Nick JA, Young SK, Arndt PG, et al. Selective suppression of neutrophil accumulation in ongoing pulmonary inflammation by systemic inhibition of p38 MAP
kinase. J Immunol 2002;169(9):5260–9.
33. Yum HK, Arcaroli J, Kupfner J, et al. Involvement of phosphoinositide 3-kinases in
neutrophil activation and the development of acute lung injury. J Immunol 2001;
167(11):6601–8.
The Pathophysiology of Septic Shock
34. Ojaniemi M, Glumoff V, Harju K, et al. Phosphatidylinositol kinase is involved in
Toll-like receptor 4-mediated cytokine expression in mouse macrophages. Eur
J Immunol 2003;335:597–605.
35. Guillot L, Le Goffic R, Bloch S, et al. Involvement of toll-like receptor 3 in the
immune response of lung epithelial cells to double-stranded RNA and influenza
A virus. J Biol Chem 2005;280:5571–80.
36. Guha M, Mackman N. The PI3K-Akt pathway limits LPS activation of signaling
pathways and expression of inflammatory mediators in human monocytic cells.
J Biol Chem 2002;277:32124–32.
37. Pengal RA, Ganesan LP, Wei G, et al. Lipopolysaccharide-induced production of
interleukin-10 is promoted by the serin threonine kinase Akt. Mol Immunol 2006;
43:1557–64.
38. Fukao T, Koyasu S. PI3K and negative regulation of TLR signaling. Trends Immunol 2003;24:358–63.
39. Maus UA, Backi M, Winter C, et al. Importance of phosphoinositide 3-kinase
gamma in the host defense against pneumococcal infection. Am J Respir Crit
Care Med 2007;175(9):958–66.
40. Hall A, Rho GT. Pases and the actin cytoskeleton. Science 1998;279:509–14.
41. Ruse M, Knaus UG. New players in TLR-mediated innate immunity. Immunol Res
2006;34:33–48.
42. Arbibe L, Mira JP, Teusch N, et al. Toll-like receptor 2-mediated NF-kappa B activation requires a Racl dependent pathway. Nat Immunol 2000;1:533–54.
43. Hotchkiss RS, Karl IE. The pathophysiology and treatment of sepsis. N Engl J
Med 2003;348:138–50.
44. Rapaport SI, Tatter D, Coeur-Baron N. Pseudomonas septicemia with intravascular clotting leading to the generalized Shwartzman reaction. N Engl J Med
1964;271:80.
45. Corrigan JJ, Ray WL, May N. Changes in the blood coagulation system associated with septicemia. N Engl J Med 1968;279:851–6.
46. Beller FK. The role of endotoxin in disseminated intravascular coagulation.
Thromb Diath Haemorrh Suppl 1969;36:125–49.
47. Corrigan JJ, Jordan CM. Heparin therapy in septicemia with disseminated intravascular coagulation. N Engl J Med Shock 1970;283:778–82.
48. Bernik TR, Friedman SG, Ochani M, et al. Pharmacological stimulation of the
cholinergic antiinflammatory pathway. J Exp Med 2002;195:781–8.
49. Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation attenuates the
systemic inflammatory response to endotoxin. Nature 2000;405:458–62.
50. Altavilla D, Guarini S, Bitto A, et al. Activation of the cholinergic anti-inflammatory
pathway reduces NF-kappab activation, blunts TNF-alpha production, and
protects against splanchic artery occlusion shock. Shock 2006;25:500–6.
51. Huston JM, Ochani M, Rosas-Ballina M, et al. Splenectomy inactivates the cholinergic antiinflammatory pathway during lethal endotoxemia and polymicrobial
sepsis. J Exp Med 2006;203:1623–8.
52. Wang H, Yu M, Ochani M, et al. Nicotinic acetylcholine receptor alpha7 subunit is
an essential regulator of inflammation. Nature 2003;421:384–8.
53. Wang H, Liao H, Ochani M, et al. Cholinergic agonists inhibit HMGB1 release and
improve survival in experimental sepsis. Nat Med 2004;10:1216–21.
54. Tracey KJ. Physiology and immunology of the cholinergic antiinflammatory
pathway. J Clin Invest 2007;117:289–96.
55. Flierl MA, Rittirsch D, Nadeau BA, et al. Phagocyte-derived catecholamines
enhance acute inflammatory injury. Nature 2007;449:721–5.
701
702
Nduka & Parrillo
56. Annane D, de la Grandmaison G, Brouland JP, et al. Inappropriate sympathetic
activation at onset of septic shock: a spectral analysis approach. Am J Respir
Crit Care Med 1999;160:458–65.
57. Calvin JE, Driedger AA, Sibbald WJ. An assessment of myocardial function in
human sepsis utilizing ECG gated cardiac scintigraphy. Chest 1981;80:579–86.
58. Parker MM, McCarthy KE, Ognibene FP, et al. Right ventricular dysfunction and
dilatation, similar to left ventricular changes, characterize the cardiac depression
of septic shock in humans. Chest 1990;97:126–31.
59. Munt B, Jue J, Gin K, et al. Diastolic filling in human severe sepsis: an echocardiographic study. Crit Care Med 1998;26:1829–33.
60. Poelaert J, Declerck C, Vogelaers D, et al. Left ventricular systolic and diastolic
function in septic shock. Intensive Care Med 1997;23:553–60.
61. Parker MM, Shelhamer JH, Natanson C, et al. Serial cardiovascular variables in
survivors and nonsurvivors of human septic shock: heart rate as an early
predictor of prognosis. Crit Care Med 1987;15:923–9.
62. Parrillo JE, Burch C, Shelhamer JH, et al. A circulating myocardial depressant
substance in humans with septic shock: septic shock patients with a reduced
ejection fraction have a circulating factor that depresses in vitro myocardial cell
performance. J Clin Invest 1985;76:1539–53.
63. Kumar A, Thota V, Dee L, et al. Tumor necrosis factor-alpha and interleukin-1 beta
are responsible for depression of in vitro myocardial cell contractility induced by
serum from humans with septic shock. J Exp Med 1996;183:949–58.
64. Ullrich R, Scherrer-Crosbie M, Bloch KD, et al. Congenital deficiency of nitric
oxide synthase 2 protects against endotoxin-induced myocardial dysfunction in
mice. Circulation 2000;102:1440–6.
Special Article
Surviving Sepsis Campaign: International guidelines for
management of severe sepsis and septic shock: 2008
R. Phillip Dellinger, MD; Mitchell M. Levy, MD; Jean M. Carlet, MD; Julian Bion, MD; Margaret M. Parker, MD; Roman Jaeschke, MD;
Konrad Reinhart, MD; Derek C. Angus, MD, MPH; Christian Brun-Buisson, MD; Richard Beale, MD; Thierry Calandra, MD, PhD;
Jean-Francois Dhainaut, MD; Herwig Gerlach, MD; Maurene Harvey, RN; John J. Marini, MD; John Marshall, MD; Marco Ranieri, MD;
Graham Ramsay, MD; Jonathan Sevransky, MD; B. Taylor Thompson, MD; Sean Townsend, MD; Jeffrey S. Vender, MD;
Janice L. Zimmerman, MD; Jean-Louis Vincent, MD, PhD; for the International Surviving Sepsis Campaign Guidelines Committee
Objective: To provide an update to the original Surviving Sepsis Campaign
clinical management guidelines, “Surviving Sepsis Campaign Guidelines for Management of Severe Sepsis and Septic Shock,” published in 2004.
Design: Modified Delphi method with a consensus conference of 55 international experts, several subsequent meetings of subgroups and key individuals,
teleconferences, and electronic-based discussion among subgroups and among
the entire committee. This process was conducted independently of any industry
funding.
Methods: We used the Grades of Recommendation, Assessment, Development
and Evaluation (GRADE) system to guide assessment of quality of evidence from
high (A) to very low (D) and to determine the strength of recommendations. A
strong recommendation (1) indicates that an intervention’s desirable effects
clearly outweigh its undesirable effects (risk, burden, cost) or clearly do not. Weak
recommendations (2) indicate that the tradeoff between desirable and undesirable
effects is less clear. The grade of strong or weak is considered of greater clinical
importance than a difference in letter level of quality of evidence. In areas without
complete agreement, a formal process of resolution was developed and applied.
Recommendations are grouped into those directly targeting severe sepsis, recommendations targeting general care of the critically ill patient that are considered high priority in severe sepsis, and pediatric considerations.
Results: Key recommendations, listed by category, include early goal-directed
resuscitation of the septic patient during the first 6 hrs after recognition (1C);
blood cultures before antibiotic therapy (1C); imaging studies performed promptly
to confirm potential source of infection (1C); administration of broad-spectrum
antibiotic therapy within 1 hr of diagnosis of septic shock (1B) and severe sepsis
without septic shock (1D); reassessment of antibiotic therapy with microbiology
and clinical data to narrow coverage, when appropriate (1C); a usual 7–10 days
of antibiotic therapy guided by clinical response (1D); source control with attention to the balance of risks and benefits of the chosen method (1C); administration
of either crystalloid or colloid fluid resuscitation (1B); fluid challenge to restore
mean circulating filling pressure (1C); reduction in rate of fluid administration with
rising filing pressures and no improvement in tissue perfusion (1D); vasopressor
preference for norepinephrine or dopamine to maintain an initial target of mean
arterial pressure >65 mm Hg (1C); dobutamine inotropic therapy when cardiac
output remains low despite fluid resuscitation and combined inotropic/vasopressor therapy (1C); stress-dose steroid therapy given only in septic shock after blood
From Cooper University Hospital, Camden, NJ (RPD);
Rhode Island Hospital, Providence, RI (MML); Hospital SaintJoseph, Paris, France (JMC); Birmingham University, Birmingham, UK (JB); SUNY at Stony Brook, Stony Brook, NY
(MMP); McMaster University, Hamilton, Ontario, Canada (RJ);
Friedrich-Schiller-University of Jena, Jena, Germany (KR);
University of Pittsburgh, Pittsburgh, PA (DCA); Hopital Henri
Mondor, Créteil, France (CBB); Guy’s and St Thomas’ Hospital Trust, London, UK (RB); Centre Hospitalier Universitaire
Vaudois, Lausanne, Switzerland (TC); French Agency for
Evaluation of Research and Higher Education, Paris, France
(JFD); Vivantes-Klinikum Neukoelin, Berlin, Germany (HG);
Consultants in Critical Care, Inc, Glenbrook, NV (MH); University of Minnesota, St. Paul, MN (JJM); St. Michael’s Hospital,
Toronto, Ontario, Canada (JM); Università di Torino, Torino,
296
pressure is identified to be poorly responsive to fluid and vasopressor therapy
(2C); recombinant activated protein C in patients with severe sepsis and clinical
assessment of high risk for death (2B except 2C for postoperative patients). In the
absence of tissue hypoperfusion, coronary artery disease, or acute hemorrhage,
target a hemoglobin of 7–9 g/dL (1B); a low tidal volume (1B) and limitation of
inspiratory plateau pressure strategy (1C) for acute lung injury (ALI)/acute respiratory distress syndrome (ARDS); application of at least a minimal amount of
positive end-expiratory pressure in acute lung injury (1C); head of bed elevation in
mechanically ventilated patients unless contraindicated (1B); avoiding routine use
of pulmonary artery catheters in ALI/ARDS (1A); to decrease days of mechanical
ventilation and ICU length of stay, a conservative fluid strategy for patients with
established ALI/ARDS who are not in shock (1C); protocols for weaning and
sedation/analgesia (1B); using either intermittent bolus sedation or continuous
infusion sedation with daily interruptions or lightening (1B); avoidance of neuromuscular blockers, if at all possible (1B); institution of glycemic control (1B),
targeting a blood glucose <150 mg/dL after initial stabilization (2C); equivalency
of continuous veno-veno hemofiltration or intermittent hemodialysis (2B); prophylaxis for deep vein thrombosis (1A); use of stress ulcer prophylaxis to prevent
upper gastrointestinal bleeding using H2 blockers (1A) or proton pump inhibitors
(1B); and consideration of limitation of support where appropriate (1D). Recommendations specific to pediatric severe sepsis include greater use of physical
examination therapeutic end points (2C); dopamine as the first drug of choice for
hypotension (2C); steroids only in children with suspected or proven adrenal
insufficiency (2C); and a recommendation against the use of recombinant activated protein C in children (1B).
Conclusions: There was strong agreement among a large cohort of international experts regarding many level 1 recommendations for the best current care
of patients with severe sepsis. Evidenced-based recommendations regarding the
acute management of sepsis and septic shock are the first step toward improved
outcomes for this important group of critically ill patients. (Crit Care Med
2008; 36:296–327)
KEY WORDS: sepsis; severe sepsis; septic shock; sepsis syndrome; infection;
Grades of Recommendation, Assessment, Development and Evaluation criteria;
GRADE; guidelines; evidence-based medicine; Surviving Sepsis Campaign; sepsis
bundles
Italy (MR); West Hertfordshire Health Trust, Hemel Hempstead, UK (GR); The Johns Hopkins University School of
Medicine, Baltimore, MD (JS); Massachusetts General Hospital, Boston, MA (BTT); Rhode Island Hospital, Providence, RI
(ST); Evanston Northwestern Healthcare, Evanston, IL (JSV);
The Methodist Hospital, Houston, TX (JLZ); Erasme University
Hospital, Brussels, Belgium (JLV).
Sponsoring organizations: American Association of Critical-Care Nurses,* American College of Chest Physicians,*
American College of Emergency Physicians,* Canadian Critical Care Society, European Society of Clinical Microbiology
and Infectious Diseases,* European Society of Intensive Care
Medicine,* European Respiratory Society,* International Sepsis Forum,* Japanese Association for Acute Medicine, Japanese Society of Intensive Care Medicine; Society of Critical
Care Medicine,* Society of Hospital Medicine,** Surgical
Infection Society,* World Federation of Societies of Intensive
and Critical Care Medicine.** Participation and endorsement
by the German Sepsis Society and the Latin American Sepsis
Institute. *Sponsor of 2004 guidelines. **Sponsors of 2008
guidelines who did not participate formally in revision process. Members of the 2008 SSC Guidelines Committee are
listed in Appendix I. Appendix J provides author disclosure
information.
Also published in Intensive Care Medicine (January
2008).
For information regarding this article, E-mail:
Dellinger-Phil@CooperHealth.edu
Copyright © 2007 by the Society of Critical Care
Medicine
DOI: 10.1097/01.CCM.0000298158.12101.41
Crit Care Med 2008 Vol. 36, No. 1
S
evere sepsis (acute organ dysfunction secondary to infection) and septic shock (severe
sepsis plus hypotension not reversed with fluid resuscitation) are major
healthcare problems, affecting millions of
individuals around the world each year,
killing one in four (and often more), and
increasing in incidence (1–5). Similar to
polytrauma, acute myocardial infarction,
or stroke, the speed and appropriateness
of therapy administered in the initial
hours after severe sepsis develops are
likely to influence outcome. In 2004, an
international group of experts in the diagnosis and management of infection and
sepsis, representing 11 organizations,
published the first internationally accepted guidelines that the bedside clinician could use to improve outcomes in
severe sepsis and septic shock (6, 7).
These guidelines represented phase II of
the Surviving Sepsis Campaign (SSC), an
international effort to increase awareness
and improve outcomes in severe sepsis.
Joined by additional organizations, the
group met again in 2006 and 2007 to
update the guidelines document using a
new evidence-based methodology system
for assessing quality of evidence and
strength of recommendations (8 –11).
These recommendations are intended
to provide guidance for the clinician caring for a patient with severe sepsis or
septic shock. Recommendations from
these guidelines cannot replace the clinician’s decision-making capability when
he or she is provided with a patient’s
unique set of clinical variables. Most of
these recommendations are appropriate
for the severe sepsis patient in both the
intensive care unit (ICU) and non-ICU
settings. In fact, the committee believes
that currently, the greatest outcome improvement can be made through education and process change for those caring
for severe sepsis patients in the non-ICU
setting and across the spectrum of acute
care. It should also be noted that resource limitations in some institutions
and countries may prevent physicians
from accomplishing particular recommendations.
METHODS
Sepsis is defined as infection plus systemic manifestations of infection (Table
1) (12). Severe sepsis is defined as sepsis
plus sepsis-induced organ dysfunction or
tissue hypoperfusion. The threshold for
Crit Care Med 2008 Vol. 36, No. 1
Table 1. Determination of the quality of evidence
● Underlying methodology
A. RCT
B. Downgraded RCT or upgraded observational studies
C. Well-done observational studies
D. Case series or expert opinion
● Factors that may decrease the strength of evidence
1. Poor quality of planning and implementation of available RCTs, suggesting high likelihood of
bias
2. Inconsistency of results (including problems with subgroup analyses)
3. Indirectness of evidence (differing population, intervention, control, outcomes, comparison)
4. Imprecision of results
5. High likelihood of reporting bias
● Main factors that may increase the strength of evidence
1. Large magnitude of effect (direct evidence, RR ⬎2 with no plausible confounders)
2. Very large magnitude of effect with RR ⬎5 and no threats to validity (by two levels)
3. Dose-response gradient
RCT, randomized controlled trial; RR, relative risk.
Table 2. Factors determining strong vs. weak recommendation
What Should Be Considered
Quality of evidence
Relative importance of the
outcomes
Baseline risks of outcomes
Magnitude of relative risk,
including benefits, harms, and
burden
Absolute magnitude of the effect
Precision of the estimates of the
effects
Costs
Recommended Process
The lower the quality of evidence, the less likely a strong
recommendation
If values and preferences vary widely, a strong
recommendation becomes less likely
The higher the risk, the greater the magnitude of benefit
Larger relative risk reductions or larger increases in
relative risk of harm make a strong recommendation
more or less likely, respectively
The larger the absolute benefits and harms, the greater or
lesser likelihood, respectively, of a strong
recommendation
The greater the precision, the more likely a strong
recommendation
The higher the cost of treatment, the less likely a strong
recommendation
this dysfunction has varied somewhat from
one severe sepsis research study to another.
An example of typical thresholds identification of severe sepsis is shown in Table 2
(13). Sepsis-induced hypotension is defined
as a systolic blood pressure (SBP) ⬍90 mm
Hg or mean arterial pressure ⬍70 mm Hg
or a SBP decrease ⬎40 mm Hg or ⬍2 SD
below normal for age in the absence of
other causes of hypotension. Septic shock
is defined as sepsis-induced hypotension
persisting despite adequate fluid resuscitation. Sepsis-induced tissue hypoperfusion
is defined as either septic shock, an elevated
lactate, or oliguria.
The current clinical practice guidelines
build on the first and second editions from
2001 (discussed subsequently) and 2004 (6,
7, 14). The 2001 publication incorporated a
MEDLINE search for clinical trials in the
preceding 10 yrs, supplemented by a manual search of other relevant journals (14).
The 2004 publication incorporated the evidence available through the end of 2003.
The current publication is based on an up-
dated search into 2007 (see following methods and rules).
The 2001 guidelines were coordinated
by the International Sepsis Forum; the
2004 guidelines were funded by unrestricted educational grants from industry
and administered through the Society of
Critical Care Medicine (SCCM), the European Society of Intensive Care Medicine (ESICM), and the International Sepsis Forum. Two of the SSC administering
organizations receive unrestricted industry funding to support SSC activities (ESICM and SCCM), but none of this funding
was used to support the 2006/2007 committee meetings.
It is important to distinguish between
the process of guidelines revision and the
SSC. The SSC is partially funded by unrestricted educational industry grants,
including those from Edwards LifeSciences, Eli Lilly and Company, and
Philips Medical Systems. SSC also received funding from the Coalition for
Critical Care Excellence of the Society of
297
Critical Care Medicine. The great majority of industry funding has come from Eli
Lilly and Company.
Current industry funding for the SSC
is directed to the performance improvement initiative. No industry funding was
used in the guidelines revision process.
For both the 2004 and the 2006/2007
efforts, there were no members of the
committee from industry, no industry
input into guidelines development, and
no industry presence at any of the
meetings. Industry awareness or comment on the recommendations was not
allowed. No member of the guideline
committee received any honoraria for
any role in the 2004 or 2006/2007
guidelines process. The committee considered the issue of recusement of individual committee members during deliberation and decision making in areas
where committee members had either
financial or academic competing interests; however, consensus as to threshold for exclusion could not be reached.
Alternatively, the committee agreed to
ensure full disclosure and transparency
of all committee members’ potential
conflicts at time of publication. (See
disclosures at the end of this document.)
The guidelines process included a
modified Delphi method, a consensus
conference, several subsequent meetings
of subgroups and key individuals, teleconferences and electronic-based discussions among subgroups and members of
the entire committee, and two follow-up
nominal group meetings in 2007.
Subgroups were formed, each charged
with updating recommendations in specific areas, including corticosteroids,
blood products, activated protein C, renal
replacement therapy, antibiotics, source
control, and glucose control. Each subgroup was responsible for updating the
evidence (into 2007, with major additional elements of information incorporated into the evolving manuscript
throughout 2006 and 2007). A separate
search was performed for each clearly defined question. The committee chair
worked with subgroup heads to identify
pertinent search terms that always included, at a minimum, sepsis, severe sepsis, septic shock, and sepsis syndrome
crossed against the general topic area of
the subgroup as well as pertinent key
words of the specific question posed. All
questions of the previous guidelines publications were searched, as were pertinent
new questions generated by general top298
ic-related search or recent trials. Quality
of evidence was judged by predefined
Grades of Recommendation, Assessment,
Development and Evaluation (GRADE)
criteria (discussed subsequently). Significant education of committee members
on the GRADE approach was performed
via e-mail before the first committee
meeting and at the first meeting. Rules
were distributed concerning assessing
the body of evidence, and GRADE experts
were available for questions throughout
the process. Subgroups agreed electronically on draft proposals that were presented to committee meetings for general
discussion. In January 2006, the entire
group met during the 35th SCCM Critical
Care Congress in San Francisco, California. The results of that discussion were
incorporated into the next version of recommendations and again discussed using
electronic mail. Recommendations were
finalized during nominal group meetings
(composed of a subset of the committee
members) at the 2007 SCCM (Orlando,
FL) and 2007 International Symposium
on Intensive Care and Emergency Medicine (Brussels) meetings with recirculation of deliberations and decisions to the
entire group for comment or approval. At
the discretion of the chair and following
adequate discussion, competing proposals for wording of recommendations or
assigning strength of evidence were resolved by formal voting. On occasions,
voting was performed to give the committee a sense of distribution of opinions
to facilitate additional discussion. The
manuscript was edited for style and form
by the writing committee with final approval by section leads for their respective group assignment and then by the
entire committee.
The development of guidelines and
grading of recommendations for the 2004
guideline development process were
based on a system proposed by Sackett
(15) in 1989, during one of the first
American College of Chest Physicians
(ACCP) conferences on the use of antithrombotic therapies. The revised guidelines recommendations are based on the
GRADE system, a structured system for
rating quality of evidence and grading
strength of recommendation in clinical
practice (8 –11). The SSC Steering Committee and individual authors collaborated with GRADE representatives to apply the GRADE system to the SSC
guidelines revision process. The members of GRADE group were directly involved, either in person or via e-mail, in
all discussions and deliberations among
the guidelines committee members as to
grading decisions. Subsequently, the SSC
authors used written material prepared
by the GRADE group and conferred with
GRADE group members who were available at the first committee meeting and
subsequent nominal group meetings.
GRADE representatives were also used as
a resource throughout subgroup deliberation.
The GRADE system is based on a sequential assessment of the quality of evidence, followed by assessment of the balance between benefits vs. risks, burden,
and cost and, based on the preceding, development and grading of a management
recommendations (9 –11). Keeping the rating of quality of evidence and strength of
recommendation explicitly separate constitutes a crucial and defining feature of the
GRADE approach. This system classifies
quality of evidence as high (grade A), moderate (grade B), low (grade C), or very low
(grade D). Randomized trials begin as highquality evidence but may be downgraded
due to limitations in implementation, inconsistency or imprecision of the results,
indirectness of the evidence, and possible
reporting bias (Table 1). Examples of indirectness of the evidence include population
studied, interventions used, outcomes measured, and how these relate to the question
of interest. Observational (nonrandomized)
studies begin as low-quality evidence, but
the quality level may be upgraded on the
basis of large magnitude of effect. An example of this is the quality of evidence for early
administration of antibiotics.
The GRADE system classifies recommendations as strong (grade 1) or weak
(grade 2). The grade of strong or weak is
considered of greater clinical importance
than a difference in letter level of quality
of evidence. The committee assessed
whether the desirable effects of adherence will outweigh the undesirable effects, and the strength of a recommendation reflects the group’s degree of
confidence in that assessment. A strong
recommendation in favor of an intervention reflects that the desirable effects of
adherence to a recommendation (beneficial health outcomes, less burden on staff
and patients, and cost savings) will
clearly outweigh the undesirable effects
(harms, more burden, and greater costs).
A weak recommendation in favor of an
intervention indicates that the desirable
effects of adherence to a recommendation
probably will outweigh the undesirable
effects, but the panel is not confident
Crit Care Med 2008 Vol. 36, No. 1
about these tradeoffs— either because
some of the evidence is low quality (and
thus there remains uncertainty regarding
the benefits and risks) or the benefits and
downsides are closely balanced. While the
degree of confidence is a continuum and
there is no precise threshold between a
strong and a weak recommendation, the
presence of important concerns about
one or more of the preceding factors
makes a weak recommendation more
likely. A strong recommendation is
worded as “we recommend” and a weak
recommendation as “we suggest.”
The implications of calling a recommendation strong are that most wellinformed patients would accept that intervention and that most clinicians should use
it in most situations. There may be circumstances in which a strong recommendation
cannot or should not be followed for an
individual patient because of that patient’s
preferences or clinical characteristics that
make the recommendation less applicable.
Being a strong recommendation does not
automatically imply standard of care. For
example, the strong recommendation for
administering antibiotics within 1 hr of the
diagnosis of severe sepsis, although desirable, is not currently standard of care as
verified by current practice (M Levy, personal communication, from first 8,000 patients entered internationally into the SSC
performance improvement database). The
implication of a weak recommendation is
that although a majority of well-informed
patients would accept it (but a substantial
proportion would not), clinicians should
consider its use according to particular circumstance.
Differences of opinion among committee members about interpretation of evidence, wording of proposals, or strength of
recommendations were resolved using a
specifically developed set of rules. We will
describe this process in detail in a separate
publication. In summary, the main approach for converting diverse opinions into
a recommendation was as follows: 1) to
give a recommendation a direction (for or
against the given action), a majority of
votes were to be in favor of that direction,
with ⱕ20% preferring the opposite direction (there was a neutral vote allowed as
well); 2) to call a given recommendation
strong rather than weak, ⱖ70% “strong”
votes were required; 3) if ⬍70% of votes
indicated “strong” preference, the recommendation was assigned a weak category of
strength. We used a combination of modified Delphi process and nominal (expert)
group techniques to ensure both depth and
Crit Care Med 2008 Vol. 36, No. 1
Table 3. Initial resuscitation and infection issues
Strength of recommendation and quality of evidence have been assessed using the GRADE criteria,
presented in parentheses after each guideline
● Indicates a strong recommendation, or “we recommend”
䡩 Indicates a weak recommendation, or “we suggest”
Initial resuscitation (first 6 hrs)
● Begin resuscitation immediately in patients with hypotension or elevated serum lactate ⬎4
mmol/L; do not delay pending ICU admission (1C)
● Resuscitation goals (1C)
CVP 8–12 mm Hga
Mean arterial pressure ⱖ 65 mm Hg
Urine output ⱖ0.5 mL䡠kg⫺1䡠hr⫺1
Central venous (superior vena cava) oxygen saturation ⱖ70% or mixed venous ⱖ65%
䡩 If venous oxygen saturation target is not achieved (2C)
Consider further fluid
Transfuse packed red blood cells if required to hematocrit of ⱖ30% and/or
Start dobutamine infusion, maximum 20 ␮g䡠kg⫺1䡠min⫺1
Diagnosis
● Obtain appropriate cultures before starting antibiotics provided this does not significantly
delay antimicrobial administration (1C)
Obtain two or more BCs
One or more BCs should be percutaneous
One BC from each vascular access device in place ⬎48 hrs
Culture other sites as clinically indicated
● Perform imaging studies promptly to confirm and sample any source of infection, if safe to do so (1C)
Antibiotic therapy
● Begin intravenous antibiotics as early as possible and always within the first hour of
recognizing severe sepsis (1D) and septic shock (1B)
● Broad-spectrum: one or more agents active against likely bacterial/fungal pathogens and with
good penetration into presumed source (1B)
● Reassess antimicrobial regimen daily to optimize efficacy, prevent resistance, avoid toxicity,
and minimize costs (1C)
䡩 Consider combination therapy in Pseudomonas infections (2D)
䡩 Consider combination empiric therapy in neutropenic patients (2D)
䡩 Combination therapy ⱕ3–5 days and de-escalation following susceptibilities (2D)
● Duration of therapy typically limited to 7–10 days; longer if response is slow or there are
undrainable foci of infection or immunologic deficiencies (1D)
● Stop antimicrobial therapy if cause is found to be noninfectious (1D)
Source identification and control
● A specific anatomic site of infection should be established as rapidly as possible (1C) and
within first 6 hrs of presentation (1D)
● Formally evaluate patient for a focus of infection amenable to source control measures (e.g.
abscess drainage, tissue debridement) (1C)
● Implement source control measures as soon as possible following successful initial
resuscitation (1C) (exception: infected pancreatic necrosis, where surgical intervention is best
delayed) (2B)
● Choose source control measure with maximum efficacy and minimal physiologic upset (1D)
● Remove intravascular access devices if potentially infected (1C)
GRADE, Grades of Recommendation, Assessment, Development and Evaluation; ICU, intensive
care unit; CVP, central venous pressure; BC, blood culture.
a
A higher target CVP of 12–15 mm Hg is recommended in the presence of mechanical ventilation
or preexisting decreased ventricular compliance.
breadth of review. The entire review group
(together with their parent organizations
as required) participated in the larger, iterative, modified Delphi process. The smaller
working group meetings, which took place
in person, functioned as the nominal
groups. If a clear consensus could not be
obtained by polling within the nominal
group meetings, the larger group was specifically asked to use the polling process.
This was only required for corticosteroids
and glycemic control. The larger group had
the opportunity to review all outputs. In
this way the entire review combined in-
tense focused discussion (nominal group)
with broader review and monitoring using
the Delphi process.
Note: Refer to Tables 3–5 for condensed adult recommendations.
I. MANAGEMENT OF SEVERE
SEPSIS
A. Initial Resuscitation
1. We recommend the protocolized resuscitation of a patient with sepsis299
Table 4. Hemodynamic support and adjunctive therapy
Strength of recommendation and quality of evidence have been assessed using the GRADE criteria,
presented in parentheses after each guideline.
● Indicates a strong recommendation, or “we recommend”
䡩 Indicates a weak recommendation, or “we suggest”
Fluid therapy
● Fluid-resuscitate using crystalloids or colloids (1B)
● Target a CVP of ⱖ8 mm Hg (ⱖ12 mm Hg if mechanically ventilated) (1C)
● Use a fluid challenge technique while associated with a hemodynamic improvement (1D)
● Give fluid challenges of 1000 mL of crystalloids or 300–500 mL of colloids over 30 mins. More
rapid and larger volumes may be required in sepsis-induced tissue hypoperfusion (1D)
● Rate of fluid administration should be reduced if cardiac filling pressures increase without
concurrent hemodynamic improvement (1D)
Vasopressors
● Maintain MAP ⱖ65 mm Hg (1C)
● Norepinephrine and dopamine centrally administered are the initial vasopressors of choice (1C)
䡩 Epinephrine, phenylephrine, or vasopressin should not be administered as the initial
vasopressor in septic shock (2C). Vasopressin 0.03 units/min may be subsequently added to
norepinephrine with anticipation of an effect equivalent to norepinephrine alone
䡩 Use epinephrine as the first alternative agent in septic shock when blood pressure is poorly
responsive to norepinephrine or dopamine (2B).
● Do not use low-dose dopamine for renal protection (1A)
● In patients requiring vasopressors, insert an arterial catheter as soon as practical (1D)
Inotropic therapy
● Use dobutamine in patients with myocardial dysfunction as supported by elevated cardiac
filling pressures and low cardiac output (1C)
● Do not increase cardiac index to predetermined supranormal levels (1B)
Steroids
䡩 Consider intravenous hydrocortisone for adult septic shock when hypotension responds poorly
to adequate fluid resuscitation and vasopressors (2C)
䡩 ACTH stimulation test is not recommended to identify the subset of adults with septic shock
who should receive hydrocortisone (2B)
䡩 Hydrocortisone is preferred to dexamethasone (2B)
䡩 Fludrocortisone (50 ␮g orally once a day) may be included if an alternative to hydrocortisone
is being used that lacks significant mineralocorticoid activity. Fludrocortisone if optional if
hydrocortisone is used (2C)
䡩 Steroid therapy may be weaned once vasopressors are no longer required (2D)
● Hydrocortisone dose should be ⱕ300 mg/day (1A)
● Do not use corticosteroids to treat sepsis in the absence of shock unless the patient’s
endocrine or corticosteroid history warrants it (1D)
Recombinant human activated protein C
䡩 Consider rhAPC in adult patients with sepsis-induced organ dysfunction with clinical
assessment of high risk of death (typically APACHE II ⱖ25 or multiple organ failure) if there
are no contraindications (2B, 2C for postoperative patients).
● Adult patients with severe sepsis and low risk of death (typically, APACHE II ⬍20 or one
organ failure) should not receive rhAPC (1A)
GRADE, Grades of Recommendation, Assessment, Development and Evaluation; CVP, central
venous pressure; MAP, mean arterial pressure; ACTH, adrenocorticotropic hormone; rhAPC, recombinant human activated protein C; APACHE, Acute Physiology and Chronic Health Evaluation.
induced shock, defined as tissue hypoperfusion (hypotension persisting
after initial fluid challenge or blood
lactate concentration ⱖ4 mmol/L).
This protocol should be initiated as
soon as hypoperfusion is recognized
and should not be delayed pending
ICU admission. During the first 6 hrs
of resuscitation, the goals of initial
resuscitation of sepsis-induced hypoperfusion should include all of the following as one part of a treatment protocol:
Central venous pressure 8 –12 mm
Hg
Mean arterial pressure (MAP) ⱖ65
mm Hg
300
Urine output ⱖ0.5 mL·kg⫺1·hr ⫺1
Central venous (superior vena
cava) or mixed venous oxygen saturation ⱖ70% or ⱖ65%, respectively (grade 1C)
Rationale. Early goal-directed resuscitation has been shown to improve survival for emergency department patients
presenting with septic shock in a randomized, controlled, single-center study
(16). Resuscitation directed toward the
previously mentioned goals for the initial
6-hr period of the resuscitation was able
to reduce 28-day mortality rate. The consensus panel judged use of central venous
and mixed venous oxygen saturation tar-
gets to be equivalent. Either intermittent
or continuous measurements of oxygen
saturation were judged to be acceptable.
Although blood lactate concentration
may lack precision as a measure of tissue
metabolic status, elevated levels in sepsis
support aggressive resuscitation. In mechanically ventilated patients or patients
with known preexisting decreased ventricular compliance, a higher target central venous pressure of 12–15 mm Hg is
recommended to account for the impediment to filling (17). Similar consideration may be warranted in circumstances
of increased abdominal pressure or diastolic dysfunction (18). Elevated central
venous pressures may also be seen with
preexisting clinically significant pulmonary artery hypertension. Although the
cause of tachycardia in septic patients
may be multifactorial, a decrease in elevated pulse rate with fluid resuscitation is
often a useful marker of improving intravascular filling. Recently published observational studies have demonstrated an
association between good clinical outcome in septic shock and MAP ⱖ65 mm
Hg as well as central venous oxygen saturation (ScvO2, measured in superior
vena cava, either intermittently or continuously) of ⱖ70% (19). Many recent
studies support the value of early protocolized resuscitation in severe sepsis and
sepsis-induced tissue hypoperfusion (20 –
25). Studies of patients with shock indicate that mixed venous oxygen saturation
(SV̄O2) runs 5–7% lower than central venous oxygen saturation (ScvO2) (26) and
that an early goal-directed resuscitation
protocol can be established in a nonresearch general practice venue (27).
There are recognized limitations to
ventricular filling pressure estimates as
surrogates for fluid resuscitation (28, 29).
However, measurement of central venous
pressure is currently the most readily obtainable target for fluid resuscitation.
There may be advantages to targeting
fluid resuscitation to flow and perhaps to
volumetric indices (and even to microcirculation changes) (30 –33). Technologies
currently exist that allow measurement
of flow at the bedside (34, 35). Future
goals should be making these technologies more accessible during the critical
early resuscitation period and research to
validate utility. These technologies are
already available for early ICU resuscitation.
2. We suggest that during the first 6 hrs
of resuscitation of severe sepsis or sepCrit Care Med 2008 Vol. 36, No. 1
Table 5. Other supportive therapy of severe sepsis
Strength of recommendation and quality of evidence have been assessed using the GRADE criteria, presented in parentheses after each guideline
● Indicates a strong recommendation, or “we recommend”
䡩 Indicates a weak recommendation, or “we suggest”
Blood product administration
● Give red blood cells when hemoglobin decreases to ⬍7.0 g/dL (⬍70 g/L) to target a hemoglobin of 7.0–9.0 g/dL in adults (1B). A higher
hemoglobin level may be required in special circumstances (e.g., myocardial ischaemia, severe hypoxemia, acute hemorrhage, cyanotic heart
disease, or lactic acidosis)
䡩 Do not use erythropoietin to treat sepsis-related anemia. Erythropoietin may be used for other accepted reasons (1B)
䡩 Do not use fresh frozen plasma to correct laboratory clotting abnormalities unless there is bleeding or planned invasive procedures (2D)
● Do not use antithrombin therapy (1B)
䡩 Administer platelets when (2D)
Counts are ⬍5000/mm3 (5 ⫻ 109/L) regardless of bleeding
Counts are 5000–30,000/mm3 (5–30 ⫻ 109/L) and there is significant bleeding risk
Higher platelet counts (ⱖ50,000/mm3 [50 ⫻ 109/L]) are required for surgery or invasive procedures
Mechanical ventilation of sepsis-induced ALI/ARDS
● Target a tidal volume of 6 mL/kg (predicted) body weight in patients with ALI/ARDS (1B)
● Target an initial upper limit plateau pressure ⱕ30 cm H2O. Consider chest wall compliance when assessing plateau pressure (1C)
● Allow PaCO2 to increase above normal, if needed, to minimize plateau pressures and tidal volumes (1C)
● Set PEEP to avoid extensive lung collapse at end-expiration (1C)
䡩 Consider using the prone position for ARDS patients requiring potentially injurious levels of FIO2 or plateau pressure, provided they are not put
at risk from positional changes (2C)
● Maintain mechanically ventilated patients in a semirecumbent position (head of the bed raised to 45°) unless contraindicated (1B), between 30°
and 45° (2C)
䡩 Noninvasive ventilation may be considered in the minority of ALI/ARDS patients with mild to moderate hypoxemic respiratory failure. The
patients need to be hemodynamically stable, comfortable, easily arousable, able to protect/clear their airway, and expected to recover rapidly (2B)
● Use a weaning protocol and an SBT regularly to evaluate the potential for discontinuing mechanical ventilation (1A)
● SBT options include a low level of pressure support with continuous positive airway pressure 5 cm H2O or a T piece
● Before the SBT, patients should
be arousable
be hemodynamically stable without vasopressors
have no new potentially serious conditions
have low ventilatory and end-expiratory pressure requirement
require FIO2 levels that can be safely delivered with a face mask or nasal cannula
● Do not use a pulmonary artery catheter for the routine monitoring of patients with ALI/ARDS (1A)
● Use a conservative fluid strategy for patients with established ALI who do not have evidence of tissue hypoperfusion (1C)
Sedation, analgesia, and neuromuscular blockade in sepsis
● Use sedation protocols with a sedation goal for critically ill mechanically ventilated patients (1B)
● Use either intermittent bolus sedation or continuous infusion sedation to predetermined end points (sedation scales), with daily
interruption/lightening to produce awakening. Re-titrate if necessary (1B)
● Avoid neuromuscular blockers where possible. Monitor depth of block with train-of-four when using continuous infusions (1B)
Glucose control
● Use intravenous insulin to control hyperglycemia in patients with severe sepsis following stabilization in the ICU (1B)
● Aim to keep blood glucose ⬍150 mg/dL (8.3 mmol/L) using a validated protocol for insulin dose adjustment (2C)
● Provide a glucose calorie source and monitor blood glucose values every 1–2 hrs (4 hrs when stable) in patients receiving intravenous insulin (1C)
● Interpret with caution low glucose levels obtained with point of care testing, as these techniques may overestimate arterial blood or plasma
glucose values (1B)
Renal replacement
䡩 Intermittent hemodialysis and CVVH are considered equivalent (2B)
䡩 CVVH offers easier management in hemodynamically unstable patients (2D)
Bicarbonate therapy
● Do not use bicarbonate therapy for the purpose of improving hemodynamics or reducing vasopressor requirements when treating hypoperfusioninduced lactic acidemia with pH ⱖ7.15 (1B)
Deep vein thrombosis prophylaxis
● Use either low-dose UFH or LMWH, unless contraindicated (1A)
● Use a mechanical prophylactic device, such as compression stockings or an intermittent compression device, when heparin is contraindicated (1A)
䡩 Use a combination of pharmacologic and mechanical therapy for patients who are at very high risk for deep vein thrombosis (2C)
䡩 In patients at very high risk, LMWH should be used rather than UFH (2C)
Stress ulcer prophylaxis
● Provide stress ulcer prophylaxis using H2 blocker (1A) or proton pump inhibitor (1B). Benefits of prevention of upper gastrointestinal bleed must
be weighed against the potential for development of ventilator-acquired pneumonia
Consideration for limitation of support
● Discuss advance care planning with patients and families. Describe likely outcomes and set realistic expectations (1D)
GRADE, Grades of Recommendation, Assessment, Development and Evaluation; ALI, acute lung injury; ARDS, acute respiratory distress syndrome;
PEEP, positive end-expiratory pressure; SBT, spontaneous breathing trial; ICU, intensive care unit; CVVH, continuous veno-venous hemofiltration; UFH,
unfractionated heparin; LMWH, low-molecular weight heparin.
tic shock, if ScvO2 or SV̄O2 of 70% or
65%, respectively, is not achieved with
fluid resuscitation to the central venous pressure target, then transfusion
of packed red blood cells to achieve a
Crit Care Med 2008 Vol. 36, No. 1
hematocrit of ⱖ30% and/or administration of a dobutamine infusion (up
to a maximum of 20 ␮g·kg⫺1·min⫺1)
be used to achieve this goal (grade
2C).
Rationale. The protocol used in the
study cited previously targeted an increase
in ScvO2 to ⱖ70% (16). This was achieved
by sequential institution of initial fluid resuscitation, packed red blood cells, and
301
then dobutamine. This protocol was associated with an improvement in survival.
Based on bedside clinical assessment and
personal preference, a clinician may deem
either blood transfusion (if hematocrit is
⬍30%) or dobutamine the best initial
choice to increase oxygen delivery and
thereby elevate ScvO2, when fluid resuscitation is believed to be already adequate.
The design of the aforementioned trial did
not allow assessment of the relative contribution of these two components (i.e., increasing oxygen content or increasing cardiac output) of the protocol on
achievement of improved outcome.
B. Diagnosis
1. We recommend obtaining appropriate cultures before antimicrobial
therapy is initiated if such cultures
do not cause significant delay in antibiotic administration. To optimize
identification of causative organisms,
we recommend at least two blood
cultures be obtained before antibiotics with at least one drawn percutaneously and one drawn through each
vascular access device, unless the device was recently (⬍48 hrs) inserted.
Cultures of other sites (preferably
quantitative where appropriate), such
as urine, cerebrospinal fluid, wounds,
respiratory secretions, or other body
fluids that may be the source of infection should also be obtained before antibiotic therapy if not associated with significant delay in
antibiotic administration (grade 1C).
Rationale. Although sampling should
not delay timely administration of antibiotics in patients with severe sepsis (e.g.,
lumbar puncture in suspected meningitis), obtaining appropriate cultures before administration of antibiotics is essential to confirm infection and the
responsible pathogens and to allow deescalation of antibiotic therapy after receipt of the susceptibility profile. Samples
can be refrigerated or frozen if processing
cannot be performed immediately. Immediate transport to a microbiological
lab is necessary. Because rapid sterilization of blood cultures can occur within a
few hours after the first antibiotic dose,
obtaining those cultures before starting
therapy is essential if the causative organism is to be identified. Two or more blood
cultures are recommended (36). In patients with indwelling catheters (for ⬎48
hrs), at least one blood culture should be
drawn through each lumen of each vas302
cular access device. Obtaining blood
cultures peripherally and through a
vascular access device is an important
strategy. If the same organism is recovered from both cultures, the likelihood
that the organism is causing the severe
sepsis is enhanced. In addition, if the
culture drawn through the vascular access device is positive much earlier than
the peripheral blood culture (i.e., ⬎2 hrs
earlier), the data support the concept that
the vascular access device is the source of
the infection (37). Quantitative cultures
of catheter and peripheral blood are also
useful for determining whether the catheter is the source of infection. Volume of
blood drawn with the culture tube should
be ⱖ10 mL (38). Quantitative (or semiquantitative) cultures of respiratory tract
secretions are recommended for the diagnosis of ventilator-associated pneumonia (39). Gram-negative stain can be useful, in particular for respiratory tract
specimens, to help decide the microorganisms to be targeted. The potential
role of biomarkers for diagnosis of infection in patients presenting with severe sepsis remains undefined. The procalcitonin level, although often useful,
is problematic in patients with an acute
inflammatory pattern from other
causes (e.g., postoperative, shock) (40).
In the near future, rapid diagnostic
methods (polymerase chain reaction,
micro-arrays) might prove extremely
helpful for a quicker identification of
pathogens and major antimicrobial resistance determinants (41).
2. We recommend that imaging studies
be performed promptly in attempts
to confirm a potential source of infection. Sampling of potential
sources of infection should occur as
they are identified; however, some
patients may be too unstable to warrant certain invasive procedures or
transport outside of the ICU. Bedside
studies, such as ultrasound, are useful in these circumstances (grade
1C).
Rationale. Diagnostic studies may
identify a source of infection that requires removal of a foreign body or drainage to maximize the likelihood of a satisfactory response to therapy. However,
even in the most organized and wellstaffed healthcare facilities, transport of
patients can be dangerous, as can placing
patients in outside-unit imaging devices
that are difficult to access and monitor.
Balancing risk and benefit is therefore
mandatory in those settings.
C. Antibiotic Therapy
1. We recommend that intravenous antibiotic therapy be started as early as
possible and within the first hour of
recognition of septic shock (1B) and
severe sepsis without septic shock
(1D). Appropriate cultures should be
obtained before initiating antibiotic
therapy but should not prevent
prompt administration of antimicrobial therapy (grade 1D).
Rationale. Establishing vascular access and initiating aggressive fluid resuscitation are the first priority when managing patients with severe sepsis or septic
shock. However, prompt infusion of antimicrobial agents should also be a priority
and may require additional vascular access ports (42, 43). In the presence of
septic shock, each hour delay in achieving administration of effective antibiotics
is associated with a measurable increase
in mortality (42). If antimicrobial agents
cannot be mixed and delivered promptly
from the pharmacy, establishing a supply
of premixed antibiotics for such urgent
situations is an appropriate strategy for
ensuring prompt administration. In
choosing the antimicrobial regimen, clinicians should be aware that some antimicrobial agents have the advantage of
bolus administration, while others require a lengthy infusion. Thus, if vascular
access is limited and many different
agents must be infused, bolus drugs may
offer an advantage.
2a. We recommend that initial empirical
anti-infective therapy include one or
more drugs that have activity against
all likely pathogens (bacterial and/or
fungal) and that penetrate in adequate concentrations into the presumed source of sepsis (grade 1B).
Rationale. The choice of empirical antibiotics depends on complex issues related to the patient’s history, including
drug intolerances, underlying disease,
the clinical syndrome, and susceptibility
patterns of pathogens in the community,
in the hospital, and that previously have
been documented to colonize or infect
the patient. There is an especially wide
range of potential pathogens for neutropenic patients.
Recently used antibiotics should generally be avoided. When choosing empirical
therapy, clinicians should be cognizant of
Crit Care Med 2008 Vol. 36, No. 1
the virulence and growing prevalence of
oxacillin (methicillin)-resistant Staphylococcus aureus (ORSA or MRSA) in some
communities and healthcare settings (especially in the United States). If the prevalence is significant, and in consideration of
the virulence of this organism, empirical
therapy adequate for this pathogen would
be warranted. Clinicians should also consider whether candidemia is a likely pathogen when choosing initial therapy. When
deemed warranted, the selection of empirical antifungal therapy (e.g., fluconazole,
amphotericin B, or echinocandin) will be
tailored to the local pattern of the most
prevalent Candida species and any prior
administration of azoles drugs (44). Risk
factors for candidemia should also be considered when choosing initial therapy.
Because patients with severe sepsis or
septic shock have little margin for error
in the choice of therapy, the initial selection of antimicrobial therapy should be
broad enough to cover all likely pathogens. There is ample evidence that failure
to initiate appropriate therapy (i.e., therapy with activity against the pathogen
that is subsequently identified as the
causative agent) correlates with increased
morbidity and mortality (45– 48).
Patients with severe sepsis or septic
shock warrant broad-spectrum therapy
until the causative organism and its antibiotic susceptibilities are defined. Restriction of antibiotics as a strategy to
reduce the development of antimicrobial
resistance or to reduce cost is not an
appropriate initial strategy in this patient
population.
All patients should receive a full loading dose of each antimicrobial. However,
patients with sepsis or septic shock often
have abnormal renal or hepatic function
and may have abnormal volumes of distribution due to aggressive fluid resuscitation. Drug serum concentration monitoring can be useful in an ICU setting for
those drugs that can be measured
promptly. An experienced physician or
clinical pharmacist should be consulted
to ensure that serum concentrations are
attained that maximize efficacy and minimize toxicity (49 –52).
2b. We recommend that the antimicrobial regimen be reassessed daily to
optimize activity, to prevent the development of resistance, to reduce
toxicity, and to reduce costs (grade
1C).
Rationale. Although restriction of antibiotics as a strategy to reduce the develCrit Care Med 2008 Vol. 36, No. 1
opment of antimicrobial resistance or to
reduce cost is not an appropriate initial
strategy in this patient population, once
the causative pathogen has been identified, it may become apparent that none of
the empirical drugs offers optimal therapy; that is, there may be another drug
proven to produce superior clinical outcome that should therefore replace empirical agents.
Narrowing the spectrum of antibiotic
coverage and reducing the duration of
antibiotic therapy will reduce the likelihood
that the patient will develop superinfection
with pathogenic or resistant organisms,
such as Candida species, Clostridium difficile, or vancomycin-resistant Enterococcus
faecium. However, the desire to minimize
superinfections and other complications
should not take precedence over the need
to give the patient an adequate course of
therapy to cure the infection that caused
the severe sepsis or septic shock.
2c. We suggest combination therapy for
patients with known or suspected
Pseudomonas infections as a cause of
severe sepsis (grade 2D).
2d. We suggest combination empirical
therapy for neutropenic patients with
severe sepsis (grade 2D).
2e. When used empirically in patients
with severe sepsis, we suggest that
combination therapy should not be
administered for ⬎3–5 days. Deescalation to the most appropriate
single therapy should be performed
as soon as the susceptibility profile is
known (grade 2D).
Rationale. Although no study or metaanalysis has convincingly demonstrated
that combination therapy produces a superior clinical outcome for individual pathogens in a particular patient group, combination therapies do produce in vitro
synergy against pathogens in some models
(although such synergy is difficult to define
and predict). In some clinical scenarios,
such as the two preceding, combination
therapies are biologically plausible and are
likely clinically useful even if evidence has
not demonstrated improved clinical outcome (53–56). Combination therapy for
suspected known Pseudomonas pending
sensitivities increases the likelihood that at
least one drug is effective against that
strain and positively affects outcome (57).
3. We recommend that the duration of
therapy typically be 7–10 days; longer
courses may be appropriate in patients who have a slow clinical re-
sponse, undrainable foci of infection,
or immunologic deficiencies, including neutropenia (grade 1D).
4. We recommend that if the presenting
clinical syndrome is determined to be
due to a noninfectious cause, antimicrobial therapy be stopped promptly
to minimize the likelihood that the
patient will become infected with an
antibiotic-resistant pathogen or will
develop a drug-related adverse effect
(grade 1D).
Rationale. Clinicians should be cognizant that blood cultures will be negative
in ⬎50% of cases of severe sepsis or septic shock, yet many of these cases are very
likely caused by bacteria or fungi. Thus,
the decisions to continue, narrow, or stop
antimicrobial therapy must be made on
the basis of clinician judgment and clinical information.
D. Source Control
1a. We recommend that a specific anatomical diagnosis of infection requiring consideration for emergent
source control (e.g., necrotizing fasciitis, diffuse peritonitis, cholangitis,
intestinal infarction) be sought and
diagnosed or excluded as rapidly as
possible (grade 1C) and within the
first 6 hrs following presentation
(grade 1D).
1b. We further recommend that all patients presenting with severe sepsis
be evaluated for the presence of a
focus on infection amenable to
source control measures, specifically
the drainage of an abscess or local
focus on infection, the debridement
of infected necrotic tissue, the removal of a potentially infected device,
or the definitive control of a source
of ongoing microbial contamination
(grade 1C). (Appendix A provides examples of potential sites needing
source control.)
2. We suggest that when infected
peripancreatic necrosis is identified as
a potential source of infection, definitive intervention is best delayed until
adequate demarcation of viable and
nonviable tissues has occurred (grade
2B).
3. We recommend that when source control is required, the effective intervention
associated with the least physiologic insult be employed (e.g., percutaneous
rather than surgical drainage of an
abscess (grade 1D).
303
4. We recommend that when intravascular access devices are a possible
source of severe sepsis or septic
shock, they be promptly removed after other vascular access has been
established (grade 1C).
Rationale. The principals of source
control in the management of sepsis include a rapid diagnosis of the specific site
of infection and identification of a focus
on infection amenable to source control
measures (specifically the drainage of an
abscess, debridement of infected necrotic
tissue, removal of a potentially infected
device, and definitive control of a source
of ongoing microbial contamination)
(58). Foci of infection readily amenable to
source control measures include an intra-abdominal abscess or gastrointestinal
perforation, cholangitis or pyelonephritis, intestinal ischemia or necrotizing soft
tissue infection, and other deep space infection, such as an empyema or septic
arthritis. Such infectious foci should be
controlled as soon as possible following
successful initial resuscitation (59), accomplishing the source control objective
with the least physiologic upset possible
(e.g., percutaneous rather than surgical
drainage of an abscess [60], endoscopic
rather than surgical drainage of biliary
tree), and removing intravascular access
devices that are potentially the source of
severe sepsis or septic shock promptly
after establishing other vascular access
(61, 62). A randomized, controlled trial
comparing early vs. delayed surgical intervention for peripancreatic necrosis
showed better outcomes with a delayed
approach (63). However, areas of uncertainty exist, such as definitive documentation of infection and appropriate
length of delay. The selection of optimal
source control methods must weigh
benefits and risks of the specific intervention as well as risks of transfer (64).
Source control interventions may cause
further complications, such as bleeding, fistulas, or inadvertent organ injury. Surgical intervention should be
considered when lesser interventional
approaches are inadequate or when diagnostic uncertainty persists despite radiologic evaluation. Specific clinical situations require consideration of
available choices, patient’s preferences,
and clinician’s expertise.
E. Fluid Therapy
1. We recommend fluid resuscitation
with either natural/artificial colloids
304
or crystalloids. There is no evidencebased support for one type of fluid
over another (grade 1B).
Rationale. The SAFE study indicated
that albumin administration was safe and
equally as effective as crystalloid (65). There
was an insignificant decrease in mortality
rates with the use of colloid in a subset
analysis of septic patients (p ⫽ .09). Previous meta-analyses of small studies of ICU
patients had demonstrated no difference
between crystalloid and colloid fluid resuscitation (66 – 68). Although administration
of hydroxyethyl starch may increase the
risk of acute renal failure in patients with
sepsis, variable findings preclude definitive
recommendations (69, 70). As the volume
of distribution is much larger for crystalloids than for colloids, resuscitation with
crystalloids requires more fluid to achieve
the same end points and results in more
edema. Crystalloids are less expensive.
2. We recommend that fluid resuscitation initially target a central venous
pressure of ⱖ8 mm Hg (12 mm Hg in
mechanically ventilated patients).
Further fluid therapy is often required (grade 1C).
3a. We recommend that a fluid challenge
technique be applied wherein fluid
administration is continued as long
as the hemodynamic improvement
(e.g., arterial pressure, heart rate,
urine output) continues (grade 1D).
3b. We recommend that fluid challenge
in patients with suspected hypovolemia be started with ⱖ1000 mL of
crystalloids or 300 –500 mL of colloids over 30 mins. More rapid administration and greater amounts of
fluid may be needed in patients with
sepsis-induced tissue hypoperfusion
(see Initial Resuscitation recommendations) (grade 1D).
3c. We recommend that the rate of fluid
administration be reduced substantially when cardiac filling pressures
(central venous pressure or pulmonary artery balloon-occluded pressure) increase without concurrent
hemodynamic improvement (grade
1D).
Rationale. Fluid challenge must be
clearly separated from simple fluid administration; it is a technique in which
large amounts of fluids are administered
over a limited period of time under close
monitoring to evaluate the patient’s response and avoid the development of pulmonary edema. The degree of intravascular
volume deficit in patients with severe sepsis
varies. With venodilation and ongoing capillary leak, most patients require continuing aggressive fluid resuscitation during
the first 24 hrs of management. Input is
typically much greater than output, and
input/output ratio is of no utility to judge
fluid resuscitation needs during this time
period.
F. Vasopressors
1. We recommend that mean arterial
pressure (MAP) be maintained ⱖ65
mm Hg (grade 1C).
Rationale. Vasopressor therapy is required to sustain life and maintain perfusion in the face of life-threatening hypotension, even when hypovolemia has not
yet been resolved. Below a certain mean
arterial pressure, autoregulation in various vascular beds can be lost, and perfusion can become linearly dependent on
pressure. Thus, some patients may require vasopressor therapy to achieve a
minimal perfusion pressure and maintain
adequate flow (71, 72). The titration of
norepinephrine to as low as MAP 65 mm
Hg has been shown to preserve tissue
perfusion (72). In addition, preexisting
comorbidities should be considered as to
most appropriate MAP target. For example, a MAP of 65 mm Hg might be too low
in a patient with severe uncontrolled hypertension, and in a young previously
normotensive, a lower MAP might be
adequate. Supplementing end points,
such as blood pressure, with assessment of regional and global perfusion,
such as blood lactate concentrations
and urine output, is important. Adequate fluid resuscitation is a fundamental aspect of the hemodynamic management of patients with septic shock and
should ideally be achieved before vasopressors and inotropes are used, but
using vasopressors early as an emergency measure in patients with severe
shock is frequently necessary. When
that occurs, great effort should be directed to weaning vasopressors with
continuing fluid resuscitation.
2. We recommend either norepinephrine or dopamine as the first choice
vasopressor agent to correct hypotension in septic shock (administered
through a central catheter as soon as
one is available) (grade 1C).
3a. We suggest that epinephrine, phenylephrine, or vasopressin should not be
administered as the initial vasopresCrit Care Med 2008 Vol. 36, No. 1
sor in septic shock (grade 2C). Vasopressin 0.03 units/min may be added
to norepinephrine subsequently with
anticipation of an effect equivalent to
that of norepinephrine alone.
3b. We suggest that epinephrine be the
first chosen alternative agent in septic shock that is poorly responsive to
norepinephrine or dopamine (grade
2B).
Rationale. There is no high-quality
primary evidence to recommend one catecholamine over another. Much literature exists that contrasts the physiologic
effects of choice of vasopressor and combined inotrope/vasopressors in septic
shock (73– 85). Human and animal studies suggest some advantages of norepinephrine and dopamine over epinephrine
(the latter with the potential for tachycardia as well as disadvantageous effects
on splanchnic circulation and hyperlactemia) and phenylephrine (decrease in
stroke volume). There is, however, no
clinical evidence that epinephrine results
in worse outcomes, and it should be the
first chosen alternative to dopamine or
norepinephrine. Phenylephrine is the adrenergic agent least likely to produce
tachycardia but as a pure vasopressor
would be expected to decrease stroke volume. Dopamine increases mean arterial
pressure and cardiac output, primarily
due to an increase in stroke volume and
heart rate. Norepinephrine increases
mean arterial pressure due to its vasoconstrictive effects, with little change in
heart rate and less increase in stroke volume compared with dopamine. Either
may be used as a first-line agent to correct
hypotension in sepsis. Norepinephrine is
more potent than dopamine and may be
more effective at reversing hypotension in
patients with septic shock. Dopamine may
be particularly useful in patients with compromised systolic function but causes more
tachycardia and may be more arrhythmogenic (86). It may also influence the endocrine response via the hypothalamicpituitary axis and have immunosuppressive
effects.
Vasopressin levels in septic shock have
been reported to be lower than anticipated for a shock state (87). Low doses of
vasopressin may be effective in raising
blood pressure in patients refractory to
other vasopressors and may have other
potential physiologic benefits (88 –93).
Terlipressin has similar effects but is long
lasting (94). Studies show that vasopressin concentrations are elevated in early
Crit Care Med 2008 Vol. 36, No. 1
septic shock, but with continued shock
the concentration decreases to normal
range in the majority of patients between
24 and 48 hrs (95). This has been called
relative vasopressin deficiency because in
the presence of hypotension, vasopressin
would be expected to be elevated. The
significance of this finding is unknown.
The recent VASST trial, a randomized,
controlled trial comparing norepinephrine alone to norepinephrine plus vasopressin at 0.03 units/min, showed no difference in outcome in the intent to treat
population. An a priori defined subgroup
analysis showed that the survival of patients receiving ⬍15 ␮g/min norepinephrine at the time of randomization was
better with vasopressin. However, the
pretrial rationale for this stratification
was based on exploring potential benefit
in the ⱖ15 ␮g norepinephrine requirement population. Higher doses of vasopressin have been associated with cardiac, digital, and splanchnic ischemia and
should be reserved for situations where
alternative vasopressors have failed (96).
Cardiac output measurement to allow
maintenance of a normal or elevated flow
is desirable when these pure vasopressors
are instituted.
5. We recommend that low-dose dopamine not be used for renal protection
(grade 1A).
Rationale. A large randomized trial
and meta-analysis comparing low-dose
dopamine to placebo found no difference
in either primary outcomes (peak serum
creatinine, need for renal replacement,
urine output, time to recovery of normal
renal function) or secondary outcomes
(survival to either ICU or hospital discharge, ICU stay, hospital stay, arrhythmias) (97, 98). Thus, the available data do
not support administration of low doses
of dopamine solely to maintain renal
function.
6. We recommend that all patients requiring vasopressors have an arterial
catheter placed as soon as practical if
resources are available (grade 1D).
Rationale. In shock states, estimation
of blood pressure using a cuff is commonly inaccurate; use of an arterial cannula provides a more appropriate and reproducible measurement of arterial
pressure. These catheters also allow continuous analysis so that decisions regarding therapy can be based on immediate
and reproducible blood pressure information.
G. Inotropic Therapy
1. We recommend that a dobutamine infusion be administered in the presence
of myocardial dysfunction as suggested by elevated cardiac filling pressures and low cardiac output (grade
1C).
2. We recommend against the use of a
strategy to increase cardiac index to
predetermined supranormal levels
(grade 1B).
Rationale. Dobutamine is the firstchoice inotrope for patients with measured or suspected low cardiac output in
the presence of adequate left ventricular
filling pressure (or clinical assessment of
adequate fluid resuscitation) and adequate mean arterial pressure. Septic patients who remain hypotensive after fluid
resuscitation may have low, normal, or
increased cardiac outputs. Therefore,
treatment with a combined inotrope/
vasopressor, such as norepinephrine or
dopamine, is recommended if cardiac
output is not measured. When the capability exists for monitoring cardiac output in addition to blood pressure, a vasopressor, such as norepinephrine, may be
used separately to target specific levels of
mean arterial pressure and cardiac output. Two large prospective clinical trials
that included critically ill ICU patients
who had severe sepsis failed to demonstrate benefit from increasing oxygen delivery to supranormal targets by use of
dobutamine (99, 100). These studies did
not specifically target patients with severe sepsis and did not target the first 6
hrs of resuscitation. The first 6 hrs of
resuscitation of sepsis-induced hypoperfusion need to be treated separately from
the later stages of severe sepsis (see Initial Resuscitation recommendations).
H. Corticosteroids
1. We suggest that intravenous hydrocortisone be given only to adult septic
shock patients after it has been confirmed that their blood pressure is
poorly responsive to fluid resuscitation and vasopressor therapy (grade
2C).
Rationale. One French multicenter,
randomized controlled trial (RCT) of patients in vasopressor-unresponsive septic
shock (hypotension despite fluid resuscitation and vasopressors) showed a significant
shock reversal and reduction of mortality
rate in patients with relative adrenal insuf305
ficiency (defined as postadrenocorticotropic hormone [ACTH] cortisol increase
ⱕ9 ␮g/dL) (101). Two additional smaller
RCTs also showed significant effects on
shock reversal with steroid therapy (102,
103). However, a recent large, European
multicenter trial (CORTICUS), which has
been presented in abstract form but not yet
published, failed to show a mortality benefit
with steroid therapy of septic shock (104).
CORTICUS did show a faster resolution of
septic shock in patients who received steroids. The use of the ACTH test (responders
and nonresponders) did not predict the
faster resolution of shock. Importantly, unlike the French trial, which only enrolled
shock patients with blood pressure unresponsive to vasopressor therapy, the CORTICUS study included patients with septic
shock, regardless of how the blood pressure
responded to vasopressors. Although corticosteroids do appear to promote shock reversal, the lack of a clear improvement in
mortality— coupled with known side effects of steroids, such as increased risk of
infection and myopathy— generally tempered enthusiasm for their broad use. Thus,
there was broad agreement that the recommendation should be downgraded from the
previous guidelines (Appendix B). There
was considerable discussion and consideration by the committee on the option of
encouraging use in those patients whose
blood pressure was unresponsive to fluids
and vasopressors, while strongly discouraging use in subjects whose shock responded
well to fluids and pressors. However, this
more complex set of recommendations was
rejected in favor of the preceding single
recommendation (Appendix B).
2. We suggest that the ACTH stimulation
test not be used to identify the subset
of adults with septic shock who should
receive hydrocortisone (grade 2B).
Rationale. Although one study suggested those who did not respond to
ACTH with a brisk surge in cortisol (failure to achieve or ⬎9 ␮g/dL increase in
cortisol 30 – 60 mins after ACTH administration) were more likely to benefit
from steroids than those who did respond, the overall trial population appeared to benefit regardless of ACTH result, and the observation of a potential
interaction between steroid use and
ACTH test was not statistically significant
(101). Furthermore, there was no evidence of this distinction between responders and nonresponders in a recent
multicenter trial (104). Commonly used
cortisol immunoassays measure total
306
cortisol (protein-bound and free) while
free cortisol is the pertinent measurement. The relationship between free and
total cortisol varies with serum protein
concentration. When compared with a
reference method (mass spectrometry),
cortisol immunoassays may over- or underestimate the actual cortisol level, affecting the assignment of patients to responders or nonresponders (105).
Although the clinical significance is not
clear, it is now recognized that etomidate, when used for induction for intubation, will suppress the hypothalamicpituitary-adrenal axis (106).
3. We suggest that patients with septic
shock should not receive dexamethasone if hydrocortisone is available
(grade 2B).
Rationale. Although often proposed
for use until an ACTH stimulation test
can be administered, we no longer suggest an ACTH test in this clinical situation (see the preceding point 3). Furthermore, dexamethasone can lead to
immediate and prolonged suppression of
the hypothalamic-pituitary-adrenal axis
after administration (107).
4. We suggest the daily addition of oral
fludrocortisone (50 ␮g) if hydrocortisone is not available and the steroid
that is substituted has no significant
mineralocorticoid activity. Fludrocortisone is considered optional if hydrocortisone is used (grade 2C).
Rationale. One study added 50 ␮g of
fludrocortisone orally (101). Since hydrocortisone has intrinsic mineralocorticoid
activity, there is controversy as to
whether fludrocortisone should be added.
5. We suggest that clinicians wean the
patient from steroid therapy when vasopressors are no longer required
(grade 2D).
Rationale. There has been no comparative study between a fixed-duration and
clinically guided regimen or between tapering and abrupt cessation of steroids.
Three RCTs used a fixed-duration protocol for treatment (101, 103, 104), and in
two RCTs, therapy was decreased after
shock resolution (102, 108). In four RCTs
steroids were tapered over several days
(102–104, 108), and in two RCTs (101,
109) steroids were withdrawn abruptly.
One crossover study showed hemodynamic and immunologic rebound effects
after abrupt cessation of corticosteroids
(110). It remains uncertain whether outcome is affected by tapering of steroids.
6. We recommend that doses of corticosteroids comparable to ⬎300 mg of
hydrocortisone daily not be used in
severe sepsis or septic shock for the
purpose of treating septic shock
(grade 1A).
Rationale. Two randomized prospective clinical trials and a meta-analyses
concluded that for therapy of severe sepsis or septic shock, high-dose corticosteroid therapy is ineffective or harmful
(111–113). Reasons to maintain higher
doses of corticosteroid for medical conditions other than septic shock may exist.
7. We recommend that corticosteroids
not be administered for the treatment
of sepsis in the absence of shock.
There is, however, no contraindication
to continuing maintenance steroid
therapy or to using stress-dose steroids if the patient’s endocrine or corticosteroid administration history
warrants (grade 1D).
Rationale. No studies exist that specifically target severe sepsis in the absence of
shock and offer support for use of stress
doses of steroids in this patient population.
Steroids may be indicated in the presence
of a history of steroid therapy or adrenal
dysfunction. A recent preliminary study of
stress-dose level steroids in communityacquired pneumonia is encouraging but
needs confirmation (114).
I. Recombinant Human
Activated Protein C (rhAPC)
1. We suggest that adult patients with sepsis-induced organ dysfunction associated with a clinical assessment of high
risk of death, most of whom will have
Acute Physiology and Chronic Health
Evaluation (APACHE) II ⱖ25 or multiple organ failure, receive rhAPC if there
are no contraindications (grade 2B except for patients within 30 days of surgery, for whom it is grade 2C). Relative
contraindications should also be considered in decision making.
2. We recommend that adult patients
with severe sepsis and low risk of
death, most of whom will have
APACHE II ⬍20 or one organ failure,
do not receive rhAPC (grade 1A).
Rationale. The evidence concerning
use of rhAPC in adults is primarily based on
two RCTs: PROWESS (1,690 adult patients,
stopped early for efficacy) (115) and ADCrit Care Med 2008 Vol. 36, No. 1
DRESS (stopped early for futility) (116).
Additional safety information comes from
an open-label observational study, ENHANCE (117). The ENHANCE trial also
suggested that early administration of
rhAPC was associated with better outcomes.
PROWESS involved 1,690 patients and
documented 6.1% in absolute total mortality reduction with a relative risk reduction of 19.4%, 95% confidence interval
6.6 –30.5%, and number needed to treat
16 (115). Controversy associated with the
results focused on a number of subgroup
analyses. Subgroup analyses have the potential to mislead due to the absence of
an intent to treat, sampling bias, and
selection error (118). The analyses suggested increasing absolute and relative
risk reduction with greater risk of death
using both higher APACHE II scores and
greater number of organ failures (119).
This led to drug approval for patients
with high risk of death (such as APACHE
II ⱖ25) and more than one organ failure
in Europe.
The ADDRESS trial involved 2,613 patients judged to have a low risk of death
at the time of enrollment. The 28-day
mortality rate from all causes was 17% on
placebo vs. 18.5% on APC, relative risk
1.08, 95% confidence interval 0.92–1.28
(116). Again, debate focused on subgroup
analyses; analyses were restricted to
small subgroups of patients with
APACHE II score ⬎25 or more than one
organ failure, which failed to show benefit. However, these patient groups also
had a lower mortality than in PROWESS.
Relative risk reduction of death was
numerically lower in the subgroup of patients with recent surgery (n ⫽ 502) in
the PROWESS trial (30.7% placebo vs.
27.8% APC) (119) when compared with
the overall study population (30.8% placebo vs. 24.7% APC) (115). In the ADDRESS trial, patients with recent surgery
and single organ dysfunction who received APC had significantly higher 28day mortality rates (20.7% vs. 14.1%, p ⫽
.03, n ⫽ 635) (116).
Serious adverse events did not differ in
the studies (115–117) with the exception
of serious bleeding, which occurred more
often in the patients treated with APC:
2% vs. 3.5% (PROWESS; p ⫽ .06) (115);
2.2% vs. 3.9% (ADDRESS; p ⬍ .01) (116);
6.5% (ENHANCE, open label) (117). The
pediatric trial and implications are discussed in the pediatric consideration section of this article. (Appendix C provides
absolute contraindications to use of
Crit Care Med 2008 Vol. 36, No. 1
rhAPC and prescribing information for
relative contraindications.)
Intracranial hemorrhage (ICH) occurred in the PROWESS trial in 0.1%
(placebo) and 0.2% (APC) (not significant) (106); in the ADDRESS trial 0.4%
(placebo) vs. 0.5 % (APC) (not significant)
(116); and in ENHANCE 1.5% (108). Registry studies of rhAPC report higher
bleeding rates than randomized controlled trials, suggesting that the risk of
bleeding in actual practice may be greater
than reported in PROWESS and ADDRESS (120, 121).
The two RCTs in adult patients were
methodologically strong and precise and
provided direct evidence regarding death
rates. The conclusions are limited, however, by inconsistency that is not adequately resolved by subgroup analyses
(thus the designation of moderate-quality
evidence). Results, however, consistently
fail to show benefit for the subgroup of
patients at lower risk of death and consistently show increases in serious bleeding. The RCT in pediatric severe sepsis
failed to show benefit and has no important limitations. Thus, for low-risk and
pediatric patients, we rate the evidence as
high quality.
For adult use there is probable mortality reduction in patients with clinical
assessment of high risk of death, most of
whom will have APACHE II ⱖ25 or multiple organ failure. There is likely no benefit in patients with low risk of death,
most of whom will have APACHE II ⬍20
or single organ dysfunction. The effects
in patients with more than one organ
failure but APACHE II ⬍25 are unclear,
and in that circumstance one may use
clinical assessment of the risk of death
and number of organ failures to support
decision. There is a certain increased
risk of bleeding with administration of
rhAPC, which may be higher in surgical
patients and in the context of invasive
procedures. Decision on utilization depends on assessing likelihood of mortality reduction vs. increases in bleeding and cost. (Appendix D provides the
nominal committee vote on recommendation for rhAPC.) A European regulatory mandated RCT of rhAPC vs. placebo in patients with septic shock is
now ongoing (122).
J. Blood Product Administration
1. Once tissue hypoperfusion has resolved
and in the absence of extenuating circumstances, such as myocardial isch-
emia, severe hypoxemia, acute hemorrhage, cyanotic heart disease, or lactic
acidosis (see recommendations for initial resuscitation), we recommend that
red blood cell transfusion occur when
hemoglobin decreases to ⬍7.0 g/dL
(⬍70 g/L) to target a hemoglobin of
7.0 –9.0 g/dL (70 –90 g/L) in adults
(grade 1B).
Rationale. Although the optimum hemoglobin for patients with severe sepsis
has not been specifically investigated, the
Transfusion Requirements in Critical
Care trial suggested that a hemoglobin of
7–9 g/dL (70 –90 g/L) when compared
with 10 –12 g/dL (100 –200 g/L) was not
associated with increased mortality in
adults (123). Red blood cell transfusion in
septic patients increases oxygen delivery
but does not usually increase oxygen consumption (124 –126). This transfusion
threshold of 7 g/dL (70 g/L) contrasts
with the early goal-directed resuscitation
protocol that uses a target hematocrit of
30% in patients with low ScvO2 (measured in superior vena cava) during the
first 6 hrs of resuscitation of septic shock.
2. We recommend that erythropoietin
not be used as a specific treatment of
anemia associated with severe sepsis
but may be used when septic patients
have other accepted reasons for administration of erythropoietin, such as
renal failure-induced compromise of
red blood cell production (grade 1B).
Rationale. No specific information regarding erythropoietin use in septic patients is available, but clinical trials in
critically ill patients show some decrease
in red cell transfusion requirement with
no effect on clinical outcome (127, 128).
The effect of erythropoietin in severe sepsis and septic shock would not be expected to be more beneficial than in other
critical conditions. Patients with severe
sepsis and septic shock may have coexisting conditions that do warrant use of
erythropoietin.
3. We suggest that fresh frozen plasma
not be used to correct laboratory clotting abnormalities in the absence of
bleeding or planned invasive procedures (grade 2D).
Rationale. Although clinical studies
have not assessed the impact of transfusion of fresh frozen plasma on outcomes
in critically ill patients, professional organizations have recommended fresh frozen plasma for coagulopathy when there
is a documented deficiency of coagulation
307
factors (increased prothrombin time, international normalized ratio, or partial
thromboplastin time) and the presence of
active bleeding or before surgical or invasive procedures (129 –131). In addition,
transfusion of fresh frozen plasma in
nonbleeding patients with mild abnormalities of prothrombin time usually fails
to correct the prothrombin time (132).
There are no studies to suggest that correction of more severe coagulation abnormalities benefits patients who are not
bleeding.
4. We recommend against antithrombin
administration for the treatment of severe sepsis and septic shock (grade 1B).
Rationale. A phase III clinical trial of
high-dose antithrombin did not demonstrate any beneficial effect on 28-day allcause mortality in adults with severe sepsis
and septic shock. High-dose antithrombin
was associated with an increased risk of
bleeding when administered with heparin
(133). Although a post hoc subgroup analysis of patients with severe sepsis and high
risk of death showed better survival in patients receiving antithrombin, antithrombin cannot be recommended until further
clinical trials are performed (134).
5. In patients with severe sepsis, we suggest that platelets be administered
when counts are ⬍5000/mm3 (5 ⫻
109/L) regardless of apparent bleeding.
Platelet transfusion may be considered
when counts are 5000 –30,000/mm3
(5–30 ⫻ 109/L) and there is a significant risk of bleeding. Higher platelet
counts (ⱖ50,000/mm3 [50 ⫻ 109/L])
are typically required for surgery or
invasive procedures (grade 2D).
Rationale. Guidelines for transfusion
of platelets are derived from consensus
opinion and experience in patients undergoing chemotherapy. Recommendations
take into account the etiology of thrombocytopenia, platelet dysfunction, risk of
bleeding, and presence of concomitant
disorders (129, 131).
II. SUPPORTIVE THERAPY OF
SEVERE SEPSIS
A. Mechanical Ventilation of
Sepsis-Induced Acute Lung
Injury (ALI)/Acute Respiratory
Distress Syndrome (ARDS)
1. We recommend that clinicians target
a tidal volume of 6 mL/kg (predicted)
body weight in patients with ALI/
ARDS (grade 1B).
308
2. We recommend that plateau pressures
be measured in patients with ALI/
ARDS and that the initial upper limit
goal for plateau pressures in a passively inflated patient be ⱕ30 cm H2O.
Chest wall compliance should be considered in the assessment of plateau
pressure (grade 1C).
Rationale. Over the past 10 yrs, several multicenter randomized trials have
been performed to evaluate the effects of
limiting inspiratory pressure through
moderation of tidal volume (135–139).
These studies showed differing results
that may have been caused by differences
between airway pressures in the treatment and control groups (135, 140). The
largest trial of a volume- and pressurelimited strategy showed a 9% decrease of
all-cause mortality in patients with ALI or
ARDS ventilated with tidal volumes of 6
mL/kg of predicted body weight (PBW),
as opposed to 12 mL/kg, and aiming for a
plateau pressure ⱕ30 cm H2O (135). The
use of lung-protective strategies for patients with ALI is supported by clinical
trials and has been widely accepted, but
the precise choice of tidal volume for an
individual patient with ALI may require
adjustment for such factors as the plateau
pressure achieved, the level of positive
end-expiratory pressure chosen, the compliance of the thoracoabdominal compartment, and the vigor of the patient’s
breathing effort. Some clinicians believe
it may be safe to ventilate with tidal volumes ⬎6 mL/kg PBW as long as the plateau pressure can be maintained ⱕ30 cm
H2O (141, 142). The validity of this ceiling value will depend on breathing effort,
as those who are actively inspiring generate higher transalveolar pressures for a
given plateau pressure than those who
are passively inflated. Conversely, patients with very stiff chest walls may require plateau pressures ⬎30 cm H2O to
meet vital clinical objectives. One retrospective study suggested that tidal volumes should be lowered even with plateau pressures ⱕ30 cm H2O (143). An
additional observational study suggested
that knowledge of the plateau pressures
was associated with lower plateau pressures; however, in that trial plateau pressure was not independently associated
with mortality rates across a wide range
of plateau pressures that bracketed 30 cm
H2O (144). The largest clinical trial employing a lung-protective strategy coupled limited pressure with limited tidal
volumes to demonstrate a mortality benefit (135).
High tidal volumes that are coupled
with high plateau pressures should be
avoided in ALI/ARDS. Clinicians should use
as a starting point the objective of reducing
tidal volume over 1–2 hrs from its initial
value toward the goal of a “low” tidal volume (⬇6 mL/kg PBW) achieved in conjunction with an end-inspiratory plateau
pressure ⱕ30 cm H2O. If plateau pressure
remains ⬎30 after reduction of tidal volume to 6 mL/kg PBW, tidal volume should
be reduced further to as low as 4 mL/kg
PBW. (Appendix E provides ARDSNet ventilator management and formulas to calculate predicted body weight.)
No single mode of ventilation (pressure control, volume control, airway
pressure release ventilation, high-frequency ventilation) has been consistently
shown advantageous when compared
with any other that respects the same
principles of lung protection.
3. We recommend that hypercapnia (allowing PaCO2 to increase above its premorbid baseline, so-called permissive
hypercapnia) be allowed in patients
with ALI/ARDS if needed to minimize
plateau pressures and tidal volumes
(grade 1C).
Rationale. An acutely elevated PaCO2
may have physiologic consequences that
include vasodilation as well as an increased heart rate, blood pressure, and
cardiac output. Allowing modest hypercapnia in conjunction with limiting tidal
volume and minute ventilation has been
demonstrated to be safe in small, nonrandomized series (145, 146). Patients
treated in larger trials that have the goal
of limiting tidal volumes and airway pressures have demonstrated improved outcomes, but permissive hypercapnia was
not a primary treatment goal in these studies (135). The use of hypercapnia is limited
in patients with preexisting metabolic acidosis and is contraindicated in patients
with increased intracranial pressure. Sodium bicarbonate or tromethamine
(THAM) infusion may be considered in selected patients to facilitate use of permissive hypercarbia (147, 148).
4. We recommend that positive endexpiratory pressure (PEEP) be set so
as to avoid extensive lung collapse at
end-expiration (grade 1C).
Rationale. Raising PEEP in ALI/ARDS
keeps lung units open to participate in
gas exchange. This will increase PaO2
Crit Care Med 2008 Vol. 36, No. 1
when PEEP is applied through either an
endotracheal tube or a face mask (149 –
151). In animal experiments, avoidance of
end-expiratory alveolar collapse helps
minimize ventilator-induced lung injury
when relatively high plateau pressures
are in use. One large multicenter trial of
the protocol-driven use of higher PEEP
in conjunction with low tidal volumes did
not show benefit or harm when compared
with lower PEEP levels (152). Neither the
control nor experimental group in that
study, however, was clearly exposed to
hazardous plateau pressures. A recent
multicenter Spanish trial compared a
high PEEP, low-moderate tidal volume
approach to one that used conventional
tidal volumes and the least PEEP achieving adequate oxygenation. A marked survival advantage favored the former approach in high-acuity patients with ARDS
(153). Two options are recommended for
PEEP titration. One option is to titrate
PEEP (and tidal volume) according to
bedside measurements of thoracopulmonary compliance with the objective of obtaining the best compliance, reflecting a
favorable balance of lung recruitment
and overdistension (154). The second option is to titrate PEEP based on severity
of oxygenation deficit and guided by the
FIO2 required to maintain adequate oxygenation (135) (Appendix D). Whichever
the indicator— compliance or oxygenation—recruiting maneuvers are reasonable to employ in the process of PEEP
selection. Blood pressure and oxygenation should be monitored and recruitment discontinued if deterioration in
these variables is observed. A PEEP ⬎5
cm H20 is usually required to avoid lung
collapse (155).
5. We suggest prone positioning in ARDS
patients requiring potentially injurious
levels of FIO2 or plateau pressure who
are not at high risk for adverse consequences of positional changes in facilities that have experience with such
practices (grade 2C).
Rationale. Several small studies and
one larger study have shown that a majority of patients with ALI/ARDS respond
to the prone position with improved oxygenation (156 –159). One large multicenter trial of prone positioning for approximately 7 hrs/day did not show
improvement in mortality rates in patients
with ALI/ARDS; however, a post hoc analysis suggested improvement in those patients with the most severe hypoxemia by
PaO2/FIO2 ratio, in those exposed to high
Crit Care Med 2008 Vol. 36, No. 1
tidal volumes, and in those who improved
CO2 exchange as a result of proning (159).
A second large trial of prone positioning,
conducted for an average of approximately
8 hrs/day for 4 days in adults with hypoxemic respiratory failure of low-moderate
acuity, confirmed improvement in oxygenation but also failed to show a survival advantage (160). However, a randomized
study that extended the length of time for
proning each day to a mean of 17 hrs for a
mean of 10 days supported benefit of proning, with randomization to supine position
an independent risk factor for mortality by
multivariate analysis (161). Prone positioning may be associated with potentially lifethreatening complications, including accidental dislodgment of the endotracheal
tube and central venous catheters, but
these complications can usually be avoided
with proper precautions.
6a. Unless contraindicated, we recommend that mechanically ventilated
patients be maintained with the head
of the bed elevated to limit aspiration
risk and to prevent the development
of ventilator-associated pneumonia
(grade 1B).
6b. We suggest that the head of bed be
elevated approximately 30 – 45°
(grade 2C).
Rationale. The semirecumbent position has been demonstrated to decrease
the incidence of ventilator-associated
pneumonia (VAP) (162). Enteral feeding
increased the risk of developing VAP;
50% of the patients who were fed enterally in the supine position developed VAP
(163). However, the bed position was only
monitored once a day, and patients who
did not achieve the desired bed elevation
were not included in the analysis (163). A
recent study did not show a difference in
incidence of VAP between patients maintained in supine and semirecumbent positions (164). In this study, patients in the
semirecumbent position did not consistently achieve the desired head of the bed
elevation, and the head of bed elevation
in the supine group approached that of
the semirecumbent group by day 7 (164).
When necessary, patients may be laid flat
for procedures, hemodynamic measurements, and during episodes of hypotension. Patients should not be fed enterally
with the head of the bed at 0°.
7. We suggest that noninvasive mask
ventilation (NIV) only be considered in
that minority of ALI/ARDS patients
with mild-moderate hypoxemic respi-
ratory failure (responsive to relatively
low levels of pressure support and
PEEP) with stable hemodynamics who
can be made comfortable and are easily arousable; who are able to protect
the airway and spontaneously clear
the airway of secretions; and who are
anticipated to recover rapidly from the
precipitating insult. A low threshold
for airway intubation should be maintained (grade 2B).
Rationale. Obviating the need for airway intubation confers multiple advantages: better communication, lower incidence of infection, reduced requirements
for sedation. Two RCTs demonstrate improved outcome with the use of NIV when
it can be employed successfully (162,
165). Unfortunately, only a small percentage of patients with life-threatening hypoxemia can be managed in this way.
8. We recommend that a weaning protocol be in place and that mechanically
ventilated patients with severe sepsis
undergo spontaneous breathing trials
regularly to evaluate the ability to discontinue mechanical ventilation when
they satisfy the following criteria: a)
They are arousable; b) they are hemodynamically stable (without vasopressor agents); c) they have no new potentially serious conditions; d) they
have low ventilatory and end-expiratory pressure requirements; and e)
their F IO 2 requirements could be
safely delivered with a face mask or
nasal cannula. If the spontaneous
breathing trial is successful, consideration should be given for extubation
(Appendix E). Spontaneous breathing
trial options include a low level of
pressure support, continuous positive
airway pressure (⬇5 cm H2O), or a
T-piece (grade 1A).
Rationale. Recent studies demonstrate that daily spontaneous breathing
trials in appropriately selected patients
reduce the duration of mechanical ventilation (166 –169). Successful completion
of spontaneous breathing trials leads to a
high likelihood of successful discontinuation of mechanical ventilation.
9. We recommend against the routine
use of the pulmonary artery catheter
for patients with ALI/ARDS (grade
1A).
Rationale. While insertion of a pulmonary artery catheter may provide useful
information on a patient’s volume status
309
and cardiac function, potential benefits of
such information may be confounded by
differences in interpretation of results
(170 –172), lack of correlation of pulmonary artery occlusion pressures with clinical response (173), and absence of a
proven strategy to use catheter results to
improve patient outcomes (174). Two
multicenter randomized trials, one in patients with shock or acute lung injury
(175) and one in patients with acute lung
injury (176), failed to show benefit with
the routine use of pulmonary artery catheters in patients with acute lung injury.
In addition, other studies in different
types of critically ill patients have failed
to show definitive benefit with routine
use of the pulmonary artery catheter
(177–179). Well-selected patients remain
appropriate candidates for pulmonary artery catheter insertion when the answers
to important management decisions depend on information only obtainable
from direct measurements made within
the pulmonary artery.
10. To decrease days of mechanical ventilation and ICU length of stay we
recommend a conservative fluid
strategy for patients with established
acute lung injury who do not have
evidence of tissue hypoperfusion
(grade 1C).
Rationale. Mechanisms for the development of pulmonary edema in patients
with acute lung injury include increased
capillary permeability, increased hydrostatic pressure, and decreased oncotic
pressure (180, 181). Small prospective
studies in patients with critical illness
and acute lung injury have suggested that
less weight gain is associated with improved oxygenation (182) and fewer days
of mechanical ventilation (183, 184). Use
of a fluid-conservative strategy directed at
minimizing fluid infusion and weight
gain in patients with acute lung injury
based on either a central venous catheter
or a pulmonary artery catheter along
with clinical variables to guide treatment
strategies led to fewer days of mechanical
ventilation and reduced length of ICU
stay without altering the incidence of renal failure or mortality rates (185). Of
note, this strategy was only used in patients with established acute lung injury,
some of whom had shock present. Active
attempts to reduce fluid volume were
conducted only during periods free from
shock.
310
B. Sedation, Analgesia, and
Neuromuscular Blockade in
Sepsis
1. We recommend sedation protocols
with a sedation goal when sedation of
critically ill mechanically ventilated
patients with sepsis is required (grade
1B).
Rationale. A growing body of evidence
indicates that the use of protocols for
sedation of critically ill ventilated patients can reduce the duration of mechanical ventilation and ICU and hospital
length of stay (186 –188). A randomized,
controlled clinical trial found that protocol use reduced duration of mechanical
ventilation, lengths of stay, and tracheostomy rates (186).
A report describing the implementation of protocols, including sedation and
analgesia, using a short-cycle improvement methodology in the management of
critically ill patients demonstrated a decrease in the cost per patient-day and a
decrease of ICU length of stay (187). Furthermore, a prospective before-and-after
study on the implementation of a sedation protocol demonstrated enhanced
quality of sedation with reduced drug
costs. Although this protocol also may
have contributed to a longer duration of
mechanical ventilation, ICU discharge
was not delayed (188). Despite the lack of
evidence regarding the use of subjective
methods of evaluation of sedation in septic patients, the use of a sedation goal has
been shown to decrease the duration of
mechanical ventilation in critically ill patients (186). Several subjective sedation
scales have been described in the medical
literature. Currently, however, there is
not a clearly superior sedation evaluation
methodology against which these sedation scales can be evaluated (189). The
benefits of sedation protocols appear to
outweigh the risks.
2. We recommend intermittent bolus sedation or continuous infusion sedation to predetermined end points (e.g.,
sedation scales) with daily interruption/lightening of continuous infusion
sedation with awakening and retitration if necessary for sedation administration to septic mechanically ventilated patients (grade 1B).
Rationale. Although not specifically
studied in patients with sepsis, the administration of intermittent sedation,
daily interruption, and retitration or systemic titration to a predefined end point
have been demonstrated to decrease the
duration of mechanical ventilation (186,
189, 190). Patients receiving neuromuscular blocking agents (NMBAs) must be
individually assessed regarding discontinuation of sedative drugs because neuromuscular blocking drugs must also be
discontinued in that situation. The use of
intermittent vs. continuous methods for
the delivery of sedation in critically ill
patients has been examined. An observational study of mechanically ventilated
patients showed that patients receiving
continuous sedation had significantly
longer durations of mechanical ventilation and ICU and hospital length of stay
(191).
Similarly, a prospective, controlled
study in 128 mechanically ventilated
adults receiving continuous intravenous
sedation demonstrated that a daily interruption in the continuous sedative infusion until the patient was awake decreased the duration of mechanical
ventilation and ICU length of stay (192).
Although the patients did receive continuous sedative infusions in this study, the
daily interruption and awakening allowed
for titration of sedation, in effect making
the dosing intermittent. Systematic (protocolized) titration to a predefined end
point has also been shown to alter outcome (186). Additionally, a randomized
prospective blinded observational study
demonstrated that although myocardial
ischemia is common in critically ill ventilated patients, daily sedative interruption is not associated with an increased
occurrence of myocardial ischemia (193).
Thus, the benefits of daily interruption of
sedation appear to outweigh the risks.
These benefits include potentially shorter
duration of mechanical ventilation and
ICU stay, better assessment of neurologic
function, and reduced costs.
3. We recommend that NMBAs be
avoided if possible in the septic patient
due to the risk of prolonged neuromuscular blockade following discontinuation. If NMBAs must be maintained, either intermittent bolus as
required or continuous infusion with
monitoring the depth of blockade with
train-of-four monitoring should be
used (grade 1B).
Rationale. Although NMBAs are often
administered to critically ill patients,
their role in the ICU is not well defined.
No evidence exists that maintaining neuromuscular blockade in this patient population reduces mortality or major morCrit Care Med 2008 Vol. 36, No. 1
bidity. In addition, no studies have been
published that specifically address the use
of NMBAs in septic patients.
The most common indication for
NMBA use in the ICU is to facilitate mechanical ventilation (194). When appropriately used, NMBAs may improve chest
wall compliance, prevent respiratory dyssynchrony, and reduce peak airway pressures (195). Muscle paralysis may also
reduce oxygen consumption by decreasing the work of breathing and respiratory
muscle blood flow (196). However, a randomized, placebo-controlled clinical trial
in patients with severe sepsis demonstrated that oxygen delivery, oxygen consumption, and gastric intramucosal pH
were not improved during profound neuromuscular blockade (197).
An association between NMBA use and
myopathies and neuropathies has been
suggested by case studies and prospective
observational studies in the critical care
population (195, 198 –201). The mechanisms by which NMBAs produced or contribute to myopathies and neuropathies
in critically ill patients are presently unknown. There appears to be an added
association with the concurrent use of
NMBAs and steroids. Although no studies
exist specific to the septic patient population, it seems clinically prudent based
on existent knowledge that NMBAs not be
administered unless there is a clear indication for neuromuscular blockade that
cannot be safely achieved with appropriate sedation and analgesia (195).
Only one prospective, randomized
clinical trial has evaluated peripheral
nerve stimulation vs. standard clinical assessment in ICU patients. Rudis et al.
(202) randomized 77 critically ill patients
requiring neuromuscular blockade in the
ICU to receive dosing of vecuronium
based on train-of-four stimulation or
clinical assessment (control). The peripheral nerve stimulation group received less
drug and recovered neuromuscular function and spontaneous ventilation faster
than the control group. Nonrandomized
observational studies have suggested that
peripheral nerve monitoring reduces or
has no effect on clinical recovery from
NMBAs in the ICU (203, 204).
Benefits to neuromuscular monitoring, including faster recovery of neuromuscular function and shorter intubation times, appear to exist. A potential for
cost savings (reduced total dose of
NMBAs and shorter intubation times)
also may exist, although this has not been
studied formally.
Crit Care Med 2008 Vol. 36, No. 1
C. Glucose Control
1. We recommend that following initial
stabilization, patients with severe sepsis and hyperglycemia who are admitted to the ICU receive intravenous insulin therapy to reduce blood glucose
levels (grade 1B).
2. We suggest use of a validated protocol
for insulin dose adjustments and targeting glucose levels to the ⬍150
mg/dL range (grade 2C).
3. We recommend that all patients receiving intravenous insulin receive a
glucose calorie source and that
blood glucose values be monitored
every 1–2 hrs until glucose values
and insulin infusion rates are stable
and then every 4 hrs thereafter
(grade 1C).
4. We recommend that low glucose levels obtained with point-of-care testing
of capillary blood be interpreted with
caution, as such measurements may
overestimate arterial blood or plasma
glucose values (grade 1B).
Rationale. The consensus on glucose
control in severe sepsis was achieved at
the first committee meeting and subsequently approved by the entire committee. (Appendix G presents the committee
vote.) One large randomized singlecenter trial in a predominantly cardiac
surgical ICU demonstrated a reduction in
ICU mortality with intensive intravenous
insulin (Leuven protocol) targeting blood
glucose to 80 –110 mg/dL (for all patients, a relative 43% and absolute 3.4%
mortality reduction; for those with ⬎5
days in the ICU, a 48% relative and 9.6%
absolute mortality reduction) (205). A reduction in organ dysfunction and ICU
length of stay (LOS) (from a median of 15
to 12 days) was also observed in the subset with ICU LOS ⬎5 days. A second randomized trial of intensive insulin therapy
using the Leuven protocol enrolled medical ICU patients with an anticipated ICU
LOS of ⬎3 days in three medical ICUs
(206). Overall mortality was not reduced,
but ICU and hospital LOS were reduced
associated with earlier weaning from mechanical ventilation and less acute kidney
injury. In patients with a medical ICU
LOS ⬎3 days, hospital mortality was reduced with intensive insulin therapy
(43% vs. 52.5%; p ⫽ .009). However, investigators were unsuccessful in predicting ICU LOS, and 433 patients (36%) had
an ICU LOS of ⬍3 days. Furthermore, use
of the Leuven protocol in the medical ICU
resulted in a nearly three-fold higher rate
of hypoglycemia than in the original experience (18% vs. 6.2% of patients) (205,
206).
One large before-and-after observational trial showed a 29% relative and
6.1% absolute reduction in mortality and
a 10.8% reduction in median ICU LOS
(207). In a subgroup of 53 patients with
septic shock, there was an absolute mortality reduction of 27% and a relative
reduction of 45% (p ⫽ .02). Two additional observational studies reported an
association of mean glucose levels with
reductions in mortality, polyneuropathy,
acute renal failure, nosocomial bacteremia, and number of transfusions, and
they suggested that a glucose threshold
for improved mortality lies somewhere
between 145 and 180 mg/dL (208, 209).
However, a large observational study
(n ⫽ 7,049) suggested that both a lower
mean glucose and less variation of blood
glucose may be important (210). A metaanalysis of 35 trials on insulin therapy in
critically ill patients, including 12 randomized trials, demonstrated a 15% reduction in short-term mortality (relative
risk 0.85, 95% confidence interval 0.75–
0.97) but did not include any studies of
insulin therapy in medical ICUs (211).
Two additional multicenter RCTs of
intensive insulin therapy, one focusing
on patients with severe sepsis (VISEP)
and the second on medical and surgical
ICU patients, failed to demonstrate improvement in mortality but are not yet
published (212, 213). Both were stopped
earlier than planned because of high rates
of hypoglycemia and adverse events in
the intensive insulin groups. A large RCT
that is planned to compare targeting 80 –
110 mg/dL (4.5– 6.0 mmol/L) vs. 140 –180
mg/dL (8 –10 mmol/L) and recruit
⬎6,000 patients (Normoglycemia in Intensive Care Evaluation and Survival Using Glucose Algorithm Regulation, or
NICE-SUGAR) is ongoing (214).
Several factors may affect the accuracy
and reproducibility of point-of-care testing of blood capillary blood glucose, including the type and model of the device
used, user expertise, and patient factors,
including hematocrit (false elevation
with anemia), PaO2, and drugs (215). One
report showed overestimation of arterial
plasma glucose values by capillary pointof-care testing sufficient to result in different protocol-specified insulin dose titration. The disagreement between
protocol-recommended insulin doses was
largest when glucose values were low
(216). A recent review of 12 published
311
insulin infusion protocols for critically ill
patients showed wide variability in insulin dose recommendations and variable
glucose control during simulation (217).
This lack of consensus about optimal dosing of intravenous insulin may reflect
variability in patient factors (severity of
illness, surgical vs. medical settings) or
practice patterns (e.g., approaches to
feeding, intravenous dextrose) in the environments in which these protocols
were developed and tested. Alternatively,
some protocols may be more effective
than others. This conclusion is supported
by the wide variability in hypoglycemia
rates reported with protocols (205–207,
212, 213). Thus, the use of a validated and
safe intensive insulin protocol is important not only for clinical care but also for
the conduct of clinical trials to avoid hypoglycemia, adverse events, and premature termination of these trials before the
efficacy signal, if any, can be determined.
The finding of reduced morbidity and
mortality within the longer ICU length of
stay subsets along with acceptable cost
weighed heavily on our recommendation
to attempt glucose control after initial
stabilization of the patient with hyperglycemia and severe sepsis. However, the
mortality benefit and safety of intensive
insulin therapy (goal to normalize blood
glucose) have been questioned by two recent trials, and we recommend maintaining glucose levels ⬍150 mg/dL until recent and ongoing trials are published or
completed. Further study of protocols
that have been validated to be safe and
effective for controlling blood glucose
concentrations and blood glucose variation in the severe sepsis population is
needed.
D. Renal Replacement
1. We suggest that continuous renal replacement therapies and intermittent
hemodialysis are equivalent in patients with severe sepsis and acute renal failure (grade 2B).
2. We suggest the use of continuous
therapies to facilitate management of
fluid balance in hemodynamically unstable septic patients (grade 2D).
Rationale. Although numerous nonrandomized studies have reported a nonsignificant trend toward improved survival using continuous methods (218 –
225), two meta-analyses (226, 227)
reported the absence of significant difference in hospital mortality between patients who receive continuous and inter312
mittent renal replacement therapies. This
absence of apparent benefit of one modality over the other persists even when the
analysis is restricted to only randomized
studies (227). To date, five prospective
randomized studies have been published
(228 –232). Four of them found no significant difference in mortality (229 –232).
One study found significantly higher
mortality in the continuous treatment
group (228), but imbalanced randomization had led to a higher baseline severity
of illness in this group. When a multivariable model was used to adjust for severity of illness, no difference in mortality
was apparent between the groups (228).
Most studies comparing modes of renal
replacement in the critically ill have included a small number of patients and
some major weaknesses (randomization
failure, modifications of therapeutic protocol during the study period, combination of different types of continuous renal
replacement therapies, small number of
heterogenous groups of patients enrolled). The most recent and largest randomized study (232) enrolled 360 patients and found no significant difference
in survival between the two groups.
Moreover, there is no current evidence to
support the use of continuous therapies
in sepsis independent of renal replacement needs.
Concerning the hemodynamic tolerance of each method, no current evidence
exists to support a better tolerance with
continuous treatments. Only two prospective studies (230, 233) have reported
a better hemodynamic tolerance with
continuous treatment, with no improvement in regional perfusion (233) and no
survival benefit (230). Four other prospective studies did not find any significant difference in mean arterial pressure
or drop in systolic pressure between the
two methods (229, 231, 232, 234). Concerning fluid balance management, two
studies reported a significant improvement in goal achievement with continuous methods (228, 230). In summary,
current evidence is insufficient to draw
strong conclusions regarding the mode of
replacement therapy for acute renal failure in septic patients.
Four randomized controlled trials
have addressed whether the dose of continuous renal replacement affects outcomes in patients with acute renal failure
(235–238). Three found improved mortality in patients receiving higher doses of
renal replacement (235, 237, 238), while
one (236) did not. None of these trials
was conducted specifically in patients
with sepsis. Although the weight of current evidence suggests that higher doses
of renal replacement may be associated
with improved outcomes, these results
may not be easily generalizable. The results of two very large multicenter randomized trials comparing the dose of renal replacement (ATN in the United
States and RENAL in Australia and New
Zealand) will be available in 2008 and will
greatly inform practice.
E. Bicarbonate Therapy
1. We recommend against the use of sodium bicarbonate therapy for the purpose of improving hemodynamics or
reducing vasopressor requirements in
patients with hypoperfusion-induced
lactic acidemia with pH ⱖ7.15 (grade
1B).
Rationale. No evidence supports the
use of bicarbonate therapy in the treatment of hypoperfusion-induced lactic acidemia associated with sepsis. Two randomized, blinded, crossover studies that
compared equimolar saline and bicarbonate in patients with lactic acidosis failed
to reveal any difference in hemodynamic
variables or vasopressor requirements
(239, 240). The number of patients with
pH ⬍7.15 in these studies was small.
Bicarbonate administration has been associated with sodium and fluid overload,
an increase in lactate and PCO2, and a
decrease in serum ionized calcium, but
the relevance of these variables to outcome is uncertain. The effect of bicarbonate administration on hemodynamics and
vasopressor requirements at lower pH as
well as the effect on clinical outcomes at
any pH is unknown. No studies have examined the effect of bicarbonate administration on outcomes.
F. Deep Vein Thrombosis
Prophylaxis
1. We recommend that patients with severe sepsis receive deep vein thrombosis
(DVT) prophylaxis with either a) lowdose unfractionated heparin (UFH) administered twice or three times per day;
or b) daily low-molecular weight heparin (LMWH) unless there are contraindications (i.e., thrombocytopenia, severe
coagulopathy, active bleeding, recent intracerebral hemorrhage) (grade 1A).
2. We recommend that septic patients
who have a contraindication for heparin use receive mechanical prophylacCrit Care Med 2008 Vol. 36, No. 1
tic device, such as graduated compression stockings or intermittent
compression devices, unless contraindicated (grade 1A).
3. We suggest that in very high-risk patients, such as those who have severe
sepsis and history of DVT, trauma, or
orthopedic surgery, a combination of
pharmacologic and mechanical therapy be used unless contraindicated or
not practical (grade 2C).
4. We suggest that in patients at very
high risk, LMWH be used rather than
UFH as LMWH is proven superior in
other high-risk patients (grade 2C).
Rationale. ICU patients are at risk for
DVT (241). Significant evidence exists for
benefit of DVT prophylaxis in ICU patients in general. No reasons suggest that
severe sepsis patients would be different
from the general patient population.
Nine randomized placebo-controlled
clinical trials of DVT prophylaxis in general populations of acutely ill patients exist (242–250). All nine trials showed reduction in DVT or pulmonary embolism.
The prevalence of infection/sepsis was
17% in all studies in which this was ascertainable, with a 52% prevalence of infection/sepsis patients in the study that
included ICU patients only. Benefit of
DVT prophylaxis is also supported by
meta-analyses (251, 252). With that in
mind, DVT prophylaxis would appear to
have a high grade for quality of evidence
(A). Because the risk of administration to
the patient is small, the gravity of the
potential result of not administering is
great, and the cost is low, the grading of
the strength of the recommendation is
strong. The evidence supports equivalency of LMWH and UFH in general medical populations. A recent meta-analysis
comparing UFH twice daily and three
times daily demonstrated that UFH three
times daily produced better efficacy and
twice daily produced less bleeding (253).
Practitioners should use underlying risk
for VTE and bleeding to individualize
choice of twice daily vs. three times daily.
The cost of LMWH is greater and the
frequency of injection is less. UFH is preferred over LMWH in patients with moderate to severe renal dysfunction.
Mechanical methods (intermittent compression devices and graduated compression stockings) are recommended when anticoagulation is contraindicated or as an
adjunct to anticoagulation in very high-risk
patients (254 –256). In very high-risk patients, LMWH is preferred over UFH (257–
Crit Care Med 2008 Vol. 36, No. 1
259). Patients receiving heparin should be
monitored for development of heparininduced thrombocytopenia.
G. Stress Ulcer Prophylaxis
1. We recommend that stress ulcer prophylaxis using H2 blocker (grade 1A)
or proton pump inhibitor (grade 1B)
be given to patients with severe sepsis
to prevent upper gastrointestinal (GI)
bleed. The benefit of prevention of upper GI bleed must be weighed against
the potential effect of an increased
stomach pH on development of ventilator-associated pneumonia.
Rationale. Although no study has been
performed specifically in patients with severe sepsis, trials confirming the benefit
of stress ulcer prophylaxis in reducing
upper GI bleeds in general ICU populations would suggest that 20% to 25% of
patients enrolled in these types of trials
have sepsis (260 –263). This benefit
should be applicable to patients with severe sepsis and septic shock. In addition,
the conditions shown to benefit from
stress ulcer prophylaxis (coagulopathy,
mechanical ventilation, hypotension) are
frequently present in patients with severe
sepsis and septic shock (264, 265).
Although there are individual trials
that have not shown benefit from stress
ulcer prophylaxis, numerous trials and a
meta-analysis show reduction in clinically significant upper GI bleeding, which
we consider significant even in the absence of proven mortality benefit (266 –
269). The benefit of prevention of upper
GI bleed must be weighed against the
potential effect of increased stomach pH
on greater incidence of ventilatorassociated pneumonia (270). Those severe sepsis patients with the greatest risk
of upper GI bleeding are likely to benefit
most from stress ulcer prophylaxis. The
rationale for preferring suppression of
acid production over sulcrafate was based
on the study of 1,200 patients by Cook et
al. (271, 272) comparing H2 blockers and
sulcrafate and a meta-analysis. Two studies support equivalency between H2
blockers and proton pump inhibitors.
One study included very ill ICU patients;
the second study was larger and demonstrated noninferiority of omeprazole suspension for clinically significant stress ulcer bleeding (273, 274). No data relating
to utility of enteral feeding in stress ulcer
prophylaxis exist. Patients should be periodically evaluated for continued need
for prophylaxis.
H. Selective Digestive Tract
Decontamination (SDD)
The guidelines group was evenly split
on the issue of SDD, with equal numbers
weakly in favor and against recommending the use of SDD (Appendix H). The
committee therefore chose not to make a
recommendation for the use of SDD specifically in severe sepsis at this time. The
final consensus on use of SDD in severe
sepsis was achieved at the last nominal
committee meeting and subsequently approved by the entire committee (Appendix H provides the committee vote).
Rationale. The cumulative conclusion
from the literature demonstrates that
prophylactic use of SDD (enteral nonabsorbable antimicrobials and short-course
intravenous antibiotics) reduces infections, mainly pneumonia, and mortality
in the general population of critically ill
and trauma patients (275–286) without
promoting emergence of resistant Gramnegative bacteria. Post hoc subgroup
analyses (287, 288) of two prospective
blinded studies (289, 290) suggest that
SDD reduces nosocomial (secondary) infections in ICU patients admitted with
primary infections (268) and may reduce
mortality (288). No studies of SDD specifically focused on patients with severe
sepsis or septic shock. The use of SDD in
severe sepsis patients would be targeted
toward preventing secondary infection.
As the main effect of SDD is in preventing
ventilator-associated pneumonia (VAP),
studies comparing SDD with nonantimicrobial interventions, such as ventilator
bundles for reducing VAP, are needed.
Further investigation is required to determine the comparative efficacy of these
two interventions, separately or in combination. Although studies incorporating
enteral vancomycin in the regimen appear to be safe (291–293), concerns persist about the potential for emergence of
resistant Gram-positive infections.
I. Consideration for Limitation
of Support
1. We recommend that advance care
planning, including the communication of likely outcomes and realistic
goals of treatment, be discussed with
patients and families (grade 1D).
Rationale. Decisions for less aggressive support or withdrawal of support
may be in the patient’s best interest
(294 –296). Too frequently, inadequate
313
physician/family communication characterizes end-of-life care in the ICU. The
level of life support given to ICU patients
may not be consistent with their wishes.
Early and frequent caregiver discussions
with patients who face death in the ICU
and with their loved ones may facilitate
appropriate application and withdrawal of
life-sustaining therapies. A recent RCT
demonstrated reduction of anxiety and
depression in family members when endof-life meetings were carefully planned
and conducted, included advance care
planning, and provided relevant information about diagnosis, prognosis, and
treatment (297).
III. Pediatric Considerations in
Severe Sepsis
While sepsis in children is a major
cause of mortality, the overall mortality
from severe sepsis in children is much
lower that that in adults, estimated at
about 10% (298). The definitions for severe sepsis and septic shock in children
are similar but not identical to the definitions in adults (299). In addition to
age-appropriate differences in vital signs,
the definition of systemic inflammatory
response syndrome requires the presence
of either temperature or leukocyte abnormalities. The presence of severe sepsis
requires sepsis plus cardiovascular dysfunction or ARDS or two or more other
organ dysfunctions (299).
A. Antibiotics
1. We recommend that antibiotics be administered within 1 hr of the identification of severe sepsis, after appropriate cultures have been obtained (grade
1D).
Early antibiotic therapy is as critical
for children with severe sepsis as it is for
adults.
C. Fluid Resuscitation
1. We suggest that initial resuscitation
begin with infusion of crystalloids
with boluses of 20 mL/kg over 5–10
mins, titrated to clinical monitors of
cardiac output, including heart rate,
urine output, capillary refill, and level
of consciousness (grade 2C).
Intravenous access for fluid resuscitation and inotrope/vasopressor infusion is
more difficult to attain in children than
in adults. The American Heart Association and the American Academy of Pediatrics have developed pediatric advanced
life support guidelines for emergency establishment of intravascular support encouraging early intraosseous access
(302). On the basis of a number of studies, it is accepted that aggressive fluid
resuscitation with crystalloids or colloids
is of fundamental importance to survival
of septic shock in children (303–308).
Three randomized controlled trials compared the use of colloid to crystalloid
resuscitation in children with dengue
shock (303, 307, 308). No difference in
mortality between colloid or crystalloid
resuscitation was shown.
Children normally have a lower blood
pressure than adults, and fall in blood
pressure can be prevented by vasoconstriction and increasing heart rate.
Therefore, blood pressure by itself is not a
reliable end point for assessing the adequacy of resuscitation. However, once hypotension occurs, cardiovascular collapse
may soon follow. Hepatomegaly occurs in
children who are fluid overloaded and can
be a helpful sign of adequacy of fluid
resuscitation. Large fluid deficits typically exist, and initial volume resuscitation usually requires 40 – 60 mL/kg but
can be much higher (304 –308). However,
the rate of fluid administration should be
reduced substantially when there are
(clinical) signs of adequate cardiac filling
without hemodynamic improvement.
B. Mechanical Ventilation
No graded recommendations.
Due to low functional residual capacity, young infants and neonates with severe sepsis may require early intubation
(300). Drugs used for intubation have important side effects in these patients; for
example, concerns have been raised
about the safety of using etomidate in
children with meningococcal sepsis because of adrenal suppression effect (301).
The principles of lung-protective strategies
are applied to children as they are to adults.
314
D. Vasopressors/Inotropes
(Should Be Used in
Volume-Loaded Patients With
Fluid Refractory Shock)
1. We suggest dopamine as the first
choice of support for the pediatric patient with hypotension refractory to
fluid resuscitation (grade 2C).
In the initial resuscitation phase, vasopressor therapy may be required to sustain perfusion pressure, even when hypo-
volemia has not yet been resolved.
Children with severe sepsis can present
with low cardiac output and high systemic vascular resistance, high cardiac
output and low systemic vascular resistance, or low cardiac output and low systemic vascular resistance shock. At various stages of sepsis or the treatment
thereof, a child may move from one hemodynamic state to another. Vasopressor
or inotrope therapy should be used according to the clinical state of the child.
Dopamine-refractory shock may reverse with epinephrine or norepinephrine
infusion (309).
2. We suggest that patients with low
cardiac output and elevated systemic
vascular resistance states (cool extremities, prolonged capillary refill,
decreased urine output but normal
blood pressure following fluid resuscitation) be given dobutamine (grade
2C).
The choice of vasoactive agent is determined by the clinical examination. For
the child with a persistent low cardiac
output state with high systemic vascular
resistance despite fluid resuscitation and
inotropic support, vasodilator therapy
may reverse shock (310). When pediatric
patients remain in a normotensive low
cardiac output and high vascular resistance state despite epinephrine and vasodilator therapy, the use of a phosphodiesterase inhibitor may be considered (311–
313). In the case of extremely low
systemic vascular resistance despite the
use of norepinephrine, vasopressin use
has been described in a number of case
reports. There is no clear evidence for the
use of vasopressin in pediatric sepsis
(314, 315).
E. Therapeutic End Points
1. We suggest that the therapeutic end
points of resuscitation of septic shock
be normalization of the heart rate, capillary refill of ⬍2 secs, normal pulses
with no differential between peripheral
and central pulses, warm extremities,
urine output ⬎1 mL·kg⫺1·hr⫺1, and
normal mental status (290) (grade 2C).
Capillary refill may be less reliable in a
cold environment. Other end points that
have been widely used in adults and may
logically apply to children include decreased lactate and improved base deficit,
ScvO2 ⱖ70% or SV̄O2 ⱖ65%, central venous pressure of 8 –12 mm Hg, or other
methods to analyze cardiac filling. OptiCrit Care Med 2008 Vol. 36, No. 1
mizing preload optimizes cardiac index.
In terms of identifying acceptable cardiac
output in children with systemic arterial
hypoxemia, such as cyanotic congenital
heart disease or severe pulmonary disease, arterial-venous oxygen content difference is a better marker than mixed
venous hemoglobin saturation with oxygen. As noted previously, blood pressure
by itself is not a reliable end point for
resuscitation. If a thermodilution catheter is
used, therapeutic end points are cardiac index
⬎3.3 and ⬍6.0 L·min⫺1·m⫺2 with normal
coronary perfusion pressure (mean arterial
pressure minus central venous pressure) for
age (290). Using clinical end points, such as
reversal of hypotension and restoration of
capillary refill, for initial resuscitation at the
community hospital level before transfer to a
tertiary center was associated with significantly improved survival rates in children
with septic shock (305). Development of a
transport system including publicizing to local hospitals and transport with mobile intensive care services significantly decreased the
case fatality rate from meningococcal disease
in the United Kingdom (316).
F. Approach to Pediatric Septic
Shock
Figure 1 shows a flow diagram summarizing an approach to pediatric septic
shock (317).
G. Steroids
1. We suggest that hydrocortisone therapy be reserved for use in children
with catecholamine resistance and
suspected or proven adrenal insufficiency (grade 2C).
Patients at risk for adrenal insufficiency include children with severe septic
shock and purpura (318, 319), children
who have previously received steroid
therapies for chronic illness, and children
with pituitary or adrenal abnormalities.
Children who have clear risk factors for
adrenal insufficiency should be treated
with stress-dose steroids (hydrocortisone
50 mg/m2/24 hrs).
Adrenal insufficiency in pediatric severe sepsis is associated with a poor prognosis (320). No strict definitions exist,
but absolute adrenal insufficiency in the
case of catecholamine-resistant septic
shock is assumed at a random total cortisol concentration ⬍18 ␮g/dL (496
nmol/L). A post 30- or 60-min ACTH
stimulation test increase in cortisol of ⱕ9
␮g/dL (248 mmol/L) has been used to
Crit Care Med 2008 Vol. 36, No. 1
Figure 1. Approach to pediatric shock. *Normalization of blood pressure and tissue perfusion;
**hypotension, abnormal capillary refill or extremity coolness. PALS, Pediatric Advanced Life Support;
PICU, pediatric intensive care unit; CI, cardiac index; ECMO, extracorporeal membrane oxygenation.
define relative adrenal insufficiency. The
treatment of relative adrenal insufficiency in children with septic shock is
controversial. A retrospective study from
a large administrative database recently
reported that the use of any corticosteroids in children with severe sepsis was
associated with increased mortality (odds
ratio 1.9, 95% confidence interval 1.7–
2.2) (321). While steroids may have been
given preferentially to more severely ill
children, the use of steroids was an independent predictor of mortality in multivariable analysis (321). Given the lack of
data in children and potential risk, steroids should not be used in children who
do not meet minimal criteria for adrenal
insufficiency. A randomized, controlled
trial in children with septic shock is very
much needed.
H. Protein C and Activated
Protein C
1. We recommend against the use rhAPC
in children (grade 1B).
Protein C concentrations in children
reach adult values at the age of 3 yrs. This
might indicate that the importance of
protein C supplementation either as protein C concentrate or as rhAPC is even
315
greater in young children than in adults
(322). There has been one dose-finding,
randomized, placebo-controlled study
performed using protein C concentrate.
This study was not powered to show an
effect on mortality rate but did show a
positive effect on sepsis-induced coagulation disturbances (323). An RCT of rhAPC
in pediatric severe sepsis patients was
stopped by recommendation of the Data
Monitoring Committee for futility after
enrollment of 399 patients: 28-day all
cause mortality was 18% placebo group
vs. 17% APC group. Major amputations
occurred in 3% of the placebo group vs.
2% in the APC group (324). Due to the
increased risk of bleeding (7% vs. 6% in
the pediatric trial) and lack of proof of
efficacy, rhAPC is not recommended for
use in children.
I. DVT Prophylaxis
1. We suggest the use of DVT prophylaxis
in postpubertal children with severe
sepsis (grade 2C).
Most DVTs in young children are associated with central venous catheters.
Femoral venous catheters are commonly
used in children, and central venous
catheter-associated DVTs occur in approximately 25% of children with a femoral central venous catheter. Heparinbonded catheters may decrease the risk of
catheter-associated DVT and should be
considered for use in children with severe
sepsis (325, 326). No data on the efficacy
of UFH or LMWH prophylaxis to prevent
catheter-related DVT in children in the
ICU exist.
J. Stress Ulcer Prophylaxis
No graded recommendations.
Studies have shown that the rate of
clinically important gastrointestinal
bleeding in children occurs at rates similar to adults (327, 328). As in adults,
coagulopathy and mechanical ventilation
are risk factors for clinically important
gastrointestinal bleeding. Stress ulcer
prophylaxis strategy is commonly used in
mechanically ventilated children, usually
with H2 blockers. Its effect is not known.
K. Renal Replacement Therapy
No graded recommendations.
Continuous veno-venous hemofiltration
(CVVH) may be clinically useful in children
with anuria/severe oliguria and fluid overload, but no large RCTs have been per316
formed comparing CVVH with intermittent
dialysis. A retrospective study of 113 critically ill children reported that children
with less fluid overload before CVVH had
better survival, especially in those children
with dysfunction of three or more organs
(329). CVVH or other renal replacement
therapy should be instituted in children
with anuria/severe oliguria before significant fluid overload occurs.
known. A recent multicenter trial reported similar outcomes in stable critically ill children managed with a transfusion threshold of 7 g/dL compared with
those managed with a transfusion threshold of 9.5 g/dL (334). Whether a lower
transfusion trigger is safe or appropriate
in the initial resuscitation of septic shock
has not been determined.
O. Intravenous Immunoglobulin
L. Glycemic Control
No graded recommendations.
In general, infants are at risk for developing hypoglycemia when they depend
on intravenous fluids. This means that a
glucose intake of 4 – 6 mg·kg⫺1·min⫺1 or
maintenance fluid intake with glucose
10%/NaCl-containing solution is advised.
Associations have been reported between
hyperglycemia and an increased risk of
death and longer length of stay (330). A
recent retrospective pediatric ICU study
reported associations of hyperglycemia,
hypoglycemia, and glucose variability
with length of stay and mortality rates
(331). No studies in pediatric patients
(without diabetes mellitus) analyzing the
effect of strict glycemic control using insulin exist. In adults, the recommendation is to maintain serum glucose ⬍150
mg/dL. Insulin therapy to avoid long periods of hyperglycemia seems sensible in
children as well, but the optimal goal
glucose is not known. However, continuous insulin therapy should only be conducted with frequent glucose monitoring
in view of the risks for hypoglycemia.
M. Sedation/Analgesia
1. We recommend sedation protocols
with a sedation goal when sedation of
critically ill mechanically ventilated
patients with sepsis is required (grade
1D).
Appropriate sedation and analgesia are
the standard of care for children who are
mechanically ventilated. Although there
are no data supporting any particular
drugs or regimens, it should be noted
that propofol should not be used for longterm sedation in children because of the
reported association with fatal metabolic
acidosis (332, 333).
N. Blood Products
No graded recommendations.
The optimal hemoglobin for a critically ill child with severe sepsis is not
1. We suggest that immunoglobulin be
considered in children with severe
sepsis (grade 2C).
Administration of polyclonal intravenous immunoglobulin has been reported
to reduce mortality rate and is a promising adjuvant in the treatment of sepsis
and septic shock in neonates. A recent
randomized controlled study of polyclonal immunoglobulin in pediatric sepsis syndrome patients (n ⫽ 100) showed a
significant reduction in mortality and
LOS and less progress to complications,
especially disseminated intravascular coagulation (335).
P. Extracorporeal Membrane
Oxygenation (ECMO)
1. We suggest that use of ECMO be limited to refractory pediatric septic
shock and/or respiratory failure that
cannot be supported by conventional
therapies (grade 2C).
ECMO has been used in septic shock
in children, but its impact is not clear.
Survival from refractory shock or respiratory failure associated with sepsis is
80% in neonates and 50% in children. In
one study analyzing 12 patients with meningococcal sepsis in ECMO, eight of the
12 patients survived, with six leading
functionally normal lives at a median of 1
yr (range, 4 months to 4 yrs) of follow-up.
Children with sepsis on ECMO do not
perform worse than children without sepsis at long-term follow-up (336, 337).
Although the pediatric considerations
section of this article offers important
information to the practicing pediatric
clinician for the management of critically
ill children with sepsis, the reader is referred to the reference list for more indepth descriptions of appropriate management of pediatric septic patients.
SUMMARY AND FUTURE
DIRECTIONS
Although this document is static, the
optimum treatment of severe sepsis and
Crit Care Med 2008 Vol. 36, No. 1
septic shock is a dynamic and evolving
process. New interventions will be proven
and, as stated in the current recommendations, established interventions may
need modification. This publication represents an ongoing process. The Surviving Sepsis Campaign and the consensus
committee members are committed to
updating the guidelines regularly as new
interventions are tested and published.
Although evidence-based recommendations have been published frequently in
the medical literature, documentation of
impact on patient outcome is limited
(338). However, there is growing evidence that protocol implementation associated with education and performance
feedback does change clinician behavior
and may improve outcomes and reduce
costs in severe sepsis (20, 24, 25). Phase
III of the Surviving Sepsis Campaign targets the implementation of a core set of
the previous recommendations in hospital environments where change in behavior and clinical impact are being measured. The sepsis bundles were developed
in collaboration with the Institute of
Healthcare Improvement (339). Concurrent or retrospective chart review will
identify and track changes in practice and
clinical outcome. Software and software
support are available at no cost in seven
languages, allowing bedside data entry
and allowing creation of regular reports
for performance feedback. The SSC also
offers significant program support and
educational materials at no cost to the
user (www.survivingsepsis.org).
Engendering evidence-based change
in clinical practice through multifaceted
strategies while auditing practice and
providing feedback to healthcare practitioners is the key to improving outcomes
in severe sepsis. Nowhere is this more
evident than in the worldwide enthusiasm for phase III of the SSC, a performance improvement program using SSC
guideline-based sepsis bundles. Using the
guidelines as the basis, the bundles have
established a global best practice for the
management of critically ill patients with
severe sepsis. As of November 2007,
nearly 12,000 patients had been entered
into the SSC central database, representing efforts of 239 hospitals in 17 countries. Changes in practice and potential
effects on survival are being measured.
ACKNOWLEDGMENTS
As mentioned previously, the Surviving Sepsis Campaign (SSC) is partially
Crit Care Med 2008 Vol. 36, No. 1
funded by unrestricted educational industry grants, including those from Edwards LifeSciences, Eli Lilly and Company, and Philips Medical Systems. The
SSC also received funding from the Coalition for Critical Care Excellence of the
Society of Critical Care Medicine. The
great majority of industry funding has
come from Eli Lilly and Company.
Current industry funding for the Surviving Sepsis Campaign is directed to the
performance improvement initiative. No
industry funding was used for committee
meetings. No honoraria were provided to
committee members. The revision process was funded primarily by the Society
of Critical Care Medicine, with the sponsoring professional organizations providing travel expenses for their designated
delegate to the guidelines revision meeting where needed.
OTHER ACKNOWLEDGMENTS
In addition, we acknowledge Toni
Piper and Rae McMorrow for their assistance in bringing the manuscripts together; and Gordon Guyatt and Henry
Masur, MD, for their guidance on grading
of evidence and antibiotic recommendations, respectively.
Nine of the 11 organizations that
sponsored the first guidelines are sponsors of the revision. Four additional national organizations (Canadian Critical
Care Society, Japanese Association for
Acute Medicine, Japanese Society of Intensive Care Medicine, and Society of
Hospital Medicine), the World Federation
of Intensive and Critical Care Societies,
and two sepsis organizations (German
Sepsis Society and the Latin American
Sepsis Institute) have also come on board
as sponsors. Two organizations that
sponsored the first guidelines (American
Thoracic Society and Australian and New
Zealand Intensive Care Society) elected
not to sponsor the revision.
REFERENCES
1. Angus DC, Linde-Zwirble WT, Lidicker J, et
al: Epidemiology of severe sepsis in the
United States: Analysis of incidence, outcome, and associated costs of care. Crit
Care Med 2001; 29:1303–1310
2. Dellinger RP: Cardiovascular management
of septic shock. Crit Care Med 2003; 31:
946 –955
3. Martin GS, Mannino DM, Eaton S, et al: The
epidemiology of sepsis in the United States
from 1979 through 2000. N Engl J Med
2003; 348:1546 –1554
4. Linde-Zwirble WT, Angus DC: Severe sepsis
epidemiology: Sampling, selection, and society. Crit Care 2004; 8:222–226
5. Dombrovskiy VY, Martin AA, Sunderram J,
et al: Rapid increase in hospitalization and
mortality rates for severe sepsis in the
United States: A trend analysis from 1993 to
2003. Crit Care Med 2007; 35:1414 –1415
6. Dellinger RP, Carlet JM, Masur H, et al:
Surviving Sepsis Campaign guidelines for
management of severe sepsis and septic
shock. Crit Care Med 2004; 32:858 – 873
7. Dellinger RP, Carlet JM, Masur H, et al:
Surviving Sepsis Campaign guidelines for
management of severe sepsis and septic
shock. Intensive Care Med 2004; 30:
536 –555
8. Guyatt G, Schünemann H, Cook D, et al:
Applying the grades of recommendations
for antithrombotic and thrombolytic therapy: The seventh ACCP conference of antithrombotic and thrombolytic therapy.
Chest 2004; 126:179S–187S
9. GRADE working group: Grading quality of
evidence and strength of recommendations.
BMJ 2004; 328:1490 –1498
10. Guyatt G, Gutterman D, Baumann MH, et
al: Grading strength of recommendations
and quality of evidence in clinical guidelines: Report from an American College of
Chest Physicians task force. Chest 2006;
129:174 –181
11. Schünemann HJ, Jaeschke R, Cook DJ, et
al, on behalf of the ATS Documents Development and Implementation Committee:
An official ATS statement: Grading the
quality of evidence and strength of recommendations in ATS guidelines and recommendations. Am J Respir Crit Care Med
2006; 174:605– 614
12. Levy MM, Fink MP, Marshall JC, et al: 2001
SCCM/ESICM/ACCP/ATS/SIS International
Sepsis Definitions Conference. Crit Care
Med 2003; 31:1250 –1256
13. Bone RC, Balk RA, Cerra FB, et al, and
members of the ACCP/SCCM Consensus
Conference: Definitions for sepsis and organ failure and guidelines for the use of
innovative therapies in sepsis. Chest 1992;
101:1644 –1655 and Crit Care Med 1992;
20:864 – 874
14. Sprung CL, Bernard GR, Dellinger RP
(Eds): Guidelines for the management of
severe sepsis and septic shock. Intensive
Care Med 2001; 27(Suppl 1):S1–S134
15. Sackett DL: Rules of evidence and clinical
recommendations on the use of antithrombotic agents. Chest 1989; 95:2S– 4S
16. Rivers E, Nguyen B, Havstad S, et al: Early
goal-directed therapy in the treatment of
severe sepsis and septic shock. N Engl J Med
2001; 345:1368 –1377
17. Bendjelid K, Romand JA: Fluid responsiveness in mechanically ventilated patients: A
review of indices used in intensive care.
Intensive Care Med 2003; 29:352–360
18. Malbrain ML, Deeren D, De Potter TJ: Intraabdominal hypertension in the critically ill:
317
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
32.
33.
34.
318
It is time to pay attention. Curr Opin Crit
Care 2005; 11:156 –171
Varpula M, Tallgren M, Saukkonen K, et al:
Hemodynamic variables related to outcome
in septic shock. Intensive Care Med 2005;
31:1066 –1071
Kortgen A, Niederprum P, Bauer M: Implementation of an evidence-based “standard
operating procedure” and outcome in septic
shock. Crit Care Med 2006; 34:943–949
Sebat F, Johnson D, Musthafa AA, et al: A
multidisciplinary community hospital program for early and rapid resuscitation of
shock in nontrauma patients. Chest 2005;
127:1729 –1743
Shapiro NI, Howell MD, Talmor D, et al:
Implementation and outcomes of the Multiple Urgent Sepsis Therapies (MUST) protocol. Crit Care Med 2006; 34:1025–1032
Micek SST, Roubinian N, Heuring T, et al:
Before-after study of a standardized hospital
order set for the management of septic
shock. Crit Care Med 2006; 34:2707–2713
Nguyen HB, Corbett SW, Steele R, et al:
Implementation of a bundle of quality indicators for the early management of severe
sepsis and septic shock is associated with
decreased mortality. Crit Care Med 2007;
35:1105–1112
Shorr AF, Micek ST, Jackson WL Jr, et al:
Economic implications of an evidencebased sepsis protocol: Can we improve outcomes and lower costs? Crit Care Med 2007;
35:1257–1262
Reinhart K, Kuhn HJ, Hartog C, et al: Continuous central venous and pulmonary artery oxygen saturation monitoring in the
critically ill. Intensive Care Med 2004; 30:
1572–1578
Trzeciak S, Dellinger RP, Abate N, et al:
Translating research to clinical practice: A
1-year experience with implementing early
goal-directed therapy for septic shock in the
emergency department. Chest 2006; 129:
225–232
Magder S: Central venous pressure: A useful
but not so simple measurement. Crit Care
Med 2006; 34:2224 –2227
Bendjelid K: Right arterial pressure: Determinant or result of change in venous return? Chest 2005; 128:3639 –3640
Vincent JL, Weil MH: Fluid challenge revisited. Crit Care Med 2006; 34:1333–1337
Trzeciak S, Dellinger RP, Parrillo JE, et al:
Early microcirculatory perfusion derangements in patients with severe sepsis and
septic shock: Relationship to hemodynamics, oxygen transport, and survival. Ann
Emerg Med 2007; 49:88 –98
De Backer D, Creteur J, Dubois MJ, et al:
The effects of dobutamine on microcirculatory alternations in patients with septic
shock are independent of its systemic effects. Crit Care Med 2006; 34:403– 408
Buwalda M, Ince C: Opening the microcirculation: Can vasodilators be useful in sepsis?
Intensive Care Med 2002; 28:1208 –1217
Boldt J: Clinical review: Hemodynamic
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
monitoring in the intensive care unit. Crit
Care 2002; 6:52–59
Pinsky MR, Payen D: Functional hemodynamic
monitoring. Crit Care 2005; 9:566–572
Weinstein MP, Reller LP, Murphy JR, et al:
The clinical significance of positive blood
cultures: A comprehensive analysis of 500
episodes of bacteremia and fungemia in
adults. I. Laboratory and epidemiologic observations. Rev Infect Dis 1983; 5:35–53
Blot F, Schmidt E, Nitenberg G, et al: Earlier positivity of central venous versus peripheral blood cultures is highly predictive
of catheter-related sepsis. J Clin Microbiol
1998; 36:105–109
Mermel LA, Maki DG: Detection of bacteremia in adults: Consequences of culturing an
inadequate volume of blood. Ann Intern
Med 1993; 119:270 –272
Guidelines for the management of adults
with hospital-acquired, ventilator-associated, and healthcare-associated pneumonia.
Am J Respir Crit Care Med 2005; 171:
388 – 416
Giamarellos-Bourboulis EJ, Giannopoulou
P, Grecka P, et al: Should procalcitonin be
introduced in the diagnostic criteria for the
systemic inflammatory response syndrome
and sepsis? J Crit Care 2004; 19:152–157
Tenover FC: Rapid detection and identification of bacterial pathogens using novel molecular technologies: Infection control and
beyond. Clin Infect Dis 2007; 44:418 – 423
Kumar A, Roberts D, Wood KE, et al: Duration of hypotension prior to initiation of
effective antimicrobial therapy is the critical determinant of survival in human septic
shock. Crit Care Med 2006; 34:1589 –1596
Morrell M, Fraser VJ, Kollef MH: Delaying
the empiric treatment of candida bloodstream infection until positive blood culture results are obtained: A potential risk
factor for hospital mortality. Antimicrob
Agents Chemother 2005; 49:3640 –3645
Pappas PG, Rex JH, Sobel JD, et al: Guidelines for treatment of candidiasis. Clin Infect Dis 2004; 38:161–189
McCabe WR, Jackson GG: Gram negative
bacteremia. Arch Intern Med 1962; 110:
92–100
Kreger BE, Craven DE, McCabe WR: Gram
negative bacteremia: IV. Re-evaluation of
clinical features and treatment in 612 patients. Am J Med 1980; 68:344 –355
Leibovici L, Shraga I, Drucker M, et al: The
benefit of appropriate empirical antibiotic
treatment in patients with bloodstream infection. J Intern Med 1998; 244:379 –386
Ibrahim EH, Sherman G, Ward S, et al: The
influence of inadequate antimicrobial treatment of bloodstream infections on patient
outcomes in the ICU setting. Chest 2000;
118:146 –155
Hatala R, Dinh T, Cook DJ: Once-daily aminoglycoside dosing in immunocompetent
adults: A meta-analysis. Ann Intern Med
1996; 124:717–725
Ali MZ, Goetz MB: A meta-analysis of the
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
relative efficacy and toxicity of single daily
dosing versus multiple daily dosing of aminoglycosides. Clin Infect Dis 1997; 24:
796 – 809
Amsden GW, Ballow CH, Bertino JS: Pharmacokinetics and pharmacodynamics of anti-infective agents. In: Principles and Practice of Infectious Diseases. Fifth Edition.
Mandell GL, Bennett JE, Dolin R (Eds).
Philadelphia, Churchill Livingstone, 2000,
pp 253–261
Hyatt JM, McKinnon PS, Zimmer GS, et al:
The importance of pharmacokinetic/pharmacodynamic surrogate markers to outcomes: Focus on antibacterial agents. Clin
Pharmacokinet 1995; 28:143–160
Hughes WT, Armstrong D, Bodey GP, et al:
2002 Guidelines for the use of antimicrobial
agents in neutropenic patients with cancer.
http://www.idsociety.org. Accessed July 10,
2007
Klastersky J: Management of fever in neutropenic patients with different risks of
complications. Clin Infect Dis 2004;
39(Suppl 1):S32–S37
Safdar N, Handelsman J, Maki DG: Does
combination antimicrobial therapy reduce
mortality in Gram-negative bacteraemia? A
meta-analysis. Lancet Infect Dis 2004;
4:519 –527
Paul M, Silbiger I, Grozinsky S, et al: Beta
lactam antibiotic monotherapy versus beta
lactam-aminoglycoside antibiotic combination therapy for sepsis. Cochrane Database
Syst Rev 2006; (1):CD003344
Garnacho-Montero J, Sa-Borges M, SoleViolan J, et al: Optimal management therapy for Pseudomonas aeruginosa ventilatorassociated pneumonia: An observational,
multicenter study comparing monotherapy
with combination antibiotic therapy. Crit
Care Med 2007; 25:1888 –1895
Jimenez MF, Marshall JC: Source control in
the management of sepsis. Intensive Care
Med 2001; 27:S49 –S62
Moss RL, Musemeche CA, Kosloske AM: Necrotizing fascitis in children: Prompt recognition and aggressive therapy improve survival. J Pediatr Surg 1996; 31:1142–1146
Bufalari A, Giustozzi G, Moggi L: Postoperative intraabdominal abscesses: Percutaneous versus surgical treatment. Acta Chir
Belg 1996; 96:197–200
Centers for Disease Control and Prevention:
Guidelines for the prevention of intravascular catheter-related infections. MMWR Morbid Mortal Wkly Rep 2002; 51(RR-10):1–29
O’Grady NP, Alexander M, Dellinger EP, et
al: Guidelines for the prevention of intravascular catheter-related infections. Clin
Infect Dis 2002; 35:1281–1307
Mier J, Leon EL, Castillo A, et al: Early
versus late necrosectomy in severe necrotizing pancreatitis. Am J Surg 1997; 173:
71–75
Evans A, Winslow BH: Oxygen saturation
and hemodynamic response in critically ill
mechanically ventilated adults during intra-
Crit Care Med 2008 Vol. 36, No. 1
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
hospital transport. Am J Crit Care 1995;
4:106 –111
Finfer S, Bellomo R, Boyce N, et al: A comparison of albumin and saline for fluid resuscitation in the intensive care unit.
N Engl J Med 2004; 350:2247–2256
Choi PTL, Yip G, Quinonez LG, et al: Crystalloids vs. colloids in fluid resuscitation: A
systematic review. Crit Care Med 1999; 27:
200 –210
Cook D, Guyatt G: Colloid use for fluid
resuscitation: Evidence and spin. Ann Intern Med 2001; 135:205–208
Schierhout G, Roberts I: Fluid resuscitation
with colloid or crystalloid solutions in critically ill patients: A systematic review of
randomized trials. BMJ 1998; 316:961–964
Schortgen F, Lacherade JC, Bruneel F, et al:
Effects of hydroxyethyl starch and gelatin
on renal function in severe sepsis: A multicentre randomised study. Lancet 2001; 357:
911–916
Sakr Y, Payen D, Reinhart K, et al: Effects of
hydroxyethyl starch administration on renal function in critically ill patients. Br J
Anaesth 2007; 98:216 –224
Hollenberg SM, Ahrens TS, Annane D, et al:
Practice parameters for hemodynamic support of sepsis in adult patients: 2004 update.
Crit Care Med 2004; 32:1928 –1948
LeDoux D, Astiz ME, Carpati CM, et al:
Effects of perfusion pressure on tissue perfusion in septic shock. Crit Care Med 2000;
28:2729 –2732
Martin C, Papazian L, Perrin G, et al: Norepinephrine or dopamine for the treatment
of hyperdynamic septic shock? Chest 1993;
103:1826 –1831
Martin C, Viviand X, Leone M, et al: Effect of
norepinephrine on the outcome of septic
shock. Crit Care Med 2000; 28:2758 –2765
De Backer D, Creteur J, Silva E, et al: Effects of dopamine, norepinephrine, and epinephrine on the splanchnic circulation in
septic shock: Which is best? Crit Care Med
2003; 31:1659 –1667
Day NP, Phu NH, Bethell DP, et al: The
effects of dopamine and adrenaline infusions on acid-base balance and systemic
haemodynamics in severe infection. Lancet
1996; 348:219 –223
Le Tulzo Y, Seguin P, Gacouin A, et al:
Effects of epinephrine on right ventricular
function in patients with severe septic
shock and right ventricular failure: A preliminary descriptive study. Intensive Care
Med 1997; 23:664 – 670
Bollaert PE, Bauer P, Audibert G, et al:
Effects of epinephrine on hemodynamics
and oxygen metabolism in dopamineresistant septic shock. Chest 1990; 98:
949 –953
Zhou SX, Qiu HB, Huang YZ, et al: Effects
of norepinephrine, epinephrine, and norepinephrine-dobutamine on systemic and
gastric mucosal oxygenation in septic
shock. Acta Pharm Sin 2002; 23:654 – 658
Levy B, Bollaert PE, Charpentier C, et al:
Crit Care Med 2008 Vol. 36, No. 1
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
Comparison of norepinephrine and dobutamine to epinephrine for hemodynamics,
lactate metabolism, and gastric tonometric
variables in septic shock: A prospective, randomized study. Intensive Care Med 1997;
23:282–287
Mackenzie SJ, Kapadia F, Nimmo GR, et al:
Adrenaline in treatment of septic shock:
Effects on haemodynamics and oxygen
transport. Intensive Care Med 1991; 17:
36 –39
Moran JL, O’Fathartaigh MS, Peisach AR, et
al: Epinephrine as an inotropic agent in
septic shock: A dose-profile analysis. Crit
Care Med 1993; 21:70 –77
Yamazaki T, Shimada Y, Taenaka N, et al:
Circulatory responses to afterloading with
phenylephrine in hyperdynamic sepsis. Crit
Care Med 1982; 10:432– 435
Gregory JS, Bonfiglio MF, Dasta JF, et al:
Experience with phenylephrine as a component of the pharmacologic support of septic
shock. Crit Care Med 1991; 19:1395–1400
Djillali A, Vigno P, Renault A, et al, for the
CATS STUDY Group: Norepinephrine plus
dobutamine versus epinephrine alone for
management of septic shock: A randomized
trial. Lancet 2007; 370:676 – 684
Regnier B, Rapin M, Gory G, et al: Haemodynamic effects of dopamine in septic
shock. Intensive Care Med 1977; 3:47–53
Landry DW, Levin HR, Gallant EM, et al:
Vasopressin deficiency contributes to the
vasodilation of septic shock. Circulation
1997; 95:1122–1125
Patel BM, Chittock DR, Russell JA, et al:
Beneficial effects of short-term vasopressin
infusion during severe septic shock. Anesthesiology 2002; 96:576 –582
Dünser MW, Mayr AJ, Ulmer H, et al: Arginine vasopressin in advanced vasodilatory
shock: A prospective, randomized, controlled study. Circulation 2003; 107:
2313–2319
Holmes CL, Patel BM, Russell JA, et al:
Physiology of vasopressin relevant to management of septic shock. Chest 2001; 120:
989 –1002
Malay MB, Ashton RC, Landry DW, et al:
Low-dose vasopressin in the treatment of
vasodilatory septic shock. J Trauma 1999;
47:699 –705
Holmes CL, Walley KR, Chittock DR, et al:
The effects of vasopressin on hemodynamics and renal function in severe septic
shock: A case series. Intensive Care Med
2001; 27:1416 –1421
Lauzier F, Levy B, Lamarre P, et al: Vasopressin or norepinephrine in early hyperdynamic septic shock: A randomized clinical
trial. Intensive Care Med 2006; 32:
1782–1789
O’Brien A, Calpp L, Singer M: Terlipressin
for norepinephrine-resistant septic shock.
Lancet 2002; 359:1209 –1210
Sharshar T, Blanchard A, Paillard M, et al:
Circulating vasopressin levels in septic
shock. Crit Care Med 2003; 31:1752–1758
96. Dünser MW, Mayr AJ, Tura A, et al: Ischemic skin lesions as a complication of continuous vasopressin infusion in catecholamine-resistant vasodilatory shock:
Incidence and risk factors. Crit Care Med
2003; 31:1394 –1398
97. Bellomo R, Chapman M, Finfer S, et al:
Low-dose dopamine in patients with early
renal dysfunction: A placebo-controlled
randomised trial. Australian and New Zealand Intensive Care Society (ANZICS) Clinical Trials Group. Lancet 2000; 356:
2139 –2143
98. Kellum J, Decker J: Use of dopamine in
acute renal failure: A meta-analysis. Crit
Care Med 2001; 29:1526 –1531
99. Gattinoni L, Brazzi L, Pelosi P, et al: A trial
of goal-oriented hemodynamic therapy in
critically ill patients. N Engl J Med 1995;
333:1025–1032
100. Hayes MA, Timmins AC, Yau EHS, et al:
Elevation of systemic oxygen delivery in the
treatment of critically ill patients. N Engl
J Med 1994; 330:1717–1722
101. Annane D, Sebille V, Charpentier C, et al:
Effect of treatment with low doses of hydrocortisone and fludrocortisone on mortality
in patients with septic shock. JAMA 2002;
288:862– 871
102. Briegel J, Forst H, Haller M, et al: Stress
doses of hydrocortisone reverse hyperdynamic septic shock: A prospective, randomized, double-blind, single-center study. Crit
Care Med 1999; 27:723–732
103. Bollaert PE, Charpentier C, Levy B, et al:
Reversal of late septic shock with supraphysiologic doses of hydrocortisone. Crit
Care Med 1998; 26:645– 650
104. Sprung CL, Annane D, Briegel J, et al: Corticosteroid therapy of septic shock
(CORTICUS). Abstr. Am Rev Respir Crit
Care Med 2007; 175:A507
105. Briegel J, Vogeser M, Annane D, et al: Measurement of cortisol in septic shock: Interlaboratory harmonization. Am Rev Respir
Crit Care Med 2007; 175:A436
106. Allolio B, Dorr H, Stuttmann R, et al: Effect
of a single bolus of etomidate upon eight
major corticosteroid hormone and plasma
ACTH. Clin Endocrinol (Oxf) 1985; 22:
281–286
107. Reincke M, Allolio B, Würth G, et al: The
hypothalamic-pituitary-adrenal axis in critical illness: Response to dexamethasone and
corticotropin-releasing hormone. J Clin
Endocrinol Metab 1993; 77:151–156
108. Oppert M, Schindler R, Husung C, et al:
Low dose hydrocortisone improves shock
reversal and reduces cytokine levels in early
hyperdynamic septic shock. Crit Care Med
2005; 33:2457–2464
109. Yildiz O, Doganay M, Aygen B, et al: Physiologic-dose steroid therapy in sepsis. Crit
Care 2002; 6:251–259
110. Keh D, Boehnke T, Weber-Carstens S, et al:
Immunologic and hemodynamic effects of
“low-dose” hydrocortisone in septic shock:
A double-blind, randomized, placebo-
319
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
122.
123.
124.
125.
320
controlled, crossover study. Am J Respir
Crit Care Med 2003; 167:512–520
Bone RC, Fisher CJ, Clemmer TP: A controlled clinical trial of high-dose methylprednisolone in the treatment of severe sepsis and septic shock. N Engl J Med 1987;
317:653– 658
Cronin L, Cook DJ, Carlet J, et al: Corticosteroid treatment for sepsis: A critical appraisal and meta-analysis of the literature.
Crit Care Med 1995; 23:1430 –1439
The Veterans Administration Systemic Sepsis Cooperative Study Group: Effect on
high-dose glucocorticoid therapy on mortality in patients with clinical signs of sepsis. N Engl J Med 1987; 317:659 – 665
Confalonieri M, Urbino R, Potena A, et al:
Hydrocortisone infusion for severe community-acquired pneumonia: A preliminary
randomized study. Am J Respir Crit Care
Med 2005; 171:242–248
Bernard GR, Vincent JL, Laterre PF, et al:
Efficacy and safety of recombinant human
activated protein c for severe sepsis. N Engl
J Med 2001; 344:699 –709
Abraham E, Laterre PF, Garg R, et al: Drotrecogin alfa (activated) for adults with severe sepsis and a low risk of death. N Engl
J Med 2005; 353:1332–1341
Vincent JL, Bernard GR, Beale R, et al:
Drotrecogin alfa (activated) treatment in severe sepsis from the global open-label trial
ENHANCE: Further evidence for survival
and safety and implications for early treatment. Crit Care Med 2005; 33:2266 –2277
Oxman AD, Guyatt GH: A consumer’s guide
to subgroup analyses. Ann Intern Med 1992;
116:78 – 84
Ely EW, Laterre PF, Angus DC, et al: Drotrecogin alfa (activated) administration
across clinically important subgroups of patients with severe sepsis. Crit Care Med
2003; 31:12–19
Kanji S, Perreault MM, Chant C, et al: Evaluating the use of drotrecogin alfa activated
in adult severe sepsis: a Canadian multicenter observational study. Intensive Care
Med 2007; 33:517–523
Bertolini G, Rossi C, Anghileri A, et al: Use
of drotrecogin alfa (activated) in Italian intensive care units: The results of a nationwide survey. Intensive care Med 2007; 33:
426 – 434
European Medicines Agency Evaluation of
Medicines for Human Use. http://www.emea.
europa.eu/pdfs/human/press/pr/8509607en.
pdf. Accessed October 22, 2007
Hébert PC, Wells G, Blajchman MA, et al: A
multicenter, randomized, controlled clinical trial of transfusion in critical care.
N Engl J Med 1999; 340:409 – 417
Marik PE, Sibbald WJ: Effect of stored-blood
transfusion on oxygen delivery in patients
with sepsis. JAMA 1993; 269:3024 –3029
Lorente JA, Landín L, dePablo R, et al: Effects of blood transfusion on oxygen transport variables in severe sepsis. Crit Care
Med 1993; 21:1312–1318
126. Fernandes CJ, Akamine N, DeMarco FVC, et
al: Red blood cell transfusion does not increase oxygen consumption in critically ill
septic patients. Crit Care 2001; 5:362–567
127. Corwin HL, Gettinger A, Rodriguez RM, et
al: Efficacy of recombinant human erythropoietin in the critically ill patient: A randomized double-blind, placebo-controlled
trial. Crit Care Med 1999; 27:2346 –2350
128. Corwin HL, Gettinger A, Pearl RG, et al:
Efficacy of recombinant human erythropoietin in critically ill patients. JAMA 2002;
28:2827–2835
129. College of American Pathologists: Practice
parameter for the use of fresh-frozen
plasma, cryoprecipitate, and platelets. JAMA
1994; 271:777–781
130. Canadian Medical Association Expert Working Group: Guidelines for red blood cell and
plasma transfusion for adults and children.
Can Med Assoc J 1997; 156:S1–S24
131. American Society of Anaesthesiologists
Task Force on Blood Component Therapy:
Practice guidelines for blood component
therapy. Anesthesiology 1996; 84:732–747
132. Abdel-Wahab OI, Healy B, Dzik WH: Effect
of fresh-frozen plasma transfusion on prothrombin time and bleeding in patients
with mild coagulation abnormalities.
Transfusion 2006; 46:1279 –1285
133. Warren BL, Eid A, Singer P, et al: High-dose
antithrombin III in severe sepsis: A randomized controlled trial. JAMA 2001; 286:
1869 –1878
134. Wiedermann CJ, Hoffmann JN, Juers M, et
al: High-dose antithrombin III in the treatment of severe sepsis in patients with a high
risk of death: Efficacy and safety. Crit Care
Med 2006; 34:285–292
135. The Acute Respiratory Distress Syndrome
Network: Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute lung injury and the acute
respiratory distress syndrome. N Engl J Med
2000; 342:1301–1308
136. Amato MBP, Barbas CS, Medeiros DM, et al:
Effect of a protective-ventilation strategy on
mortality in the acute respiratory distress
syndrome. N Engl J Med 1998; 338:347–354
137. Brochard L, Roudot-Thoraval F, Roupie E,
et al: Tidal volume reduction for prevention
of ventilator-induced lung injury in acute
respiratory distress syndrome. Am J Respir
Crit Care Med 1998; 158:1831–1838
138. Brower RG, Fessler HE, Shade DM, et al:
Prospective, randomized, controlled clinical
trial comparing traditional versus reduced
tidal volume ventilation in acute respiratory
distress syndrome patients. Crit Care Med
1999; 27:1492–1498
139. Stewart TE, Meade MO, Cook DJ, et al:
Evaluation of a ventilation strategy to prevent barotrauma in patients at high risk for
acute respiratory distress syndrome. N Engl
J Med 1998; 338:355–361
140. Eichacker PQ, Gerstenberger EP, Banks
SM, et al: Meta-analysis of acute lung injury
and acute respiratory distress syndrome tri-
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
152.
153.
154.
als testing low tidal volumes. Am J Respir
Crit Care Med 2002; 166:1510 –1514
Tobin MJ: Culmination of an era in research
on the acute respiratory distress syndrome.
N Engl J Med 2000; 342:1360 –1361
Marini JJ, Gattinoni L: Ventilatory management of acute respiratory distress syndrome: A consensus of two. Crit Care Med
2004; 32:250 –255
Hager DN, Krishnan JA, Hayden DL, et al:
Tidal volume reduction in patients with
acute lung injury when plateau pressures
are not high. Am J Respir Crit Care Med
2005; 172:1241–1245
Ferguson ND, Frutos-Vivar F, Esteban A et
al: Airway pressures, tidal volumes, and
mortality in patients with acute respiratory
distress syndrome Crit Care Med 2005; 33:
21–30
Hickling KG, Henderson S, Jackson R: Low
mortality rate in adult respiratory distress
syndrome using low-volume, pressurelimited ventilation with permissive hypercapnia: A prospective study. Crit Care Med
1994; 22:1568 –1578
Bidani A, Tzouanakis AE, Cardenas VJ, et al:
Permissive hypercapnia in acute respiratory
failure. JAMA 1994; 272:957–962
Kallet RH, Jasmer RM, Luce JM, et al: The
treatment of acidosis in acute lung injury
with THAM. Am J Respir Crit Care Med
2000; 161:1149 –1153
Weber T, Tschernich H, Sitzwohl C, et al:
Tromethamine buffer modifies the depressant effect of permissive hypercapnia on
myocardial contractility in patients with
acute respiratory distress syndrome. Am J
Respir Crit Care Med 2000; 162:1361–1365
Marini JJ, Ravenscraft SA: Mean airway
pressure: Physiologic determinants and
clinical importance—Part I: Physiologic determinants and measurements. Crit Care
Med 1992; 20:1461–1472
Gattinoni L, M.R., Caspani ML, et al: Constant mean airway pressure with different
patterns of positive pressure breathing during the adult respiratory distress syndrome.
Bull Eur Physiopathol Respir 1985; 21:
275–279
Pesenti A, Marcolin R, Prato P, et al: Mean
airway pressure vs. positive end-expiratory
pressure during mechanical ventilation.
Crit Care Med 1985; 13:34 –37
The National Heart, Lung, and Blood Institute ARDS Clinical Trials Network: Higher
versus lower positive end-expiratory pressures in patients with the acute respiratory
distress syndrome. N Engl J Med 2004; 351:
327–336
Villar J, Kacmarek RM, Pérez-Méndez L, et
al, for the ARIES Network: A high PEEP-low
tidal volume ventilatory strategy improves
outcome in persistent ARDS: A randomized
controlled trial. Crit Care Med 2006; 34:
1311–1318
Amato MB, Barbas CS, Medeiros DM, et al:
Beneficial effects of the “open lung approach” with low distending pressures in
Crit Care Med 2008 Vol. 36, No. 1
155.
156.
157.
158.
159.
160.
161.
162.
163.
164.
165.
166.
167.
acute respiratory distress syndrome: A prospective randomized study on mechanical
ventilation. Am J Respir Crit Care Med
1995; 152:1835–1846
Gattinoni L, Caironi P, Cressoni M, et al:
Lung recruitment in patients with acute
respiratory distress syndrome. N Engl J Med
2006; 354:1775–1786
Stocker R, Neff T, Stein S, et al: Prone
positioning and low-volume pressurelimited ventilation improve survival in patients with severe ARDS. Chest 1997; 111:
1008 –1017
Lamm WJ, Graham MM, Albert RK: Mechanism by which prone position improves
oxygenation in acute lung injury. Am J Respir Crit Care Med 1994; 150:184 –193
Jolliet P, Bulpa P, Chevrolet JC: Effects of
the prone position on gas exchange and
hemodynamics in severe acute respiratory
distress syndrome. Crit Care Med 1998; 26:
1977–1985
Gattinoni L, Tognoni G, Pesenti A, et al:
Effect of prone positioning on the survival
of patients with acute respiratory failure.
N Engl J Med 2001; 345:568 –573
Guerin C, Gaillard S, Lemasson S, et al:
Effects of systematic prone positioning in
hypoxemic acute respiratory failure: A randomized controlled trial. JAMA 2004; 292:
2379 –2387
Mancebo J, Fernandez R, Blanch L, et al: A
multicenter trial of prolonged prone ventilation in severe acute respiratory distress
syndrome. Am J Respir Crit Care Med 2006;
173:1233–1239
Antonelli M, Conti G, Rocco M, et al: A
comparison of noninvasive positive-pressure ventilation and conventional mechanical ventilation in patients with acute respiratory failure. N Engl J Med 1998; 339:
429 – 435
Drakulovic MB, Torres A, Bauer TT, et al:
Supine body position as a risk factor for
nosocomial pneumonia in mechanically
ventilated patients: A randomised trial. Lancet 1999; 354:1851–1858
van Nieuwenhoven CA, VandenbrouckeGrauls C, van Tiel FH, et al: Feasibility and
effects of the semirecumbent position to
prevent ventilator-associated pneumonia: A
randomized study. Crit Care Med 2006; 34:
396 – 402
Ferrer M, Esquinas A, Leon M, et al: Noninvasive ventilation in severe hypoxemic respiratory failure: A randomized clinical trial
Am J Respir Crit Care Med 2003; 168:
1438 –1444
Ely EW, Baker AM, Dunagan DP, et al: Effect on the duration of mechanical ventilation of identifying patients capable of
breathing spontaneously. N Engl J Med
1996; 335:1864 –1869
Esteban A, Alia I, Tobin MJ, et al: Effect of
spontaneous breathing trial duration on
outcome of attempts to discontinue mechanical ventilation. Am J Respir Crit Care
Med 1999; 159:512–518
Crit Care Med 2008 Vol. 36, No. 1
168. Esteban A, Alia I, Gordo F, et al: Extubation
outcome after spontaneous breathing trials
with T-tube or pressure support ventilation.
Am J Respir Crit Care Med 1997; 156:
459 – 465
169. Brochard L, Rauss A, Benito S, et al: Comparison of three methods of gradual withdrawal from ventilatory support during
weaning from mechanical ventilation. Am J
Respir Crit Care Med 1994; 150:896 –903
170. Connors AF Jr, McCaffree DR, Gray BA:
Evaluation of right-heart catheterization in
the critically ill patient without acute myocardial infarction. N Engl J Med 1983; 308:
263–267
171. Iberti TJ, Fischer EP, Leibowitz AB, et al: A
multicenter study of physicians’ knowledge
of the pulmonary artery catheter: Pulmonary artery catheter study group. JAMA
1990; 264:2928 –2932
172. Al-Kharrat T, Zarich S, Amoateng-Adjepong
Y, et al: Analysis of observer variability in
measurement of pulmonary artery occlusion pressures. Am J Respir Crit Care Med
1999; 160:415– 420
173. Osman D, Ridel C, Ray P, et al: Cardiac
filling pressures are not appropriate to predict hemodynamic response to volume
challenge. Crit Care Med 2007; 35:64 – 68
174. Gattinoni L, Brazzi L, Pelosi P, et al: A trial
of goal-oriented hemodynamic therapy in
critically ill patients: SvO2 collaborative
group. N Engl J Med 1995; 333:1025–1032
175. Richard C, Warszawski J, Anguel N, et al:
Early use of the pulmonary artery catheter
and outcomes in patients with shock and
acute respiratory distress syndrome: A randomized controlled trial. JAMA 2003; 290:
2713–2720
176. Wheeler AP, Bernard GR, National Heart,
Lung, and Blood Institute Acute Respiratory Distress Syndrome (ARDS) Clinical
Trials Network: Pulmonary-artery versus
central venous catheter to guide treatment
of acute lung injury. N Engl J Med 2006;
354:2213–2224
177. Sandham JD, Hull RD, Brant RF, et al: A
randomized, controlled trial of the use of
pulmonary-artery catheters in high-risk
surgical patients. N Engl J Med 2003; 348:
5–14
178. Shah MR, Hasselblad V, Stevenson LW, et
al: Impact of the pulmonary artery catheter
in critically ill patients: Meta-analysis of
randomized clinical trials. JAMA 2005; 294:
1664 –1670
179. Harvey S, Harrison DA, Singer M, et al:
Assessment of the clinical effectiveness of
pulmonary artery catheters in management
of patients in intensive care (PAC-man): A
randomised controlled trial. Lancet 2005;
366:472– 477
180. Ware LB, Matthay MA: The acute respiratory distress syndrome. N Engl J Med 2000;
342:1334 –1349
181. Sibbald WJ, Short AK, Warshawski FJ, et al:
Thermal dye measurements of extravascular lung water in critically ill patients: In-
182.
183.
184.
185.
186.
187.
188.
189.
190.
191.
192.
193.
194.
195.
196.
travascular starling forces and extravascular
lung water in the adult respiratory distress
syndrome. Chest 1985; 87:585–592
Martin GS, Mangialardi RJ, Wheeler AP, et
al: Albumin and furosemide therapy in hypoproteinemic patients with acute lung injury. Crit Care Med 2002; 30:2175–2182
Schuller D, Mitchell JP, Calandrino FS, et
al: Fluid balance during pulmonary edema:
Is fluid again a marker or a cause of poor
outcome? Chest 1991; 100:1068 –1075
Mitchell JP, Schuller D, Calandrino FS, et
al: Improved outcome based on fluid management in critically ill patients requiring
pulmonary artery catheterization. Am Rev
Respir Dis 1992; 145:990 –998
Wiedemann HP, Wheeler AP, National
Heart, Lung, and Blood Institute Acute Respiratory Distress Syndrome (ARDS) Clinical Trials Network: Comparison of two
fluid-management strategies in acute lung
injury. N Engl J Med 2006; 354:2564 –2575
Brook AD, Ahrens TS, Schaiff R, et al: Effect
of a nursing-implemented sedation protocol
on the duration of mechanical ventilation.
Crit Care Med 1999; 27:2609 –2615
Marx WH, DeMaintenon NL, Mooney KF, et
al: Cost reduction and outcome improvement in the intensive care unit. J Trauma
1999; 46:625– 629
MacLaren R, Plamondon JM, Ramay KB, et
al: A prospective evaluation of empiric versus protocol-based sedation and analgesia.
Pharmacotherapy 2000; 20:662– 672
De Jonghe B, Cook D, Appere-De-Vecchi C,
et al: Using and understanding sedation
scoring systems: A systematic review. Intensive Care Med 2000; 20:662– 672
Devlin JW, Boleski G, Mlynarek M, et al:
Motor activity assessment scale: A valid and
reliable sedation scale for use with mechanically ventilated patients in an adult surgical intensive care unit. Crit Care Med 1999;
27:1271–1275
Kollef MH, Levy NT, Ahrens TS, et al: The
use of continuous IV sedation is associated
with prolongation of mechanical ventilation. Chest 1998; 114:541–548
Kress JP, Pohlman AS, O’Connor MF, et al:
Daily interruption of sedative infusions in
critically ill patients undergoing mechanical ventilation. N Engl J Med 2000; 342:
1471–1477
Kress JP, Vinayak AG, Levitt J, et al: Daily
sedative interruption in mechanically ventilated patients at risk for coronory disease.
Crit Care Med 2007; 35:365–371
Klessing HT, Geiger HJ, Murray MJ, et al: A
national survey on the practice patterns of
anesthesiologist intensivists in the use of
muscle relaxants. Crit Care Med 1992; 20:
1341–1345
Murray MJ, Cowen J, Deblock H, et al: Clinical practice guidelines for sustained neuromuscular blockade in the critically ill
adult. Crit Care Med 2002; 30:142–156
Hansen-Flaschen JH, Brazinsky S, Basile C,
et al: The use of sedating drugs and neuro-
321
197.
198.
199.
200.
201.
202.
203.
204.
205.
206.
207.
208.
209.
210.
211.
212.
322
muscular blocking agents in patients requiring mechanical ventilation for respiratory failure. JAMA 1991; 266:2870 –2875
Freebairn RC, Derrick J, Gomersall CD, et
al: Oxygen delivery, oxygen consumption,
and gastric intramucosal pH are not improved by a computer-controlled, closedloop, vecuronium infusion in severe sepsis
and septic shock. Crit Care Medicine 1997;
25:72–77
Shapiro BA, Warren J, Egol AB, et al: Practice parameters for sustained neuromuscular blockade in the adult critically ill patient: An executive summary. Crit Care Med
1995; 23:1601–1605
Meyer KC, Prielipp RC, Grossman JE, et al:
Prolonged weakness after infusion of atracurium in tow intensive care unit patients.
Anesth Analg 1994; 78:772–774
Lacomis D, Petrella JT, Giuliani MJ: Causes
of neuromuscular weakness in the intensive
care unit: A study of ninety-two patients.
Muscle Nerve 1998; 21:610 – 617
Gooch JL, Suchyta MR, Balbierz JM, et al:
Prolonged paralysis after treatment with
neuromuscular blocking agents. Crit Care
Med 1991; 19:1125–1131
Rudis MI, Sikora CA, Angus E, et al: A
prospective randomized controlled evaluation of peripheral nerve stimulation versus
standard clinical dosing of neuromuscular
blocking agents in critically ill patients. Crit
Care Med 1997; 25:575–583
Frankel H, Jeng J, Tilly E, et al: The impact
of implementation of neuromuscular blockade monitoring standards in a surgical intensive care unit. Am Surg 1996; 62:
503–506
Strange C, Vaughan L, Franklin C, et al: comparison of train-of-four and best clinical assessment during continuous paralysis. Am J
Respir Crit Care Med 1997; 156:1556 –1561
Van den Berghe G, Wouters P, Weekers F,
et al: Intensive insulin therapy in critically
ill patients. N Engl J Med 2001; 345:
1359 –1367
Van den Berghe G, Wilmer A, Hermans G, et
al: Intensive insulin therapy in the medical
ICU. N Engl J Med 2006; 354:449 – 461
Krinsley JS: Effect of an intensive glucose
management protocol on the mortality of
critically ill adult patients. Mayo Clin Proc
2004; 79:992–1000
Finney SJ, Zekveld C, Elia A, et al: Glucose
control and mortality in critically ill patients. JAMA 2003; 290:2041–2047
Krinsley JS: Association between hyperglycemia and increased hospital mortality in a heterogeneous population of critically ill patients. Mayo Clin Proc 2003; 78:1471–1478
Egi M, Bellomo R, Stachowski E, et al: Variability in blood glucose concentrations and
short-term mortality in critically ill patients. Anesthesiology 2006; 105:233–234
Pittas AG, Siegel RD, Lau J: Insulin therapy
for critically ill hospitalized patients. Arch
Int Med 2004; 164:2005–2011
Brunkhorst FM, Kuhnt E, Engel C, et al:
213.
214.
215.
216.
217.
218.
219.
220.
221.
222.
223.
224.
225.
Intensive insulin therapy in patient with
severe sepsis and septic shock is associated
with an increased rate of hypoglycemia—
Results from a randomized multicenter
study (VISEP). Abstr. Infection 2005; 33:
19 –20
Preiser JC: Intensive glycemic control in medsurg patients (European Glucontrol trial).
Program and abstracts of the Society of Critical Care Medicine 36th Critical Care Congress, February 17–21, 2007, Orlando, FL
Current Controlled Trials: A multi-centre, open
label, randomised controlled trial of two target
ranges for glycaemic control in intensive care
unit (ICU) patients. http://controlled-trials.com/
isrctn/trial/ISRCTN04968275/0/04968275.
html. Accessed June 10, 2007
Nichols JH: Bedside testing, glucose monitoring, and diabetes management. In: Principles of Point of Care Testing. Kost GJ
(Ed). Philadelphia, Lippincott Williams &
Wilkins, 2002
Kanji S, Buffie J, Hutton B, et al: Reliability
of point-of-care testing for glucose measurement in critically ill adults. Crit Care
Med 2005; 33:2778 –2785123
Wilson M, Weinreb J, Soo Hoo GW: Intensive insulin therapy in critical care: A review of a dozen protocols. Diabetes Care
2007; 30:1005–1011
Mauritz W, Sporn P, Schindler I, et al:
Acute renal failure in abdominal infection:
Comparison of hemodialysis and continuous arteriovenous and continuous hemofiltration. Anasth Intensivther Nortfallmed
1986; 21:212–217
Bartlett RH, Mault JR, Dechert RE, et al:
Continuous arteriovenous hemofiltration:
Improved survival in surgical acute renal
failure. Surgery 1986; 100:400 – 408
Kierdorf H: Continuous versus intermittent
treatment: Clinical results in acute renal
failure. Contrib Nephrol 1991; 93:1–12
Bellomo R, Mansfield D, Rumble S, et al:
Acute renal failure in critical illness: Conventional dialysis versus continuous hemodiafiltration. Am Soc Artif Intern Organs J
1992; 38:M654 –M657
Bellomo R, Farmer M, Parkin G, et al: Severe acute renal failure: A comparison of
acute continuous hemodiafiltration and
conventional dialytic therapy. Nephron
1995; 71:59 – 64
Kruczinski K, Irvine-Bird K, Toffelmire EB,
et al: A comparison of continuous arteriovenous hemofiltration and intermittent hemodialysis in acute renal failure patients in
intensive care unit. Am Soc Artif Intern
Organs J 1993; 38:M778 –M781
Van Bommel EH, Bouvy ND, Sob KL, et al:
Acute dialytic support for the critically ill:
Intermittent hemodialysis versus continuous arteriovenous hemodiafiltration. Am J
Nephrol 1995; 15:192–200
Guerin C, Girard R, Selli JM, et al: Intermittent versus continuous renal replacement
therapy for acute renal failure in intensive
care units: Results from a multicenter pro-
226.
227.
228.
229.
230.
231.
232.
233.
234.
235.
236.
237.
238.
spective epidemiological survey. Intensive
Care Med 2002; 28:1411–1418
Kellum JA, Angus DC, Johnson JP, et al:
Continuous versus intermittent renal replacement therapy: A meta-analysis. Intensive Care Med 2002; 28:29 –37
Tonelli M, Manns B, Feller-Kopman D:
Acute renal failure in the intensive care
unit: A systematic review of the impact of
dialytic modality on mortality and renal recovery. Am J Kidney Dis 2002; 40:875– 885
Mehta RL, McDonald B, Gabbai FB, et al: A
randomized clinical trial of continuous versus intermittent dialysis for acute renal failure. Kidney Int 2001; 60:1154 –1163
Gasparovic V, Filipovic-Greie I, Merkler M,
et al: Continuous renal replacement therapy (CRRT) or intermittent hemodialysis
(IHD)—What is the procedure of choice in
critically ill patients? Ren Fail 2003; 25:
855– 862
Augustine JJ, Sandy D, Seifert TH, et al: A
randomized controlled trial comparing intermittent with continuous dialysis in patients with ARF. Am J Kidney Dis 2004;
44:1000 –1007
Uehlinger DE, Jakob SM, Ferrari P, et al:
Comparison of continuous and intermittent
renal replacement therapy for acute renal
failure. Nephrol Dial Transplant 2005; 20:
1630 –1637
Vinsonneau C, Camus C, Combes A, et al:
Continuous venovenous haemodiafiltration
versus intermittent haemodialysis for acute
renal failure in patients with multipleorgan dysfunction syndrome: A multicentre
randomised trial. Lancet 2006; 368:379 – 85
John S, Griesbach D, Baumgärtel M, et al:
Effects of continuous haemofiltration vs intermittent haemodialysis on systemic haemodynamics and splanchnic regional perfusion in septic shock patients: A prospective,
randomized clinical trial. Nephrol Dial
Transplant 2001; 16:320 –327
Misset B, Timsit JF, Chevret S, et al: A
randomized cross-over comparison of the
hemodynamic response to intermittent hemodialysis and continuous hemofiltration
in ICU patients with acute renal failure.
Intensive Care Med 1996; 22:742–746
Ronco C, Bellomo R, Homel P, et al: Effects
of different doses in continuous venovenous haemofiltration on outcomes of
acute renal failure: A prospective randomised trial. Lancet 2000; 356:26 –30
Bouman CS, Oudemans-Van Straaten HM,
Tijssen JG, et al: Effects of early highvolume continuous venovenous hemofiltration on survival and recovery of renal function in intensive care patients with acute
renal failure: A prospective, randomized
trial. Crit Care Med 2002; 30:2205–2211
Schiffl H, Lang SM, Fischer R: Daily hemodialysis and the outcome of acute renal failure. N Engl J Med 2002; 346:305–310
Saudan P, Niederberger M, De Seigneux S,
et al: Adding a dialysis dose to continuous
hemofiltration increases survival in patients
Crit Care Med 2008 Vol. 36, No. 1
239.
240.
241.
242.
243.
244.
245.
246.
247.
248.
249.
250.
251.
252.
253.
with acute renal failure. Kidney Int 2006;
70:1312–1317
Cooper DJ, Walley KR, Wiggs BR, et al:
Bicarbonate does not improve hemodynamics in critically ill patients who have lactic
acidosis: A prospective, controlled clinical
study. Ann Intern Med 1990; 112:492– 498
Mathieu D, Neviere R, Billard V, et al: Effects of bicarbonate therapy on hemodynamics and tissue oxygenation in patients
with lactic acidosis: A prospective, controlled clinical study. Crit Care Med 1991;
19:1352–1356
Cade JF: High risk of the critically ill for
venous thromboembolism. Crit Care Med
1982; 10:448 – 450
Halkin H, Goldberg J, Modal M, et al: Reduction in mortality in general medical inpatients by low-dose heparin prophylaxis.
Ann Intern Med 1982; 96:561–565
Pingleton SK, Bone RC, Pingleton WW, et
al: Prevention of pulmonary emboli in a
respiratory intensive care unit. Chest 1981;
79:647– 650
Belch JJ, Lowe DO, Ward AG, et al: Prevention of deep vein thrombosis in medical
patients by low-dose heparin. Scott Med J
1981; 26:115–117
Gardlund B: Randomized, controlled trial of
low-dose heparin for prevention of fatal pulmonary embolism in patients with infectious diseases: The Heparin Prophylaxis
Study Group. Lancet 1996; 347:1357–1361
Samama MM, Cohen AT, Darmon JY, et al:
A comparison of enoxaparin with placebo
for the prevention of venous thromboembolism in acutely ill medical patient. N Engl
J Med 1999; 341:793– 800
Dahan R, Houlbert D, Caulin C, et al: Prevention of deep vein thrombosis in elderly
medical in-patients by a low molecular
weight heparin: A randomized double-blind
trial. Haemostasis 1986; 16:159 –164
Hirsch DR, Ingenito EP, Goldhaber SZ:
Prevalence of deep venous thrombosis
among patients in medical intensive care.
JAMA 1995; 274:335–337
Fraisse F, Holzapfel L, Couland JM, et al:
Nadroparin in the prevention of deep vein
thrombosis in acute decompensated COPD:
The Association of Non-University Affiliated
Intensive Care Specialist Physicians of
France. Am J Respir Crit Care Med 2000;
161:1109 –1114
Kupfer Y, Anwar J, Seneviratne C, et al:
Prophylaxis with subcutaneous heparin significantly reduces the incidence of deep venous thrombophlebitis in the critically ill.
Abstr. Am J Crit Care Med 1999; 159(Suppl):A519
Geerts W, Cook D, Shelby R, et al: Venous
thromboembolism and its prevention in
critical care. J Crit Care 2002; 17:95–104
Attia J, Ray JG, Cook DJ, et al: Deep vein
thrombosis and its prevention in critically
ill adults. Arch Intern Med 2001; 161:
1268 –1279
King CS, Holley AB, Jackson JF, et al: Twice
Crit Care Med 2008 Vol. 36, No. 1
254.
255.
256.
257.
258.
259.
260.
261.
262.
263.
264.
265.
266.
vs three times daily heparin dosing for
thromboembolism prophylaxis in the general medical population: A metaanalysis.
Chest 2007; 131:507–516
Vanek VW: Meta-analysis of effectiveness of
intermittent pneumatic compression devices with a comparison of thigh-high to
knee-high sleeves. Am Surg 1998; 64:
1050 –1058
Turpie AG, Hirsh J, Gent M, et al: Prevention of deep vein thrombosis in potential
neurosurgical patients: A randomized trial
comparing graduated compression stockings alone or graduated compression stockings plus intermittent pneumatic compression with control. Arch Intern Med 1989;
149:679 – 681
Agu O, Hamilton G, Baker D: Graduated
compression stocking in the prevention of
venous thromboembolism. Br J Surg 1999;
86:992–1004
German Hip Arthroplasty Trial Group
(GHAT): Prevention of deep vein thrombosis with low molecular-weight heparin in
patients undergoing total hip replacement:
A randomized trial. Arch Orthop Trauma
Surg 1992; 111:110 –120
Colwell CW, Spiro TE, Trowbridge AA, et al:
Use of enoxaparin, a low-molecular-weightheparin, and unfractionated heparin for the
prevention of deep venous thrombosis after
elective hip replacement: A clinical trial
comparing efficacy and safety. J Bone Joint
Surg Am 1994; 76:3–14
Geerts WH, Jay RM, Code KI, et al: A comparison of low-dose heparin with lowmolecular-weight heparin as prophylaxis
against venous thromboembolism after major trauma. N Engl J Med 1996; 335:
701–707
Basso N, Bagarani M, Materia A, et al: Cimetidine and antacid prophylaxis of acute
upper gastrointestinal bleeding in high risk
patients. Am J Surg 1981; 141:339 –342
Bresalier RS, Grendell JH, Cello JP, et al:
Sucralfate versus titrated antacid for the
prevention of acute stress-related gastrointestinal hemorrhage in critically ill patients. Am J Med 1987; 83:110 –116
Poleski MH, Spanier AH: Cimetidine versus
antacids in the prevention of stress erosions
in critically ill patients. Am J Gastroenterol
1986; 81:107–111
Stothert JC, Simonowitz DA, Dellinger EP,
et al: Randomized prospective evaluation of
cimetidine and antacid control of gastric pH
in the critically ill. Ann Surg 1980; 192:
169 –174
Cook DJ, Fuller HD, Guyatt GH, et al: Risk
factors for gastrointestinal bleeding in critically ill patients. N Engl J Med 1994; 330:
377–381
Schuster DP, Rowley H, Feinstein S, et al:
Prospective evaluation of the risk of upper
gastrointestinal bleeding after admission to
a medical intensive care unit. Am J Med
1984; 76:623– 629
Misra UK, Kalita J, Pandey S, et al: A ran-
267.
268.
269.
270.
271.
272.
273.
274.
275.
276.
277.
278.
279.
280.
domized placebo controlled trial of ranitidine versus sucralfate in patients with spontaneous intracerebral hemorrhage for
prevention of gastric hemorrhage. J Neurol
Sci 2005; 239:5–10
Friedman CJ, Oblinger MJ, Suratt PM, et al:
Prophylaxis of upper gastrointestinal hemorrhage in patients requiring mechanical
ventilation. Crit Care Med 1982; 10:
316 –319
Hastings PR, Skillman JJ, Bushnell LS, et al:
Antacid titration in the prevention of acute
gastrointestinal bleeding: A controlled, randomized trial in 100 critically ill patients.
N Engl J Med 1978; 298:1041–1045
Cook DJ, Witt LG, Cook RJ, et al: Stress
ulcer prophylaxis in the critically ill: A
meta-analysis. Am J Med 1991; 91:519 –257
Kahn JM, Doctor JN, Rubenfeld GD: Stress
ulcer prophylaxis in mechanically ventilated patients: Integrating evidence and
judgment using a decision analysis. Intensive Care Med 2006; 32:1151–1158
Cook D, Guyatt G, Marshall J, et al: A comparison of sucralfate and ranitidine for the
prevention of upper gastrointestinal bleeding in patients requiring mechanical ventilation. N Engl J Med 1998; 338:791–797
Cook DJ, Reeve BK, Guyatt GH, et al: Stress
ulcer prophylaxis in critically ill patients:
Resolving discordant meta-analyses. JAMA
1996; 275:308 –314
Levy MJ, Seelig CB, Robinson NJ, et al:
Comparison of omeprazole and ranitidine
for stress ulcer prophylaxis. Dig Dis Sci
1997; 42:1255–1299
Conrad SA, Gabrielli A, Margolis B, et al:
Randomized, double-blind comparison of
immediate-release omeprazole oral suspension versus intravenous cimetidine for the
prevention of upper gastrointestinal bleeding in critically ill patients. Crit Care Med
2005; 33:760 –765
Vandenbroucke-Grauls CMJ, Vandenbroucke JP: Effect of selective decontamination
of the digestive tract on respiratory tract
infections and mortality in the intensive
care unit. Lancet 1991; 338:859 – 862
Selective Decontamination of the Digestive
Tract Trialists’ Collaborative Group: Metaanalysis of randomised controlled trials of
selective decontamination of the digestive
tract. BMJ 1993; 307:525–532
Kollef M: The role of selective digestive
tract decontamination on mortality and respiratory tract infections: A meta-analysis.
Chest 1994; 105:1101–1108
Heyland DK, Cook DJ, Jaeschke R, et al:
Selective decontamination of the digestive
tract: An overview. Chest 1994; 105:
1221–1229
Hurley JC: Prophylaxis with enteral antibiotics in ventilated patients: Selective decontamination or selective cross-infection? Antimicrob Agents Chemother 1995; 39:
941–947
D’Amico R, Pifferi S, Leonetti C, et al: Effectiveness of antibiotic prophylaxis in crit-
323
281.
282.
283.
284.
285.
286.
287.
288.
289.
290.
291.
292.
293.
324
ically ill adult patients: Systematic review of
randomised controlled trials. BMJ 1998;
316:1275–1285
Nathens AB, Marshall JC: Selective decontamination of the digestive tract in surgical
patients: A systematic review of the evidence. Arch Surg 1999; 134:170 –176
Redman R, Ludington E, Crocker M, et al:
Analysis of respiratory and non-respiratory
infections in published trials of selective
digestive decontamination. Abstr. Intensive
Care Med 2001; 27(Suppl 1):S128
Safdar N, Said A, Lucey MR: The role of
selective digestive decontamination for reducing infection in patients undergoing
liver transplantation: A systematic review
and meta-analysis. Liver Transpl 2004; 10:
817– 827
Liberati A, D’Amico R, Pifferi S, et al: Antibiotic prophylaxis to reduce respiratory
tract infections and mortality in adults receiving intensive care (Cochrane Review).
In: The Cochrane Library. Issue 1. Chichester, UK: Wiley, 2004
Silvestri L, van Saene HKF, Milanese M, et
al: Impact of selective decontamination of
the digestive tract on fungal carriage and
infection: Systematic review of randomised
controlled trials. Intensive Care Med 2005;
31:898 –910
Silvestri L, Milanese M, Durì D, et al: Impact of SDD on bloodstream infections: A
systematic review of randomized trials. Abstr. Intensive Care Med 2005; 31(Suppl 1):
S87
Hammond JMJ, Potgieter PD: Is there a role
for selective decontamination of the digestive tract in primarily infected patients in
the ICU? Anaesth Intensive Care 1995; 23:
168 –174
De Jonge E, Schultz M, Spanjaard L, et al:
Selective decontamination of digestive tract
in intensive care. Lancet 2003; 362:
2119 –2120
De Jonge E, Schultz MJ, Spanjaard L, et al:
Effects of selective decontamination of the
digestive tract on mortality and acquisition
of resistance bacteria on intensive care: A
randomised controlled trial. Lancet 2003;
362:1011–1016
Hammond JM, Potgieter PD, Saunders GL,
et al: Double blind study of selective decontamination of the digestive tract in intensive care. Lancet 1992; 340:5–9
de la Cal MA, Cerda E, van Saene HKF, et al:
Effectiveness and safety of enteral vancomycin to control endemicity of methicillinresistant Staphylococcus aureus in a medical/surgical intensive care unit. J Hosp
Infect 2004; 56:175–183
Silvestri L, van Saene HKF, Milanese M, et
al: Prevention of MRSA pneumonia by oral
vancomycin decontamination: A randomised trial. Eur Respir J 2004; 23:921–926
Cerda E, Abella A, de la Cal MA, et al: Enteral vancomycin controls methicillinresistant Staphylococcus aureus endemicity
in an intensive care burn unit: A 9-year
294.
295.
296.
297.
298.
299.
300.
301.
302.
303.
304.
305.
306.
307.
308.
prospective study. Ann Surg 2007; 245:
397– 407
Curtis JR: Interventions to improve care
during withdrawal of life-sustaining treatments. J Palliat Med 2005; 8(Suppl 1):
S116 –S131
Thompson BT, Cox PN, Antonelli M, et al:
Challenges in end-of-life care in the ICU:
Statement of the 5th International Consensus Conference in Critical Care: Brussels,
Belgium, April 2003: Executive summary.
Crit Care Med 2004; 32:1781–1784
Heyland DK, Tranmer J, O’Callaghan CJ, et
al: The seriously ill patient: Preferred role in
end of life decision making. J Crit Care
2003; 18:3–10
Curtis JR, Engelberg RA, Wenrich MD, et al:
Missed opportunities during family conferences about end-of-life care in the intensive
care unit. Am J Respir Crit Care Med 2005;
171:844 – 849
Watson RS, Carcillo JA, Linde-Zwirble WT,
et al: The epidemiology of severe sepsis in
children in the United States. Am J Respir
Crit Care Med 2003; 167:695–701
Goldstein B, Giroir B, Randolph A: International pediatric sepsis consensus conference: Definitions for sepsis and organ dysfunction in pediatrics. Pediatr Crit Care
Med 2005; 6:2– 8
Pollard AJ, Britto J, Nadel S, et al: Emergency management of meningococcal disease. Arch Dis Child 1999; 80:290 –296
den Brinker M, Joosten KFM, Lime O, et al:
Adrenal insufficiency in meningococcal sepsis: Bioavailable cortisol levels and impact
of interleukin-6 levels and intubation with
etomidate on adrenal function and mortality. Clin Endocrinol Metab 2005; 90:
5110 –5117
Kanter RK, Zimmerman JJ, Strauss RH, et
al: Pediatric emergency intravenous access:
Evaluation of a protocol. Am J Dis Child
1986; 140:132–134
Ngo NT, Cao XT, Kneen R, et al: Acute
management of dengue shock syndrome: A
randomized double-blind comparison of 4
intravenous fluid regimens in the first
hour. Clin Infect Dis 2001; 32:204 –213
Carcillo JA, Davis AL, Zaritsky A: Role of
early fluid resuscitation in pediatric septic
shock. JAMA 1991; 266:1242–1245
Han YY, Carcillo JA, Dragotta MA, et al:
Early reversal of pediatric-neonatal septic
shock by community physicians is associated with improved outcome. Pediatrics
2003; 112:793–799
Ranjit S, Kissoon N, Jayakumar I: Aggressive management of dengue shock syndrome may decrease mortality rate: A suggested protocol. Pediatr Crit Care Med
2005; 6:412– 419
Willis BA, Dung NM, Loan HT, et al: Comparison of three fluid solutions for resuscitation in dengue shock syndrome. N Engl
J Med 2005; 353:877– 889
Dung NM, Day NP, Tam DT, et al: Fluid
replacement in dengue shock syndrome: A
309.
310.
311.
312.
313.
314.
315.
316.
317.
318.
319.
320.
321.
322.
randomized, double-blind comparison of
four intravenous-fluid regimens. Clin Infect
Dis 1999; 29:787–794
Ceneviva G, Paschall JA, Maffei F, et al:
Hemodynamic support in fluid-refractory
pediatric septic shock. Pediatrics 1998; 102:
e19
Keeley SR, Bohn DJ: The use of inotropic
and afterload-reducing agents in neonates.
Clin Perinatol 1988; 15:467– 489
Barton P, Garcia J, Kouatli A, et al: Hemodynamic effects of i.v. milrinone lactate in
pediatric patients with septic shock: A prospective, double-blinded, randomized, placebo-controlled, interventional study. Chest
1996; 109:1302–1312
Lindsay CA, Barton P, Lawless S, et al: Pharmacokinetics and pharmacodynamics of
milrinone lactate in pediatric patients with
septic shock. J Pediatr 1998; 132:329 –334
Irazuzta JE, Pretzlaff RK, Rowin ME: Amrinone in pediatric refractory septic shock:
An open-label pharmacodynamic study. Pediatr Crit Care Med 2001; 2:24 –28
Powell KR, Sugarman LI, Eskenazi AE, et al:
Normalization of plasma arginine vasopressin
concentrations when children with meningitis are given maintenance plus replacement
fluid therapy. J Pediatr 1991; 117:515–522
Masutani S, Senzaki H, Ishido H, et al:
Vasopressin in the treatment of vasodilatory
shock in children. Pediatr Int 2005; 47:
132–136
Booy R, Habibi P, Nadel S, et al: Reduction
in case fatality rate from meningococcal
disease associated with improved healthcare
delivery. Arch Dis Child 2001; 85:386 –390
Carcillo JA, Fields AI, American College of
Critical Care Medicine Task Force Committee Members: Clinical practice parameters
for hemodynamic support of pediatric and
neonatal patients in septic shock. Crit Care
Med 2002; 30:1365–1378
Pizarro CF, Troster EJ, Damiani D, et al:
Absolute and relative adrenal insufficiency
in children with septic shock. Crit Care Med
2005; 33:855– 859
Riordan FA, Thomson AP, Ratcliffe JM, et al:
Admission cortisol and adrenocorticotrophic hormone levels in children with meningococcal disease: Evidence of adrenal insufficiency? Crit Care Med 1999; 27:
2257–2261
De Kleijn ED, Joosten KF, Van Rijn B, et al:
Low serum cortisol in combination with
high adrenocorticotrophic hormone concentrations is associated with poor outcome
in children with severe meningococcal disease. Pediatr Infect Dis J 2002; 21:330 –336
Markovitz BP, Goodman DM, Watson S, et al:
A retrospective cohort study of prognostic factors associated with outcome in pediatric severe sepsis: What is the role of steroids? Pediatr Crit Care Med 2005; 6:270 –274
Hazelzet JA, de Kleijn ED, de Groot R: Endothelial protein C activation in meningococcal sepsis. N Engl J Med 2001; 345:
1776 –1777
Crit Care Med 2008 Vol. 36, No. 1
323. de Kleijn ED, de Groot R, Hack CE, et al:
Activation of protein C following infusion of
protein C concentrate in children with severe meningococcal sepsis and purpura fulminans: A randomized, double-blinded, placebo-controlled, dose-finding study. Crit
Care Med 2003; 31:1839 –1847
324. Nadel S, Goldstein B, Williams MD, et al:
Drotrecogin alfa (activated) in children with
severe sepsis: A multicentre phase III randomized controlled trial. Lancet 2007; 369:
836 – 843
325. Krafte-Jacobs B, Sivit CJ, Mejia R, et al:
Catheter-related thrombosis in critically ill
children: Comparison of catheters with and
without heparin bonding. J Pediatr 1995;
126:50 –54
326. Pierce CM, Wade A, Mok Q: Heparin-bonded
central venous lines reduce thrombotic and
infective complications in critically ill children. Intensive Care Med 2000; 26:967–972
327. Chaïbou M, Tucci M, Dugas MA, et al: Clinically significant upper gastrointestinal
bleeding acquired in a pediatric intensive
care unit: A prospective study. Pediatrics
1998; 102:933–938
328. Gauvin F, Dugas M, Chaïbou M, et al: The
impact of clinically significant upper gastrointestinal bleeding in a pediatric intensive care unit. Pediatr Crit Care Med 2001;
2:294 –298
329. Foland JA, Fortenberry JD, Warshaw BL, et
al: Fluid overload before continuous hemofiltration and survival in critically ill children: A retrospective analysis. Crit Care
Med 2004; 32:1771–1776
330. Branco RG, Garcia PC, Piva JP, et al: Glucose level and risk of mortality in pediatric
septic shock. Pediatr Crit Care Med 2005;
6:470 – 472
331. Faustino EV, Apkon M: Persistent hyperglycemia in critically ill children. J Pediatr
2005; 146:30 –34
332. Cam PC, Cardone D: Propofol infusion syndrome. Anaesthesia 2007; 62:690 –701
333. Parke TJ, Stevens JE, Rice AS, et al: Metabolic acidosis and fatal myocardial failure
after propofol infusion in children: Five
case reports. BMJ 1992; 305:613– 616
334. Lacroix J, Hebert PC, Hutchison JS, et al:
Transfusion strategies for patients in pediatric intensive care units. N Engl J Med
2007; 256:1609 –1619
335. El-Nawawy A, El-Kinany H, Hamdy ElSayed M, et al: Intravenous polyclonal immunoglobulin administration to sepsis syndrome patients: A prospective study in a
pediatric intensive care unit. J Trop Pediatr
2005; 51:271–278
336. Meyer DM, Jessen ME: Results of extracorporeal membrane oxygenation in children
with sepsis: The Extracorporeal Life Support Organization. Ann Thorac Surg 1997;
63:756 –761
337. Goldman AP, Kerr SJ, Butt W, et al: Extracorporeal support for intractable cardiorespiratory failure due to meningococcal disease. Lancet 1997; 349:466 – 469
Crit Care Med 2008 Vol. 36, No. 1
338. Cinel I, Dellinger RP: Guidelines for severe
infections: Are they useful. Curr Opin Crit
Care 1006; 12:483– 488
339. Levy MM, Pronovost PJ, Dellinger RP, et al:
Sepsis change bundles: Converting guidelines into meaningful change in behavior
and clinical outcome. Crit Care Med 2004;
32(Suppl):S595–S597
340. Meduri GU, Golden E, Freire AX, et al:
Methylprednisolone infusion in early severe
ARDS: Results of a randomized controlled
trial. Chest 2007; 131:1954 –1963
341. The National Heart, Lung, and Book Institute Acute Respiratory Distress Syndrome
(ARDS) Clinical Trials Network: Efficacy
and safety of corticosteroids for persistent
acute respiratory distress syndrome. N Engl
J Med 2006; 354:1671–1684
APPENDIX A
Source Control
Source Control
Technique
Drainage
Debridement
Device removal
Definitive control
Examples
Intra-abdominal abscess
Thoracic empyema
Septic arthritis
Pyelonephritis, cholangitis
Infected pancreatic
necrosis
Intestinal infarction
Mediastinitis
Infected vascular catheter
Urinary catheter
Infected intrauterine
contraceptive device
Sigmoid resection for
diverticulitis
Cholecystectomy for
gangrenous
cholecystitis
Amputation for clostridial
myonecrosis
APPENDIX B
a single recommendation suggested to
some that this approach might lead to
excessive use of steroids and increased
incidence of superinfections, citing the
sepsis and septic shock adverse events in
the steroid-treated patients in the
CORTICUS trial. Those who argued for
one recommendation pointed to problems with two different recommendations that would require the bedside clinician to choose a time point for
classification of one or the other as well
as a distinct blood pressure cutoff with
the potential for the blood pressure to
vary over time. In addition, there are inadequate data to provide standardization
of how much fluids and vasopressors
should be in place to call the blood pressure unresponsive or poorly responsive.
These members also pointed to the fact
that the increased superinfection/sepsis/
septic shock adverse events in CORTICUS
are contrary to the results of other stressdose steroid trials, such as early ARDS
(lower incidence of infections) (341), late
ARDS (decreased development of septic
shock), and community-acquired pneumonia (decreased development of septic
shock) (114). Based on GRADE adjudication guidelines, a secret ballot vote was
conducted to resolve the issue.
The two options put to vote were:
Two-Recommendation Option
1. We suggest that intravenous hydrocortisone be given to adult septic
shock patients if blood pressure is inadequate with appropriate fluid resuscitation and vasopressor therapy
(grade 2B).
2. We suggest intravenous hydrocortisone not be given to adult septic shock
patients if blood pressure is adequate
with appropriate fluid resuscitation
and vasopressor therapy (grade 2B).
Steroids
Considerable difference of opinion existed among committee members as to
the best option for the style of the recommendations for steroid use in septic
shock. Some committee members argued
for two recommendations and pointed to
the two distinct patient populations of
the French Trial (enrollment early in septic shock and blood pressure unresponsive to vasopressors) and the CORTICUS
trial (enrollment allowed up to 72 hrs and
did not target patients with blood pressure unresponsive to vasopressin), leading to two distinct results. Furthermore,
One-Recommendation Option
1. We suggest that intravenous hydrocortisone be given only to adult septic
shock patients with blood pressure
poorly responsive to fluid resuscitation
and vasopressor therapy (grade 2C).
The committee vote that determined
the current recommendation was:
Favor two-recommendation option—19
Favor one-recommendation option—31
Abstain—1
325
APPENDIX C
Contraindications to Use of
Recombinant Human Activated
Protein C (rhAPC)
rhAPC increases the risk of bleeding
and is contraindicated in patients with
the following clinical situations in which
bleeding could be associated with a high
risk of death or significant morbidity:
Active internal bleeding
Recent (within 3 months) hemorrhagic stroke
Recent (within 2 months) intracranial or intraspinal surgery, or severe
head trauma
Trauma with an increased risk of lifethreatening bleeding
Presence of an epidural catheter
Intracranial neoplasm or mass lesion
or evidence of cerebral herniation
Known hypersensitivity to rhAPC or
any component of the product
Anticipated PEEP settings at various
FIO2 requirements
FIO2 0.3, 0.4, 0.4, 0.5, 0.5, 0.6, 0.7,
0.7, 0.7, 0.8, 0.9, 0.9, 0.9, 1.0
PEEP 5, 5, 8, 8, 10, 10, 10, 12, 14, 14,
14, 16, 18, 20 –24
Predicted Body Weight Calculation
Male—50 ⫹ 2.3 (height [inches] ⫺
60) or 50 ⫹ 0.91 (height [cm] ⫺
152.4)
Female— 45.5 ⫹ 2.3 (height
[inches] ⫺ 60) or 45.5 ⫹ 0.91
(height [cm] ⫺ 152.4)
APPENDIX G
Glycemic Control Committee Vote
Glycemic control—90%
Total votes ⫽ 51
Agree—34
Too conservative, but accept— 4
Too liberal, but accept— 8
Disapprove, too conservative— 0
Disapprove, too liberal—5
Disapprove, other— 0
APPENDIX F
See labeling instructions for relative
contraindications. The committee recommends that platelet count be maintained at ⱖ30,000 during infusion of
rhAPC. (Physicians’ Desk Reference, 61st
Edition. Montvale, NJ, Thompson PDR,
2007, p 1829).
APPENDIX D
Recombinant Activated Protein
C Nominal Group Vote
Strong for use, 6
Weak for use, 15
Neutral, 1
Weak for not using, 0
Strong for not using, 0
APPENDIX E
ARDSNet Ventilator
Management
Assist control mode—volume ventilation (96)
Reduce tidal volume to 6 mL/kg lean
body weight
Keep inspiratory plateau pressure
(Pplat) ⱕ30 cm H2O
Reduce tidal volume as low as 4 mL/kg
predicted body weight to limit Pplat
Maintain arterial oxygen saturation/
pulse oximetry oxyhemoglobin saturation (SpO2) 88% to 95%
326
Crit Care Med 2008 Vol. 36, No. 1
Appendix H. Selective Digestive Decontamination Nominal Group Vote
Antibiotics
Systemic
and oral
Systemic
alone
Strong
for Use
Weak
for Use
Neutral
Weak
for Not Using
Strong
for Not Using
—
9
4
8
1
—
2
7
5
3
APPENDIX I
2008 SSC Guidelines Committee
R. Phillip Dellinger (Chair), Tom
Ahrens,a Naoki Aikawa,b Derek Angus,
Djillali Annane, Richard Beale, Gordon R.
Bernard, Julian Bion,c Christian BrunBuisson, Thierry Calandra, Joseph Carcillo,
Jean Carlet, Terry Clemmer, Jonathan
Cohen, Edwin A. Deitch,d Jean-Francois
Dhainaut, Mitchell Fink, Satoshi Gando,b
Herwig Gerlach, Gordon Guyatt,e Maurene
Harvey, Jan Hazelzet, Hiroyuki Hirasawa,f
Steven M. Hollenberg, Michael Howell, Roman Jaeschke,e Robert Kacmarek, Didier
Keh, Mitchell M. Levy,g Jeffrey Lipman,
John J. Marini, John Marshall, Claude Martin, Henry Masur, Steven Opal, Tiffany M.
Osborn,h Giuseppe Pagliarello,i Margaret
Parker, Joseph Parrillo, Graham Ramsay,
Adrienne Randolph, Marco Ranieri, Robert
C. Read,j Konrad Reinhart,k Andrew
Rhodes, Emmanuel Rivers,h Gordon
Rubenfeld, Jonathan Sevransky, Eliezer Silva,l Charles L. Sprung, B. Taylor Thompson, Sean R. Townsend, Jeffery Vender,m
Jean-Louis Vincent,n Tobias Welte,o Janice
Zimmerman.
a
American Association of CriticalCare Nurses; bJapanese Association for
Acute Medicine; cEuropean Society of
Intensive Care Medicine; dSurgical Infection Society; eGrades of Recommendation, Assessment, Development and
Evaluation (GRADE) Group; fJapanese
Society of Intensive Care Medicine;
g
Society of Critical Care Medicine;
h
American College of Emergency Physicians; iCanadian Critical Care Society;
j
European Society of Clinical Microbiology and Infectious Diseases; kGerman Sepsis Society; lLatin American
Sepsis Institute; m American College
Crit Care Med 2008 Vol. 36, No. 1
of Chest Physicians; n International
Sepsis Forum; oEuropean Respiratory
Society.
APPENDIX J
Author Disclosure Information
2006 –2007
Dr. Dellinger has consulted for AstraZeneca, Talecris, and B Braun. He has received honoraria from Eli Lilly (2), Brahms
(2), INO Therapeutics (1), Pulsion (1), and
bioMerieux (1). He has also received grant
support from AstraZeneca and Artisan.
Dr. Levy has received honoraria from
Eli Lilly and Edwards Lifesciences. He
has also received grant support from
Philips Medical Systems, Edwards Lifesciences, Philips Medical Systems, Novartis, Biosite, and Eisai.
Dr. Carlet has consulted for Forrest,
Wyeth, Chiron, bioMerieux, and GlaxoSmithKline. He has also received honoraria from Eli Lilly, Becton Dickinson,
Jansen, Cook, AstraZeneca, Hutchinson,
Bayer, Gilead, MSD, and Targanta.
Dr. Bion has not disclosed any potential conflicts of interest.
Dr. Parker has consulted for Johnson
& Johnson.
Dr. Jaeschke has received honoraria
from AstraZeneca, Boehringer, Eli Lilly,
GlaxoSmithKline, and MSD.
Dr. Reinhart has consulted for Eli Lilly
and Edwards Lifesciences. He has also
received honoraria from B Braun and
royalties from Edwards Lifesciences.
Dr. Angus has consulted for or received speaking fees from AstraZeneca,
Brahms Diagnostica, Eisai, Eli Lilly, GlaxoSmithKline, OrthoBiotech, Takeda, and
Wyeth-Ayerst. He has also received grant
support from GlaxoSmithKline, OrthoBiotech, and Amgen.
Dr. Brun-Buisson has not disclosed
any potential conflicts of interest.
Dr. Beale has received honoraria from
Eisai and speaking fees (paid to university)
from Lilly UK, Philips, Lidco, and Chiron.
Dr. Calandra has consulted for Baxter,
received honoraria from Roche Diagnostics, and received grant support from
Baxter and Roche Diagnostics. He also
served on the advisory board for Biosite.
Dr. Dhainaut has consulted for Eli
Lilly and Novartis. He has also received
honoraria from Eli Lilly.
Dr. Gerlach has not disclosed any potential conflicts of interest.
Ms. Harvey has not disclosed any potential conflicts of interest.
Dr. Marini has consulted for KCI and
received honoraria from Maquet.
Dr. Marshall has consulted for Becton
Dickinson, Takeda, Pfizer, Spectral Diagnostics, Eisai, and Leo-Pharma. He has also received honoraria from Spectral Diagnostics.
Dr. Ranieri has served on the advisory
board for Maquet and received support
for a sponsored trial from Eli Lilly. He
has also received grant support from
Tyco, Draeger, and Hamilton.
Dr. Ramsay has consulted for Edwards
Lifesciences and Respironics.
Dr. Sevransky has not disclosed any
potential conflicts of interest.
Dr. Thompson has consulted for Eli
Lilly, Abbott, and AstraZeneca. He has also
received grant support from the NIH for a
study on computerized glucose control.
Dr. Townsend has not disclosed any
potential conflicts of interest.
Dr. Vender has consulted and received
honoraria from Eli Lilly.
Dr. Zimmerman has not disclosed any
potential conflicts of interest.
Dr. Vincent has consulted for AstraZeneca, Biosite, bioMerieux, Edwards Lifesciences, Eli Lilly, Eisai, Ferring, GlaxoSmithKline, Intercell, Merck, Novartis,
NovoNordisk, Organon, Pfizer, Philips
Medical Systems, Roche Diagnostics, Spectral Diagnostics, Takeda, and WyethLederle. He has also received honoraria
from Eli Lilly, Edwards Lifesciences, Eisai,
GlaxoSmithKline, Novartis, NovoNordisk,
and Pfizer.
327
Concise Definitive Review
Molecular biology of inflammation and sepsis: A primer*
Ismail Cinel, MD, PhD; Steven M. Opal, MD
Background: Remarkable progress has been made during the
last decade in defining the molecular mechanisms that underlie
septic shock. This rapidly expanding field is leading to new
therapeutic opportunities in the management of severe sepsis.
Aim: To provide the clinician with a timely summary of the
molecular biology of sepsis and to better understand recent
advances in sepsis research.
Data Selection: Medline search of relevant publications in
basic mechanisms of sepsis/severe sepsis/septic shock, and selected literature review of other manuscripts about the signalosome, inflammasome, apoptosis, or mechanisms of shock.
Data Synthesis and Findings: The identification of the toll-like
receptors and the associated concept of innate immunity based upon
pathogen- or damage-associated molecular pattern molecules allowed significant advances in our understanding of the pathophysiology of sepsis. The essential elements of the inflammasome and
signal transduction networks responsible for activation of the host
response have now been characterized. Apoptosis, mitochondrial
I
n sepsis, the expected and appropriate inflammatory response to an infectious process becomes amplified
leading to organ dysfunction or risk
for secondary infection. A continuum exists
from a low grade systemic response associated with a self-limited infection to a
marked systemic response with solitary or
multiorgan dysfunction, i.e., severe sepsis.
As a clinical syndrome, sepsis occurs when
an infection is associated with the systemic
inflammatory response.
The complex toll-like receptor signaling
and associated downstream regulators of
immune cell functions play a crucial role in
the innate system as a first line of defense
against pathogens (1). However, signaling
is sometimes conflicting and a sustained
inflammatory response can result in tissue
From the Division of Critical Care Medicine (IC), The
Robert Wood Johnson School of Medicine, The University
of Medicine and Dentistry of New Jersey, Camden NJ;
and The Infectious Disease Division (SMO), Memorial
Hospital of RI, The Warren Alpert School of Medicine of
Brown University, Providence, RI.
Dr. Opal has received grants from Wyeth and Eisai
Inc. Dr. Cinel has not disclosed any potential conflicts
of interest.
For information regarding this article, E-mail:
cinel-ismail@cooperhealth.edu
Copyright © 2008 by the Society of Critical Care
Medicine and Lippincott Williams & Wilkins
DOI: 10.1097/CCM.0b013e31819267fb
Crit Care Med 2009 Vol. 37, No. 1
dysfunction, sepsis-related immunosuppression, late mediators of
systemic inflammation, control mechanisms for coagulation, and
reprogramming of immune response genes all have critical roles in
the development of sepsis.
Conclusions: Many of these basic discoveries have direct implications for the clinical management of sepsis. The translation of
these “bench-to-bedside” findings into new therapeutic strategies is
already underway. This brief review provides the clinician with a
primer into the basic mechanisms responsible for the molecular
biology of sepsis, severe sepsis, and septic shock.(Crit Care Med
2009; 37:291–304)
KEY WORDS: sepsis; inflammation; toll like receptors; inflammasome; signalosome; apoptosis; neutrophils; mitochondrial dysfunction; reactive oxygen species; nitric oxide; peroxynitrite; activated protein C; a disintegrin-like and metalloproteinase with
thrombospondin type-1 motifs-13; pathogen associated molecular
patterns; danger associated molecular patterns
damage. In addition, a reduction in their
antimicrobial capacity may set the stage for
opportunistic and/or super infections (2).
Severe sepsis may also be associated with
an exaggerated procoagulant state. This
may lead to ischemic cell injury, an effect
that further amplifies the damage caused
by inappropriate inflammation. A microvasculature injured by inflammation and
ischemia, in turn, further deranges the
host response by altering leukocyte trafficking, generating apoptotic microparticles,
and increasing cellular hypoxia (3). Mitochondrial dysfunction, an acquired intrinsic defect in cellular respiration termed “cytopathic hypoxia,” also has an important
role by decreasing cellular oxygen consumption in this chaotic process. In this
review, we highlight the current understanding of the basic molecular mechanisms that modulate these events so as to
produce sepsis.
Pattern Recognition Receptors,
Pathogen-Associated Molecular
Patterns (PAMPs) and DangerAssociated Molecular Patterns
(DAMPs)
The initiation of the host response
during sepsis or tissue injury involves
three families of pattern recognition receptors (PRRs): 1) toll-like receptors
(TLRs); 2) nucleotide-oligomerization
domain leucine-rich repeat (NOD-LRR)
proteins; and 3) cytoplasmic caspase activation and recruiting domain helicases such as retinoic-acid-inducible
gene I (RIG-I)-like helicases (RLHs) (4,
5). These receptors initiate the innate
immune response and regulate the
adaptive immune response to infection
or tissue injury.
Gram-positive and Gram-negative bacteria, viruses, parasites, and fungi all possess a limited number of unique cellular
constituents not found in vertebrate animals. These elements are now referred to as
PAMPs, or more appropriately microbialassociated molecular patterns, as these
molecules are also common in nonpathogenic and commensal bacteria (6). PAMPs
bind to PRRs, such as TLRs, expressed on
the surface of host cells. Cytoplasmic PRRs
exist to detect invasive intracellular pathogens (7). The NOD proteins recognize common fragments of bacterial peptidoglycan.
Diamino-pimelate from Gram-negative
bacteria is the ligand for NOD1 and muramyl dipeptide from peptidoglycan is the
ligand for NOD2 in the cytosol (see Figs. 1
and 2). The PRRs also recognized damage
signals from the release of endogenous peptides and glycosaminoglycans from apoptotic or necrotic host cells (8 –10) Caspase
activation and recruiting domain helicases
291
(LPS)-induced mortality (15). Multiple
positive feedback loops between dangerassociated molecular patterns and
PAMPs, and their overlapping receptors
temporally and spatially drive these processes and may represent the molecular
basis for the observation that infections,
as well as nonspecific stress factors, can
trigger flares in systemic inflammatory
response. The degree to which TLR regulation mediates the ultimate outcome in
sepsis in individual patients remains elusive and is an active area of clinical investigation (13, 16).
Inflammasome and Signalosome
Pathways
Figure 1. Specific host immune response to each pathogen is mediated by various sets of pathogen
associated molecular patterns (PAMPs) and pattern recognition receptors (PRRs) as detailed in Figure
1. PRRs are essential for initiating the host’s immune defenses against invading pathogens, yet they
can also contribute to persistent and deleterious systemic inflammation. PRRs also serve as receptors
for endogenous danger signals, hemodynamic changes in sepsis (tissue hypoperfusion and ischemia/
reperfusion phenomenon), thus same signaling systems that alerts the highly advantageous, host
defense mechanisms, also contributes to the disadvantageous, pathologic events of systemic inflammation, coagulation, tissue damage in target organs in sepsis. Heat shock proteins, fibrinogen,
fibronectin, hyaluran, biglycans and high mobility group box-1 (HMGB-1) have been defined as danger
associated molecular patterns (DAMPs) which are likely relevant for sepsis. Toll-like receptors (TLRs),
especially TLR4, are involved in the recognition of these endogenous or harmful self-antigens ligands
which are released during noninfectious injury, such as trauma or ischemia/reperfusion suggesting
their function may not be restricted to the recognition of extrinsic pathogens. NOD-LRR, nucleotideoligomerization domain leucine-rich repeat; ASC, apoptosis-associated speck-like protein containing
caspase activation and recruiting domain; NF-␬␤, nuclear factor ␬␤.
Figure 2. Binding of toll-like receptors (TLRs) activates intracellular signal-transduction pathways that
lead to the activation of transcriptional activators such as interferon regulator factors, phosphoinositide 3-kinase (PI3K)/Akt, activator protein-1, and cytosolic nuclear factor-kappa ␤ (NF-␬␤). Activated
NF-␬␤ moves from the cytoplasm to the nucleus, binds to transcription sites and induces activation
of an array of genes for acute phase proteins, inducible nitric oxide synthase, coagulation factors,
proinflammatory cytokines, as well as enzymatic activation of cellular proteases. TLR9 DNA, TLR 3
dsRNA, and TLR7/8 ss RNA are endosomal. TLR 10 ligand is not defined and TLR1 forms heterodimers
with TLR2. LPS, lipopolysaccharide; IRF, interferon regulatory factor; JNK; c Jun N-terminal kinase.
primarily recognize viral nucleic acids and
activate antiviral measures including the
type I interferons.
TLR expression is significantly upregulated in experimental models of sepsis and in patients with sepsis (11–14).
Trauma including thermal injury gener292
ates danger-associated molecular patterns (i.e., high mobility group box-1,
heat shock proteins, S100 proteins, hyaluran, etc.) that augment TLR expression
like PAMPs. It also primes the innate immune system for enhanced TLR reactivity, resulting in excess lipopolysaccharide
TLRs induce pro-interleukin(IL)-1beta
production and prime NLR-containing
multiprotein complexes, termed “inflammasomes,” to respond to bacterial products and products of damaged cells (17,
19). This results in caspase-1 activation
and the subsequent processing of proIL-1␤ to its active extracellular form
IL-1␤ (19). Caspases are a set of cysteine
proteases that alter the enzymatic activity
of target proteins at specific peptide sequences adjacent to aspartate moieties.
Caspases are important in process of apoptosis, cellular regulation, and inflammation (Figs. 1 and 3). One of the many
targets of the caspase cascade is caspase
activated DNase (CAD). CAD activation
induces DNA fragmentation characteristic of programmed cell death (apoptosis).
The posttranslational activation of
caspase-1 is tightly regulated by inflammasome, the known components of
which include caspase-1, ASC (apoptosisassociated speck-like protein containing a
caspase activation and recruiting domain), NALP1 (NACHT, leucine rich repeat and pyrin domain containing 1), and
caspase-5 (20). Additionally, alternate inflammasome constructions have been
suggested to contain pyrin, NALP3, and
other members of the NOD-LRR family
(21–23). ASC facilitates inflammasome
assembly thus triggering caspase-1 activation and IL-1␤ processing. Interestingly, ASC can also regulate the nuclear
factor (NF)-␬B pathway, thus linking the
inflammasome to the signalosome
(Fig. 1) (24).
The inflammasome pathways contribute to the inflammatory response in sepsis (25). Caspase-1 knock out mice are
protected from sepsis (26) while a naturally occurring polymorphism for human
caspase-12, a putative regulator of
Crit Care Med 2009 Vol. 37, No. 1
Figure 3. Pathogenic mechanisms during sepsis or in response to tissue injury can lead to organ
dysfunction. PRRs, pattern recognition receptors; TLRs, toll-like receptors; NOD-LRR, nucleotideoligomerization domain leucine-rich repeat protein receptors; RLHs; retinoic-acid-inducible gene I
(RIG-I)-like helicases; TNF-␣, tumor necrosis factor alpha; IL-1, interleukin 1; HMGB-1, high mobility
group box-1; LPS, lipopolysaccharide; LTA, lipoteichoic acid; PGN, peptidoglycan; VSMCs, vascular
smooth muscle cells; RBC, red blood cell; MPO, myeloperoxidase; XOR, xanthine oxidoreductase;
iNOS, inducible nitric oxide synthase; COX-2, cyclooxygenase; RAGE, receptor for advanced glycation
end products; ROCK; RhoA/Rho kinase; PARP-1, poly(ADP ribose) polymerase-1; PAR, protease
activated receptor; ROS/RNS, reactive oxygen and nitrogen species; NF, nuclear factor; NADPH,
nicotimanide adenosine dinucleotide phosphate; PAMPs, pathogen-associated molecular patterns;
DAMPs, danger-associated molecular patterns.
caspase-1, has been linked to sepsis (27,
28). Thus, caspase-1 activation appears to
be a prerequisite for a competent immune response (29). Recently, the inflammasome components have been
shown to be significantly lower in septic
shock patients during the early stages of
systemic inflammatory response with elevated plasma cytokines levels (30). This
Crit Care Med 2009 Vol. 37, No. 1
monocyte deactivation process may be
maladaptive in the later phases of sepsis
and predispose to secondary infection.
Caspase-1 and its proinflammatory cytokine products are likely to contribute to
the pathogenesis of sepsis in overwhelming inflammation. However, like many
other essential elements of innate immunity, caspase-1 also has a positive impact
on host defense against several infections
up-regulating microbial killing mechanisms such as the production of reactive
oxygen and nitrogen species (ROS and
RNS) (31, 32). Negative regulation of
TLRs and TLR-induced programmed cell
death has been defined (7). Apoptosis induction is used by Pseudomonas aeruginosa to inhibit the secretion of immune
and proinflammatory mediators by target
cells (33).
MyD88 protein and IL-1 receptorassociated kinase pathways activate
NF-␬B during the innate immune response (34). NF-␬B is a transcription factor that is constituted by homo- or heterodimers of the Rel protein family with a
pivotal role in inflammation, cell survival, and proliferation. In unstimulated
cells, NF-␬B is maintained in a latent
form in the cytoplasm by means of sequestration by inhibitory ␬B (I␬B) proteins. NF-␬B activating stimuli, such as
cytokines, viruses, and lipopolysaccharide
(LPS), induce the degradation of inhibitory ␬Bs by the proteasome, unmasking
the nuclear localization signal of NF-␬B,
resulting in its nuclear translocation,
binding to NF-␬B motifs, and gene transcription. Dynamic redox control of NF␬B through glutaredoxin-regulated Sglutathionylation of inhibitory ␬Bs has
been demonstrated (35). NF-␬B, subject
to regulation by redox changes, has been
shown to be involved in the transcriptional regulation of more than 150 genes
with a significant portion demonstrating
proinflammatory properties (36). NF-␬B
is readily activated upon intraperitoneally
LPS challenge within 4 hrs in lung, liver,
and spleen (37). A variant IL-1 receptorassociated kinase ⫺1 haplotype has recently been demonstrated to affect the
magnitude of NF-␬B activation and directly correlates with an increased incidence of septic shock and significantly
reduced survival rates (38). The impact of
NF-␬B signaling is tissue-specific as deficient NF-␬B activation in intestinal epithelium is associated with increased inflammation in vivo (39, 40). Both studies
demonstrate that defects of NF-␬B signaling cause immunosuppression which
triggers and maintains inflammation.
Thus, it can be suggested that inhibition
of massive NF-␬B activation in vivo leads
to reduced inflammatory responses, at
least during certain phases and certain
tissues (i.e., parenchymal tissues) in sepsis. On the other hand, this activation is
followed by negative NF-␬B regulation
favoring apoptosis in immune cells which
293
may lead to immunosuppression and fatal
outcome in severe sepsis. Recently, using
specific gene-targeted deletions, it has
been shown that deletion of MyD88
caused a worsened survival in a model of
severe peritonitis, despite the marked decrease in sepsis-induced T and B lymphocyte apoptosis suggesting MyD88, like
NF-␬B, is also critical host survival in
sepsis (41).
Toll-Like Receptor Signaling
The Role of Phosphoinositide 3-Kinase.
Phosphoinositide 3-kinase (PI3K), a signal transduction enzyme, and the downstream serine/threonine kinase Akt (also
known as protein kinase B) have been
reported in cellular activation, inflammatory responses, chemotaxis, and apoptosis
(Figs. 2 and 3) (42). PI3K can function
either as a positive or negative regulator
of TLR signaling. PI3Ks (three types) act
at several steps downstream of TLRs, depending on the cell type and/or the engagement of a specific TLR regulating
downstream signaling to NF-KB transactivation or to mitogen-activated phosphokinase activation (43, 44). As a positive mediator of TLR signaling, PI3K
together with p38 and extracellular regulated kinase (ERK)1/2 mitogen-activated phosphokinases, lead to production
of proinflammatory cytokines IL-1␤,
IL-6, and IL-8 upon microbial challenge
(44, 45). In detail, PI3K activation appeared to have a significantly promoting
function for these mediators in monocytes, whereas activation appeared to
limit the LPS response for generation of
these cytokines in neutrophils (46). However, PI3K inhibition resulted in impaired oxidative burst and phagocytosis
activity in both neutrophils and monocytes. By limiting C5a-mediated effects
on neutrophil cytokine generation, and
promoting oxidative burst and phagocytosis, PI3K activation seems to be a therapeutic approach for limiting inflammation in sepsis.
On the other hand, PI3K/Akt signaling
pathway acts as an endogenous negative
feedback mechanism that serves to limit
proinflammatory and apoptotic events as
seen in monocytes in response to endotoxin (47). The suppressive role in inflammation and coagulation was confirmed in mouse model of endotoxemia
(48). It can also promote the generation
of anti-inflammatory cytokine IL-10 (49).
PI3K/Akt has an effect in balancing Th1
vs. Th2 responses (50). Overexpression of
294
Akt in lymphocytes decreases lymphocyte
apoptosis, a Th1 cytokine propensity, and
improve outcome in cecal ligation and
puncture-induced sepsis (51). Peptidemediated activation of Akt and extracellular regulated kinase signaling protects
lymphocytes from numerous apoptotic
stimuli both in vitro and in vivo (52).
This suggests again the survival advantage of PI3K/Akt pathway activation for
the later stages of sepsis.
The Role of Rho GTPases. The Rho
family of small GTPases is one of the
master regulators of cell motility, as they
control actin cytoskeleton remodeling.
RhoA, Rac1, and CDc42 are the well
known family members which act molecular switches regulating responses of innate immune cells related to pathogen
sensing, intracellular uptake, and destruction (53). These GTPases play both
unique and overlapping roles in phagocyte functions including migration, chemotaxis, and optimal bacterial killing
(54). It has been shown that PAMPs may
utilize GTPases through TLRs (i.e.,
TLR-2, -4, -3, and -9) in which Rac1 activation is required for PI3K activation
upon TLR2 stimulation (55). RhoA regulates not only cytoskeletal events, which
mediate neutrophil migration, but also
contributes to NF-␬␤-dependent proinflammatory gene transcription (Fig. 3)
(56). It has been suggested that ROCK
inhibition could attenuate cytoskeletal
rearrangement of endothelial cells, leading to decreased neutrophil emigration
into the lung parenchyma in LPSinduced lung injury (57). An important
role for rho kinase in leukocyte recruitment is also supported in an endotoxemic
liver injury model (58). The recently
emerged connections between TLR signaling and small Rho-GTPases seem to
provide new therapeutic avenue of research in sepsis.
Toll-Like Receptor Signaling
and Regulatory T Cells (Tregs)
To balance self-tolerance and immunity against pathogens, the immune system depends on both up-regulatory and
down-regulatory mechanisms. Recent
studies have suggested that several lymphocyte subpopulations (i.e., CD4⫹CD25⫹
Foxp3⫹ T regulatory-cell 关Tregs兴) may
have the capacity to actively suppress an
adaptive immune response and may potentially be involved in septic immune
dysfunction. Naturally occurring Tregs
express the transcription factor forkhead
box protein (FoxP3), which is induced by
the anti-inflammatory cytokine transforming growth factor-␤ (59, 60). TLR
triggering induces dendritic cell maturation also, which is essential for the induction of adaptive immune responses (61).
Studies have recently highlightened the
importance of TLRs on Tregs (62). In this
regard, the dominant role of TLR2 signaling on the Treg-mediated immune suppression has been demonstrated (63, 64).
Tregs control inflammatory reactions
to commensal bacteria and opportunist
pathogens and play a major role in suppressing immune reactivity, ranging
from autoimmunity to infectious disease
(65) and to injury (66). Monneret et al
(67) observed that sepsis increases
CD4⫹CD25⫹ T cells in the peripheral
blood of septic patients. This was subsequently found to be a relative increase in
Tregs due to a decrease in the CD4⫹CD25–
T effector cell populations (68). Furthermore, Treg-mediated induction of “alternatively activated” macrophages has been
demonstrated suggesting as one of the
causes of immune dysfunction in systemic inflammatory response syndrome
and sepsis (69, 70). Targeting apoptosis of
Tregs may be a new therapeutic approach
in preventing the continuum of sepsis to
severe sepsis. However, it has been reported that depletion of CD25⫹ cells before inducing sepsis did not alter septic
mortality pointing the need of more studies to clarify the significance of this cell
population’s expansion in sepsis morbidity (71, 72).
Adoptive transfer of Tregs before or
following the initiation of polymicrobial
sepsis improved survival by enhancing
tumor necrosis factor (TNF)-␣ production and bacterial clearance (73). Tregs
inhibit LPS-induced monocyte survival
through the Fas/FasL dependent proapoptotic mechanism, which might play
a role in the resolution of exaggerated
inflammation (74). The positive and negative effects of TLR on Tregs are curious
in sepsis, and the dynamics of TLR expression on immune-suppressive Tregs
upon inflammation or in relation to type
of pathogen are needed to illuminate.
Neutrophils and
Monocyte/Macrophages in
Inflammation
Myeloid cells including neutrophils
and elements of monocyte/macrophage
lineage are heavily armed with large
stores of proteolytic enzymes and with
Crit Care Med 2009 Vol. 37, No. 1
the capacity to rapidly generate ROS and
RNS to degrade internalized pathogens.
The highly proapoptotic nature of neutrophils is designed to maintain a balance
between antimicrobial effectiveness and
the potential for neutrophil-associated
damage to the host in septic challenge or
in other injurious processes, such as
trauma or ischemia/reperfusion (75).
Host tissue damage in severe sepsis may
arise via a variety of mechanisms including premature neutrophil activation during migration, extracellular release of cytotoxic molecules and toxins during
microbial killing, removal of infected or
damaged host cells or debris during host
tissue remodeling, and failure to terminate acute inflammatory responses (76).
Therefore, to maximize host defense capabilities while minimizing damage to
host tissues, neutrophil microbial responses are tightly regulated. On the
other hand, quorum sensing (the ability
of bacteria to assess their population density) has been found to have a crucial role
in regulating tissue invasion by bacterial
pathogens, and inhibitors of quorum
sensing system provide new avenues for
intervention against invasive pathogens
(1). Evidence now exists that quorum
sensing system can even open up bidirectional lines of communication between
bacteria and the human host.
Leukocyte-endothelial interactions,
which may also contribute to inflammation-mediated injury, involve two sets of
adhesion molecules, selectins, and integrins (77, 78). P-selectin is expressed on
platelets; E- and P-selectins are expressed
by endothelial cells, whereas L-selectin is
expressed on leukocytes. Selectins mediate
neutrophil rolling along activated endothelial surfaces as circulating neutrophils decelerate to engage endothelial receptors.
The beta-2 intergrins (CD11/CD18 complexes) mediate tight adhesion to endothelial membranes, allowing subsequent
egress of neutrophils to extravascular sites
of inflammation (78). Activated neutrophils
stimulate transendothelial albumin transport through intracellular adhesion molecule-1 mediated, Scr-dependent caveolin
phosphorylation. The role of caveolin in
inflammatory response in sepsis has been
recently defined (Fig. 3) (79 – 82).
Neutrophils contribute to blood coagulation in localized inflammation and in
generalized sepsis (1, 3, 75). During systemic inflammation, homeostatic mechanisms are compromised in the microcirculation including endothelial hyperactivity,
fibrin deposition, microvascular occlusion,
Crit Care Med 2009 Vol. 37, No. 1
and cellular exudates that further impede
adequate tissue oxygenation. Neutrophils
participate in these rheologic changes
through their augmented binding to blood
vessel walls and through the formation of
platelet-leukocyte aggregates (83). Neutrophil elastase, other proteases, glycases and
inflammatory cytokines degrade endogenous anticoagulant activity, and impair fibrinolysis on endothelial surfaces favoring
a procoagulant state (1).
The Role of Apoptosis. Sepsis-induced
neutrophil-mediated tissue injury has
been demonstrated in a variety of organs
including the lungs (84 – 86), diaphragm
(87), kidneys (86), intestine (88, 89), and
liver (86). Apoptosis is a counter-regulator of the initial inflammatory response
in sepsis (90). Neutrophils are constitutively proapoptotic and apoptosis is fundamental for the resolution of inflammation and cell turnover. Neutrophils can
undergo apoptosis via intrinsic and extrinsic pathways; the latter also requires
mitochondrial amplification (Fig. 4) (91).
The role played by mitochondria in the
regulation of neutrophil life span is more
crucial than in other cell types in the
body (92). As neutrophils kill pathogens
using ROS and RNS and a mixture of lytic
enzymes, delayed clearance of neutrophils in sepsis can potentially contribute
Figure 4. Summary of apoptotic signaling pathways as seen through activation of death receptor
(extrinsic) or mitochondrial (intrinsic) pathway. Extrinsic signals bind to their receptors and trigger
intracellular signaling, leading to caspase-8 activation. Activation of caspase-8 by extrinsic stimuli
(such as tumor necrosis factor-␣ [TNF-␣], Fas ligand) involves mitochondria-dependent signaling in
type II cells. In type I cells, on the other hand, execution of apoptosis occurs without significant
participation of mitochondria. MAPK, mitogen-activated phosphokinase; PI3K/Akt, phosphoinositide
3-kinase/Akt; APAF-1, apoptosis protease activating factor 1; ER, endoplasmic reticulum; IL, interleukin.
Figure 5. The recognition of apoptotic cells by macrophages is largely dependent on the cell surface
appearance of phosphatidylserine (PS). S-nitrosylation of critical cysteine residues inhibits aminophospholipid translocase (APLT), leading to PS externalization. It generates an “eat me” signal during apoptosis.
iNOS, inducible nitric oxide synthase; .NO, nitric oxide; O2, superoxide; ONOOⴚ, peroxynitrite.
295
to cell/organ injury. Importantly, the
phagocytosis of bacteria and fungi accelerates neutrophil apoptosis. Apoptotic
cell clearance induces anti-inflammatory
effects in tissues. It has been shown that
intratracheal administration of killed E.
coli attenuated lung injury and improved
survival in an intestinal ischemia/reperfusion injury associated with marked pulmonary neutrophil infiltration (93).
Cytokine-induced prolonged neutrophil survival is accompanied by evidence
of increased neutrophil activation, including augmented respiratory burst activity (90). Neutrophils from patients
with sepsis manifest markedly prolonged
survival in vitro in association with evidence of cellular activation (94). Phagocytosis of apoptotic neutrophils by
macrophages inhibits the release of
proinflammatory cytokines and promotes
the secretion of anti-inflammatory cytokines (95). In contrast, inefficient apoptotic cell clearance is proinflammatory and
immunogenic (96). The recognition of
apoptotic cells by macrophages is largely
dependent on the cell surface appearance
of an anionic phospholipid, phosphatidylserine (PS), which is normally confined
to the inner leaflet of the plasma membrane (97). Asymmetric distribution of
PS across the plasma membrane is
mainly because of the activity of a specialized enzymatic mechanism, aminophospholipid translocase. S-nitrosylation of critical cysteine residues inhibits
aminophospholipid translocase, leading
to PS externalization. PS expression during apoptosis generates an “eat-me” signal (Fig. 5), which in turn triggers clearance of apoptotic cells and suppresses the
inflammatory response (98). It has been
demonstrated that S-nitrosylation of critical cysteine residues in aminophospholipid translocase using a cell-permeable
transnitrosylating agent, S-nitroso-acetylcysteine, resulted in egression of PS to
the outer surface of the plasma membrane, rendering these cells recognizable
by macrophages (99). The therapeutic potential of regulating neutrophil life-span
in sepsis remains to be determined. Care
must be exercised in regulating of this
pathway, as sepsis enhances the capacity
of macrophages to clear expanded apoptotic populations, a mechanism contributing to septic immune suppression
(100).
The Role of ROS and RNS. ROS and
RNS exert several beneficial physiologic
functions, such as intracellular signaling
for several cytokines and growth factors,
296
Figure 6. Proinflammatory/anti-inflammatory cytokines and reactive oxygen and nitrogen species have
important effects within the microcirculatory unit: the arteriole, endothelial cell, capillary bed, and the
venule. The arteriole is where the characteristic intractable vasodilation of sepsis occurs. The capillary bed
is where the effects of endothelial cell activation/dysfunction are most pronounced and microvascular
thromboses are formed. The postcapillary venule is where leukocyte trafficking is most disordered. All of
these causes impair flow through the microcirculation leading to microcirculatory dysfunction. TLR,
toll-like receptor; NOD-LRR, nucleotide-oligomerization domain leucine-rich repeat; RLH, (RIG-I)-like
helicase; VSM, vascular smooth muscle; IL, interleukin; TGF, transforming growth factor; MIF, migration
inhibitory factor; TNF, tumor necrosis factor; HMGB, high mobility group box; PAF, protease activating
factor; sTNFR, soluble tumor necrosis factor receptor.
second messengers for hormones and redox regulation. Despite their importance
as a defense mechanism against invading
pathogens, an overwhelming production
of ROS and RNS or a deficit in oxidant
scavenger and antioxidant defenses result
in oxidative/nitrosative stress, a key element in the deleterious processes in sepsis (Fig. 6) (101, 102).
Stimulated neutrophils produce ROS
and RNS through the nicotinamide adenine dinucleotide phosphate oxidase
complex, myeloperoxidase and xanthine
oxidoreductase and represent a defense
mechanism against invading microorganisms (103). Lipopolysaccharide and
other proinflammatory mediators activate nicotinamide adenine dinucleotide
phosphate oxidase to produce superoxide
radical (O2⫺). In aqueous environments,
superoxide radical is rapidly catalyzed by
superoxide dismutase hydrogen peroxide
(H2O2) and hydroxyl radicals. Myeloperoxidase from neutrophil azurophilic
granules produces hypochlorous acid
from hydrogen peroxide (H2O2) and chloride anion (Clⴚ) during respiratory burst.
These radicals are highly cytotoxic, and
neutrophils used them to kill bacteria
and other pathogens. Expression of human xanthine oxidoreductase is markedly
up-regulated by hypoxia, ischemia/reperfusion, LPS, and TNF-␣. Increased activity of xanthine oxide, one the important
contributors of ROS production, has been
reported in adult and pediatric patients
with sepsis (104).
O2ⴚ in the presence of nitric oxide,
generates peroxynitrite (ONOO⫺), a key
player in the pathogenesis of sepsisinduced organ dysfunction. ONOO⫺ can
cause DNA strand breakage, which triggers the activation of DNA repair enzymes such as poly (adenine dinucleotide
phosphate-ribose) polymerase (Fig. 3).
Poly (adenine dinucleotide phosphateribose) polymerase inhibitors protect
against oxidative and nitrosative stressinduced organ dysfunction in endotoxemia (87– 89). Recently, the potential role
of poly (adenine dinucleotide phosphateribose) polymerase activation has been
implicated in the pathogenesis of myocardial contractile dysfunction associated
with human septic shock (105).
Novel Cytokines in Inflammation
High Mobility Group Box-1 and Receptor for Advanced Glycation EndProducts. High mobility group box-1
(HMGB-1) is a nonhistone, nuclear DNAbinding protein involved in nucleosome
stabilization and gene transcription. However, when HMGB-1 is released in large
quantities into the extracellular environment, it becomes a lethal mediator of systemic inflammation (Fig. 3) (106). Indeed,
Crit Care Med 2009 Vol. 37, No. 1
it has been recently shown that it has a
weak proinflammatory activity by itself and
binding to bacterial substances including
lipid molecules such as phophatidylserine
strengthens its effects (107). Interestingly,
phosphatidylserine has been implicated in
the regulation of inflammation and
HMGB-1 might thus regulate its antiinflammatory activities (108).
HMGB-1 is released into the extracellular space through acetylation or phosphorylation (109, 110). HMGB-1 is either
“passively released” from necrotic cells,
and a mechanism that represents a process adopted by the innate immune system to recognize damaged and necrotic
cells, or “actively secreted” by immune
cells including macrophages and neutrophils to trigger inflammation (106). Recently, HMGB-1 release from macrophages has been shown during the course
of apoptosis as well as necrosis and defined as a downstream event of cell apoptosis during severe sepsis (111, 112).
After treatment with LPS or various cytokines such as TNF-␣, IL-1␤, or IFN-␥,
HMGB-1 is released from activated macrophages within 4 hrs and reaches a plateau around 18 –24 hrs. It binds to several
transmembrane receptors such as receptor for advanced glycation end products
(RAGE), TLR-2, and -4, activating NF-␬B
and extracellular regulated kinase 1/2
(113, 114).
Although HMGB-1 was originally described as a late mediator of endotoxininduced lethality (115), recent studies indicate a role for HMGB-1 in angiogenesis,
tissue repair, and regeneration (116).
HMGB-1 appears to be a novel myocardial
depressant factor upon release by resident myocardial cells following tissue injury. HMGB-1 might decrease energy utilization in ischemic tissue, thereby
preventing injured myocytes from worsening ATP depletion that eventuate in
necrosis (117). On other hand, excessive
release of HMGB-1 in sepsis might contribute to sustained inflammation and to
profound myocardial depression.
The cholinergic anti-inflammatory
pathway is a neural mechanism that inhibits the expression of HMGB-1 and
other cytokines (118 –121). Signals transmitted via the vagus nerve, the principal
nerve of the parasympathetic nervous
system, significantly attenuate the release of HMGB-1 and other cytokines in
inflammation in animal and human studies (122).
The remarkable binding characteristics
of HMGB-1 suggest another important role
Crit Care Med 2009 Vol. 37, No. 1
for this protein in the extracellular fluid.
HMGB-1 might serve as a shuttle platform
for LPS and other microbial mediators for
docking to CD14 and recognition by the
TLRs (108, 123) or through binding to
host-derived proinflammatory mediators,
such as IL-1beta (124).
Elevated levels of HMGB-1 are measurable in the majority of patients up to 1 wk
after the diagnosis of sepsis or septic shock
and are correlated with the degree of organ
dysfunction (125, 126). However, serum
HMGB-1 levels do not consistently identify
nonsurvivors from survivors as a predictor
of hospital mortality (127). As HMGB-1 is
late inflammatory cytokine of sepsis, it provides a wide therapeutic time window for
clinical intervention and remains an attractive target for sepsis treatment.
RAGE, a member of the immunoglobulin superfamily, is a pattern-recognition receptor that binds diverse classes of endogenous molecules including HMGB-1. It has
been defined as part of a newly appreciated
component of the innate immune system
referred to as the danger associated molecular pattern system (Fig. 3) (128). Membrane bound and soluble forms of RAGE
(sRAGE) have been detected in plasma. Soluble RAGE, anti-RAGE antibody (Fab 2
fragment) or data from RAGE⫺/⫺ animals
have been shown to decrease inflammation,
reduce neutrophil extravasation, and reduce migration (129). Recently, the demonstration of survival benefit after delayed
administration of anti-RAGE antibody in a
murine model of polymicrobial sepsis, even
when delayed up to 24 hrs, provides a therapeutic rationale for the use of anti-RAGE
mAb as a salvage therapy for established
severe sepsis (130).
Macrophage Migration Inhibitory
Factor. Migration inhibitory factor (MIF)
acts as a stress response mediator and
proinflammatory cytokine upon induction by glucocorticoids (131). This protein is readily measurable in patients with
sepsis, and MIF probably contributes to
the pathogenesis of sepsis. Inhibition of
MIF or its targeted deletion attenuates
TNF-␣ and IL-1␤ expression and protects
mice from lethality is experimental sepsis
(132, 133). Systemic challenge of animals
with MIF increases LPS-related lethality
(133). MIF promotes the expression of
TLR4 on macrophages, and thereby sensitizes these immune effector cells to LPS
(134).
The immunoregulatory effects of MIF
might be crucial to the control and resolution of the inflammatory response as a consequence of its ability to regulate activa-
tion-induced apoptosis (135). High MIF
levels delay the removal of activated monocytes/macrophages by apoptosis. This prolongs monocyte/macrophage survival, increases cytokine production, and sustains
an ongoing proinflammatory response.
Mitochondrial Dysfunction in
Inflammation
Although microvascular flow abnormalities occur, findings of decreased oxygen
consumption (136) and elevated tissue oxygen tension (137), yet minimal cell death
despite functional and biochemical derangements (138), suggest that the problem lies more in cellular oxygen utilization
rather than a problem with oxygen delivery
(139). It is postulated that prolonged and
systemic inflammatory insult is accompanied by a basic tissue survival response mediated by switching off its energy-consuming biophysiological processes. Recent
evidence suggests that sepsis and septic
shock severely impair the mitochondria
(140, 141), and the severity and outcome of
organ dysfunction could be related to mitochondrial dysfunction (142). Depleted
levels of reduced glutathione, an important
intramitochondrial antioxidant, in combination with excess generation of ROS and
RNS severely inhibit oxidative phosphorylation and ATP generation (142). This acquired intrinsic derangement in cellular
energy metabolism which has also been
termed “cytopathic hypoxia,” contributes to
reduced activities of mitochondrial electron
transport chain enzyme complexes and impaired ATP biosynthesis, potentially organ
dysfunction in sepsis (141, 143, 144).
Sepsis-related derangements in mitochondrial function can activate the ubiquitin proteolytic pathway in skeletal muscle of septic patients (145). Mitochondrial
permeability transition pore seems to be
involved in sepsis-induced mitochondrial
damage, since its inhibition significantly
improved organ function and reduced
mortality in rodents (146). Whether sepsis-related reduction in energy supply
could result in a state of cellular shutdown analogous to myocardial “stunning” (or hibernation) following coronary
occlusion, allowing for eventual restoration of organ function and survival, has
not yet been determined.
Impact of Inflammation on
Coagulation
The clotting system is almost invariably activated by systemic microbial in297
vasion (147). Clotting is one most prominent features of sepsis. Coagulation
contributes significantly to the outcome
in sepsis with concurrent down-regulation of anticoagulant systems and fibrinolysis (Fig. 7). Inflammation-induced
coagulation in turn contributes to further inflammation (148). Indeed, collaboration between clotting and inflammation accounts for the basic survival
strategy of walling off the damaged and
infected tissues from the rest of the host
(149). The key determinant of survival in
sepsis is to limit excess systemic inflammatory and coagulopathic damage while
retaining the benefits of controlled antimicrobial clearance and localized clot
formation (147, 150).
The inflammatory reaction to tissue
injury activates the clotting system, and
coagulation promotes inflammation (3,
151, 152). The role of procoagulant apoptotic microparticles have also been demonstrated in sepsis (153–155). Linkage of
coagulation enzymes with their serine
protease activity with protease activated
receptors (PAR 1-4) on endothelial surfaces increases P-selectin, cytokine production, and adhesion molecule expression,
leading to microcirculatory dysfunction in
severe sepsis (156, 157).
Activated Protein C. Activated protein
C (APC) is derived from its zymogen protein C in contact with thrombin: thrombomodulin complexes on endothelial surfaces. Protein C was originally thought to
be synthesized exclusively by the liver
(158). It has recently shown that it is
strongly expressed by the endothelium and
keratinocytes (159). The conversion to APC
is augmented by endothelial PC receptor
(EPCR) which is present on endothelial
cells, neutrophils, monocytes, and keratinocytes (160, 161) whereas soluble EPCR
inhibits APC anticoagulant activity (162).
Soluble EPCR is released constitutively and
levels increase in patients with Gramnegative sepsis (163). Levels of APC, protein
C, and its cofactor protein S are depleted in
sepsis (164, 165). Furthermore, peripheral
conversion of Protein C by the thrombin:
thrombomodulin complex is impaired in
sepsis, further contributing to microvascular thrombosis and vascular leakage (166).
APC is a central endogenous anticoagulant protein with antithrombotic, antiinflammatory, antiapoptotic, and profibrinolytic activities (Fig. 8) (167, 168).
Although an anti-inflammatory role for
APC may be an indirect consequence of
its ability to reduce thrombin generation,
APC also has direct anti-inflammatory
298
Figure 7. The extrinsic pathway (tissue factor pathway) is the primary mechanism by which thrombin is
generated in sepsis. The intrinsic cascade (contact factor pathway) primarily serves an accessory role in
amplifying the prothrombotic events that are initiated in sepsis. Thrombin, factor Xa and the TF-factor VIIa
complex interact with the PAR (protease activated receptors) system and directly activate endothelial cells,
platelets and white blood cells, and induce a proinflammatory response. Platelet-derived microparticles
(MPs) express functional adhesion receptors including P-selectin on their surface, attach to the site of
injury on the vessel wall, and support the rolling of leukocytes in the presence of shear stress or severe
insult. When bearing appropriate counter-ligands, MPs can transfer their procoagulant potential to target
cells. Platelet-derived MPs can bind to soluble and immobilized fibrinogen, thus delivering procoagulant
entities to the thrombus via the formation of aggregates. In vitro, interaction between endothelial MPs and
monocytes promotes TF mRNA expression and TF-dependent procoagulant activity. Activated platelets and
platelet-derived MPs thus amplify leukocyte-mediated tissue injury in thrombotic and inflammatory
disorders. EPCR, endothelial protein C receptor; PMN, polymorphonuclear leukocyte; APC, activated
protein C; ADAMST13, a disintegrin and metalloproteinase with a thrombospondin type 1 motifs 13;
ULVWF, unusually large von Willebrand factor; ICAM, intracellular adhesion molecule; VCAM, vascular cell
adhesion molecule-1; IL, interleukin; TNF, tumor necrosis factor; IFN, interferon.
Figure 8. The homeostatic balance between thrombin and activated protein C (APC) in coagulation and
inflammation is given. APC is a central endogenous anticoagulant protein with antithrombotic, antiinflammatory, anti-apoptotic and pro-fibrinolytic activities. The ligand occupancy of endothelial protein C
receptor (EPCR) switches the protease-activated receptor 1 (PAR-1)-dependent signaling specificity of thrombin
from a permeability-enhancing to a barrier-protective response. Other pleiotropic effects are also explained. TAFI,
thrombin activatable fibrinolysis inhibitor; NF-␬␤, nuclear factor ␬␤.
Crit Care Med 2009 Vol. 37, No. 1
Table 1. Ongoing and upcoming clinical studies with molecular targets
Target
CytoFab (AZD9773)
Recombinant human lactoferrin
Lipid emulsion (GR-270773)
E5564
TAK-242
Recombinant human soluble thrombomodulin
Recombinant antithrombin
Recombinant tissue factor pathway inhibitor
Recombinant activated Protein C⫹ Erythropoietin
Recombinant activated Protein C
Recombinant plasma gelsolin
Sponsor or Institution
Phase
Comments
AstraZeneca
Agennix
Glaxo Smith Kline
Eiasi
Takeda
Artisan Pharma
Leo Pharma
Novartis
LHRI
Lilly
CBC
II
II
II
III
III
II
II
III
III
III
II
Recruiting
Recruiting
Suspended
Ongoing
Recruiting
Recruiting
Recruiting
Completed
Recruiting
Recruiting
Recruiting
L-Citrulline supplementation
Fabs of IgG that bind to TNF-␣
LPS-neutralization
TLR4
TLR4
TLR4
Coagulation
Coagulation
Coagulation
Coagulation and inflammation
Coagulation
Replacement of circulating
actin-binding protein
NO pathway
MU
II
Inhaled nitric oxide
NO pathway
NIMS
III
Simvastatin
Pleitrophic effects
IV
Rosuvastatin
Pleitrophic effects
II
Ongoing
Atorvastatin
Pleitrophic effects
MUV, Austria and
Chicago, USA
UASLP, Mexico and Beth
Israel
HCPA, Brazil
Not yet open for
participant
recruitment
Not yet open for
participant
recruitment
Recruiting
II
Recruiting
TNF, tumor necrosis factor; LPS, lipopolysaccharide; NO, nitric oxide; TLR, toll-like receptor, LHRI, Lawson Human Resources Institute; CBC, Critical
Biologics Corporation; MU, Maastricht University; NIMS; National Institute of Medical Sciences; MUV, Medical University of Vienna; UASLP, Universidad
Autonoma de San Luis Potosi; HCPA, Hospital de Clinical de Porto Alegre.
properties (169). APC can cleave and activate PAR1-dependent cellular pathways
(170). APC competes for PAR-1 binding
with thrombin, but in vitro studies suggest that APC is 103- to 104-fold less potent that thrombin in cleaving PAR-1.
The critical receptors required for both
PC activation and APC cellular signaling
(i.e., thrombomodulin, EPCR and PAR-1)
are co-localized in lipid rafts on endothelial cells (171). EPCR is associated with
caveolin-1 on lipid rafts and EPCR binding to the gamma-carboxyglutamic acid
domain of protein C/APC leads to its dissociation from caveolin-1 (Fig. 7). APC
then engages PAR-1 generating a protective signaling pathway through coupling
of PAR-1 to the pertussis toxin-sensitive
G(i)-protein. Thus, when EPCR is bound
by protein C, the PAR-1-dependent protective signaling responses in endothelial
cells can be mediated by either thrombin
or APC. These results explain how PAR-1
and EPCR participate in protective signaling events in endothelial cells (172).
Therapeutic administration of recombinant human APC (rhAPC) is currently
in use as a treatment strategy for severe
sepsis patients with a high risk of death
(173, 174). Genetically engineered variants of APC have been designed with
greater antiapoptotic activity and reduced
anticoagulant activity relative to wildtype APC to increase the risk/benefit ratio
Crit Care Med 2009 Vol. 37, No. 1
of rhAPC regarding the bleeding complication (175). A nonanticoagulant from of
APC reduces mortality in experimental
models of endotoxemia and sepsis (176).
von Willebrand Factor, A Disintegrin-Like
and Metalloproteinase with Thrombospondin
Type-1 Motifs 13 and Ashwell Receptor.
The discovery of a disintegrin-like and metalloproteinase with thrombospondin type-1
motifs 13 (ADAMTS-13) has provided new
insights in pathogenesis of thrombosis in
sepsis. ADAMTS-13, the principal physiologic modulator of von Willebrand factor
(VWF) is produced mainly stellate cells in
the liver (177). VWF is synthesized in vascular endothelial cells and released into the
plasma as unusually large VWF multimers
which are rapidly degraded into smaller
VWF multimers by ADAMTS-13. Deficiency
of the ADAMTS-13, as observed in most
forms of thrombotic thrombocytopenic
purpura, increases the level of unusually
large VWF multimers in plasma and leads
to platelet aggregation and/or thrombus
formation, especially in small arterioles, resulting in microvascular failure (178 –180).
Recently, inflammation associatedADAMTS-13 deficiency has been described in patients with systemic inflammatory response syndrome and severe
sepsis (Fig. 7) (181–185). Decreased levels of ADAMTS-13 have been reported in
healthy volunteers following endotoxin
infusion (186). Furthermore, reduced
ADAMTS-13 levels are associated with differences in morbidity, mortality, and
variables of inflammation and endothelial
dysregulation in severe sepsis patients
(182, 187).
The Ashwell receptor, which is the
major lectin of hepatocytes, modulates
VWF homeostasis. It has been recently
demonstrated that the marked thrombocytopenia associated with S. pneumoniae
sepsis is the result of Ashwell receptordependent clearance of platelets (188).
The ensuing reduction in platelet counts
at the onset of sepsis protects the host
against the development of disseminated
intravascular coagulation. Homeostatic
adaptation by this receptor moderates the
onset and severity of disseminated intravascular coagulation during sepsis suggesting the improvement in host survival
probability (189). At present, it remains
unclear whether blocking the Ashwell receptor may have a beneficial effect in
severe sepsis.
CONCLUSION
A unifying concept of innate immunity is based upon pathogen-, or damageassociated molecular pattern molecules
and downstream signaling pathways. This
has facilitated significant advances in our
understanding of the pathophysiology of
sepsis and led to a multitude of clinical
299
trials (Table 1). However, further identification of the critical elements in severe
sepsis that drives the transition from localized inflammation to deleterious host
response remains incompletely illuminated. The limitations in our current
knowledge of the molecular mechanisms
in sepsis have made the design of intervention trials in clinical sepsis challenging (190). New findings as to biomarkers
and measures to detect genetic signatures of sepsis are now making their way
into clinical trial designs. It is anticipated
that such innovations will improve the
outlook for successful development of
new sepsis treatments tailored to individual patient needs.
REFERENCES
1. van der Poll T, Opal SM: Host-pathogen
interactions in sepsis. Lancet Infect Dis
2008; 8:32– 43
2. Cinel I, Dellinger RP: Making a difference in
outcome in severe sepsis: The organism, the
host response and the treating clinician.
Emerg Med Crit Care Rev 2007; 1:1–3
3. Cinel I, Dellinger RP: Advances in pathogenesis and management of sepsis. Curr
Opin Infect Dis 2007; 20:345–352
4. Uematsu S, Akira S: Toll-like receptors and
innate immunity. J Mol Med 2007; 84:
712–725
5. Creagh EM, O’Neill LA: TLRs, NLRs and
RLRs: A trinity of pathogen sensors that
co-operate in innate immunity. Trends
Immunol 2006; 27:352–357
6. Granucci F, Foti M, Ricciardi-Castagnoli P:
Dendritic cell biology. Adv Immunol 2005;
88:193–233
7. Liew FY, Xu D, Brint EK, et al: Negative
regulation of toll-like receptor-mediated
immune responses. Nat Rev Immunol 2005;
5:446 – 458
8. Akira S, Uematsu S, Takeuchi O: Pathogen
recognition and innate immunity. Cell
2006; 124:783– 801
9. Bianchi ME: DAMPs PAM. Ps and alarmins:
All we need to know about danger. J Leukoc
Biol 2007; 81:1–5
10. Mollen KP, Anand RJ, Tsung A, et al:
Emerging paradigm: Toll-like receptor
4-sentinel for the detection of tissue damage. Shock 2006; 26:430 – 437
11. Tsujimoto H, Ono S, Hiraki S, et al: Hemoperfusion with polymyxin B-immobilized fibers reduced the number of CD16⫹
CD14⫹ monocytes in patients with septic
shock. J Endotoxin Res 2004; 10:229 –237
12. Armstrong L, Medford AR, Hunter KJ, et al:
Differential expression of toll-like receptor
(TLR)-2 and TLR-4 on monocytes in human
sepsis. Clin Exp Immunol 2004; 136:
312–319
13. Tsujimoto H, Ono S, Majima T, et al: Neutrophil elastase, MIP-2, and TLR-4 expres-
300
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
sion during human and experimental sepsis. Shock 2005; 23:39 – 44
Williams DL, Ha T, Li C, et al: Modulation of
tissue toll-like receptor 2 and 4 during the
early phases of polymicrobial sepsis correlates with mortality. Crit Care Med 2003;
31:1808 –1818
Paterson HM, Murphy TJ, Purcell EJ, et al:
Injury primes the innate immune system
for enhanced toll-like receptor reactivity.
J Immunol 2003; 171:1473–1483
Tsujimoto H, Ono S, Efron PA, et al: Role of
toll like receptors in the development of
sepsis. Shock 2008; 29:315–321
Ogura Y, Sutterwala FS, Flavell RA: The
inflammasome: First line of the immune
response to cell stress. Cell 2006; 126:
659 – 662
Drenth JP, van der Meer JW: The inflammasome—A linebacker of innate defense.
N Engl J Med 2006; 355:730 –732
Dinarello CA: Interleukin-1␤, interleukin18, and the interleukin-1␤ converting enzyme. Ann NY Acad Sci 1998; 856:1–11
Martinon F, Burns K, Tschopp J: The inflammasome. A molecular platform triggering activation of inflammatory caspases and
processing of proIL-1␤. MolCell 2002; 10:
417– 426
Yu JW, Wu J, Zhang Z, et al: Cryopyrin and
pyrin activate caspase-1, but not NFkappaB, via ASC oligomerization. Cell
Death Differ 2005; 13:236 –249
Seshadri S, Duncan MD, Hart JM, et al:
Pyrin levels in human monocytes and
monocyte-derived macrophages regulate
IL-1␤ processing and release. J Immunol
2007; 179:1274 –1281
Tschopp J, Martinon F, Burns K: NALPs: A
novel protein family involved in inflammation. NatRevMol Cell Biol 2003; 4:95–104
Sarkar A, Duncan M, Hart J, et al: ASC
directs NF-␬B activation by regulating receptor interacting protein-2 (RIP2)
caspase-1 interactions. J Immunol 2006;
176:4979 – 4986
Scott AM, Saleh M: The inflammatory
caspases: Guardians against infections and
sepsis. Cell Death Differ 2007; 14:23–31
Sarkar A, Hall MW, Exline M, et al:
Caspase-1 regulates E. coli sepsis and
splenic B cell apoptosis independently of
IL-1␤ and IL-18. Am J Respir Crit Care Med
2006; 174:1003–1010
Saleh M, Vaillancourt JP, Graham RK, et al:
Differential modulation of endotoxin responsiveness by human caspase-12 polymorphisms. Nature 2004; 429:75–79
Saleh M, Mathison JC, Wolinski MK, et al:
Enhanced bacterial clearance and sepsis resistance in caspase-12-deficient mice. Nature 2006; 440:1064 –1068
Joshi VD, Kalvakolanu DV, Hasday JD, et al:
IL-18 levels and the outcome of innate immune response to lipopolysaccharide: Importance of a positive feedback loop with
caspase-1 in IL-18 expression. J Immunol
2002; 169:2536 –2544
30. Fahy RJ, Exline MC, Gavrilin MA, et al:
Inflammasome mRNA expression in human
monocytes during early septic shock. Am J
Resp Crit Care Med 2008; 177:983–988.
31. Lara-Tejero M, Sutterwala FS, Ogura Y, et
al: Role of the caspase-1 inflammasome in
Salmonella typhimurium pathogenesis.
J Exp Med 2006; 203:1407–1412
32. Brightbill HD, Libraty DH, Krutzik SR, et
al: Host defense mechanisms triggered by
microbial lipoproteins through toll-like receptors. Science 1999; 285:732–736
33. Bruno TF, Woods DE, Mody CH: Exoenzyme S from Pseudomonas aeruginosa induces apoptosis in T lymphocytes. J Leukoc
Biol 2000; 67:808 – 816
34. Wesche H, Henzel WJ, Shillinglaw W, et al:
MyD88: An adapter that recruits IRAK to
the IL-1 receptor complex. Immunity 1997;
7:837– 847
35. Reynaert NL, van der Vliet A, Guala AS, et
al: Dynamic redox control of NF-kappaB
through glutaredoxin-regulated S-glutathionylation of inhibitory kappaB kinase
beta. Proc Natl Acad Sci USA 2006; 103:
13086 –13091
36. Pahl HL: Activators and target genes of rel/
NF-kappaB transcription factors. Oncogene
1999; 18:6853– 6866
37. Blackwell TS, Yull FE, Chen CL, et al: Multiorgan nuclear factor kappa B activation in
a transgenic mouse model of systemic inflammation. Am J Respir Crit Care Med
2000; 162:1095–1101
38. Arcaroli J, Silva E, Maloney JP, et al: Variant
IRAK-1 haplotype is associated with increased nuclear factor-kappaB activation
and worse outcomes in sepsis. Am J Respir
Crit Care Med 2006; 173:1335–1341
39. Zaph C, Troy AE, Taylor BC, et al: Epithelial
cell-intrinsic IKK-beta expression regulates
intestinal immune homeostasis. Nature
2007; 446:552–556
40. Liu YJ, Soumelis V, Watanabe N, et al:
TSLP: An epithelial cell cytokine that regulates T cell differentiation by conditioning
dendritic cell maturation. Annu Rev Immunol 2007; 25:193–219
41. Peck-Palmer OM, Unsinger J, Chang KC, et
al: Deletion of MyD88 markedly attenuates
sepsis-induced T and B lymphocyte apoptosis but worsens survival. J Leukoc Biol
2008; 83:1009 –1018
42. Cantley LC. The phosphoinositide 3-kinase
pathway. Science 2002; 296:1655–1657
43. Okugawa S, Ota Y, Kitazawa T, et al: Janus
kinase2 is involved in lipopolysaccharideinduced activation of macrophages. Am J
Physiol Cell Physiol 2003; 285:C399 –C408
44. Ojaniemi M, Glumoff V, Harju K, et al:
Phosphatidylinositol kinase is involved in
Toll-like receptor 4-mediated cytokine expression in mouse macrophages. Eur J Immunol 2003; 335:97– 605
45. Guillot L, Le GofficR, BlochS, et al: Involvement of toll-like receptor 3 in the immune
response of lung epithelial cells to double-
Crit Care Med 2009 Vol. 37, No. 1
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
stranded RNA and influenza A virus. J Biol
Chem 2005; 280:5571–5580
Wrann CD, Tabriz NA, Barkhausen T, et al:
The phosphatidylinositol 3-kinase signaling
pathway exerts protective effects during
sepsis by controlling C5a-mediated activation of innate immune functions. J Immunol 2007; 178:5940 –5948
Guha M, Mackman N: The PI3K-Akt pathway limits LPS activation of signaling pathways and expression of inflammatory mediators in human monocytic cells. J Biol
Chem 2002; 277:32124 –32132
Schabbaue G, Tencati M, Pedersen B, et al:
PI3K-Akt pathway suppresses coagulation
and inflammation in endotoxemic mice. Arterioscler Thromb Vasc Biol 2004; 24:
1963–1969
Pengal RA, Ganesan LP, Wei G, et al: Lipopolysaccharide-induced production of interleukin-10 is promoted by the serin threonine kinase Akt. Mol Immunol 2006; 43:
1557–1156
Fukao T, Koyasu S: PI3K and negative regulation of TLR signaling. Trends Immunol
2003; 24:358 –363
Bommhardt U, Chang KC, Swanson PE, et
al: Akt decreases lymphocyte apoptosis and
improves survival in sepsis. J Immunol
2004; 172:7583–7591
Mc Dunn JE, Muenzer JT, Rachdi L, et al:
Peptide-mediated activation of Akt and extracellular regulated kinase signaling prevents lymphocyte apoptosis. FASEB J 2008;
22:561–568
Hall A: Rho GT. Pases and the actin cytoskeleton. Science 1998; 279:509 –514
Ruse M, Knaus UG: New players in TLRmediated innate immunity. Immunologic
Res 2006; 34:33– 48
Arbibe L, Mira JP, Teusch N, et al: Toll-like
receptor 2-mediated NF-kappa B activation
requires a Racl dependenpt pathway. Nat
Immunol 2000; 1:533–540
Honing H, van den Berg TK, van der Pol
SM, et al: Rho activation promotes transendothelial migration of monocytes via
ROCK. J Leukoc Biol 2004; 75:523–528
Tasaka S, Koh H, Yamada W, et al: Attenuation of endotoxin-induced acute lung injury by the Rho-associated kinase inhibitor,
Y-27632. Am J Respir Cell Mol Biol 2005;
32:504 –510
Thorlacius K, Slotta JE, Laschke MW, et al:
Protective effect of fasudil, a Rho-kinase
inhibitor, on chemokine expression, leukocyte recruitment, and hepatocellular apoptosis in septic liver injury. J Leukoc Biol
2006; 79:923–931
Hori S, Nomura T, Sakaguchi S: Control of
regulatory T cell development by the transcription factor FoxP3. Science 2003; 299:
1057–1061
Zheng SG, Wang JH, Koss MN, et al: CD4⫹
and CD8⫹ regulatory T cells generated ex
vivo with IL-2 and TGF-beta suppress a
stimulatory Graft-versus- Host disease with
Crit Care Med 2009 Vol. 37, No. 1
61.
62.
63.
64.
65.
66.
67.
68.
69.
70.
71.
72.
73.
74.
75.
a Lupus-like syndrome. J Immunol 2004;
172:1531–1539
Ausubel FM: Are innate immune signaling
pathways in plants and animals conserved?
Nat Immunol 2005; 6:973–979
Caramalho I, Lopes-Carvalho T, Ostler D, et
al: Regulatory T cells selectively express
toll-like receptors and are activated by lipopolysaccharide. J Exp Med 2003; 197:
403– 411
Sutmuller RPM, den Brok MH, Kramer M,
et al: Toll-like receptor 2 controls expansion
and function of regulatory T cells. J Clin
Invest 2006; 116:485– 494
Liu H, Komai-Koma M, Xu D, et al: Toll-like
receptor 2 signaling modulates the functions of CD4⫹CD25⫹ regulatory T cells.
Proc Natl Acad Sci USA 2006; 103:
7048 –7053
McHugh RS, Shevach EM: The role of suppressor T cells in regulation of immune
responses. J Allergy Clin Immunol 2002;
110:693–702
Murphy TJ, Choileain NN, Zang Y, et al:
CD4⫹CD25⫹ regulatory T cells control innate immune reactivity after injury. J Immunol 2005; 174:2957–2963
Monneret G, Debard AL, Venet F, et al:
Marked elevation of human circulating
CD4⫹CD25⫹ regulatory T cells in sepsisinduced immunoparalysis. Crit Care Med
2003; 31:2068 –2071
Venet F, Pachot A, Debard AL, et al: Increased percentage of CD4⫹CD25⫹ regulatory T cells during septic shock is due to the
decrease of CD4⫹CD25-lymphocytes. Crit
Care Med 2004; 32:2329 –2331
Takahashi H, Tsuda Y, Takeuchi D, et al:
Influence of systemic inflammatory response syndrome on host resistance against
bacterial infections. Crit Care Med 2004;
32:1879 –1885
Tiemessen MM, Jagger AL, Evans HG, et al:
CD4⫹CD25⫹Foxp3⫹ regulatory T cells induce alternative activation of human monocytes/macrophages. Proc Natl Acad Sci USA
2007; 104:19446 –19451
Wisnoski N, Chung CS, Chen Y, et al: The
contribution of CD4⫹ CD25⫹ T-regulatory-cells to immune suppression in sepsis.
Shock 2007; 27:251–257
van Maren WW, Jacobs JF, de Vries IJ, et al:
Toll-like receptor signalling on Tregs: To
suppress or not to suppress? Immunology
2008; 124:445– 452.
Heuer JG, Zhang T, Zhao J, et al: Adoptive
transfer of in vitro-stimulated CD4⫹CD25⫹
regulatory T cells increases bacterial clearance and improves survival in polymicrobial
sepsis. J Immunol 2005; 174:7141–7146
Venet F, Pachot A, Debard AL, et al: Human
CD4⫹CD25⫹ regulatory T lymphocytes inhibit lipopolysaccharide-induced monocyte
survival through a Fas/Fas ligand-dependent mechanism. J Immunol 2006; 177:
6540 – 6547
Brown KA, Brain SD, Pearson JD, et al:
Neutrophils in development of multiple or-
76.
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
gan failure in sepsis. Lancet 2006; 368:
157–169
Marshal JC: The pathogenesis and molecular biology of sepsis. Crit Care Resusc 2006;
8:227–229
Chandra A, Enkhbaatar P, Nakano Y, et al:
Sepsis: Emerging role of nitric oxide and
selectins. Clinics 2006; 61:71–76
Hu G, Predescu D, Vogel SM: ICAM-1 dependent neutrophil adhesion to endothelial
cells increases caveolae-mediated pulmonary vascular albumin permeability. Crit
Care Med 2007; 34 (Suppl 12): A31
Garrean S, Gao X-P, Brovkovych V, et al:
Caveolin-1 regulates NF-kB activation and
lung inflammatory response to sepsis induced by lipopolysaccharide. J Immunol
2006 177: 4853– 4860
Wang XM, Kim HP, Song R, et al: Caveolin-1 confers antiinflammatory effects in
murine macrophages via the MKK3/p38
MAPK pathway. Am J Respir Cell Mol Biol
2006; 34:434 – 442
Medina FA, de Almeida CJ, Dew E, et al:
Caveolin-1 deficient mice show defects in
innate immunity and inflammatory immune response during Salmonella enterica
serovar typhimurium infection. Infect Immun 2006; 74:6665– 6674
Medina FA, Cohen AW, de Almeida CJ, et al:
Immune dysfunction in caveolin-1 null
mice following infection with Trypanosoma
cruzi (Tulahuen strain). Microbes Infect
2007; 9:325–333
Astiz ME, DeGent GE, Lin RY, et al: Microvascular function and rheologic changes in
hyperdynamic sepsis. Crit Care Med 1995;
23:265–271
Ozdulger A, Cinel I, Koksel O, et al: The
protective effect of N-acetylcysteine on apoptotic lung injury in cecal ligation and
puncture-induced sepsis model. Shock
2003; 19:366 –372
Stehr SN, Knels L, Weissflog C, et al: Effects
of IgM enriched solution on polymorphonuclear neutrophil function, bacterial
clearance, and lung histology in endotoxemia. Shock 2007; 29:167–172
Kabay B, Kocaefe C, Baykal A, et al: Interleukin-10 gene transfer: Prevention of multiple organ injury in a murine cecal ligation
and puncture model of sepsis. World J Surg
2007; 31:105–115
Ozdulger A, Cinel I, Unlu A, et al: Poly
(ADP-ribose) synthetase inhibition prevents
lipopolysaccharide-induced peroxynitrite
mediated damage in diaphragm. Pharmacol
Res 2002; 46:67–73
Taner S, Cinel I, Ozer L, et al: Poly (ADPribose) synthetase inhibition reduces bacterial translocation in rats after endotoxin
challenge. Shock 2001; 16:159 –162
Cinel I, Buyukafsar K, Cinel L, et al: The
role of poly (ADP-ribose) synthetase inhibition in preventing endotoxemia-induced intestinal epithelial apoptosis. Pharmacol Res
2002; 46:119 –127
301
90. Savill J: Apoptosis in resolution of inflammation. J Leukoc Biol 1997; 61:375–380
91. Maianski NA, Geissler J, Srinivasula SM, et
al: Functional characterization of mitochondria in neutrophils: A role restricted to
apoptosis. Cell Death Differ 2004; 11:
143–153
92. van Raam BJ, Verhoeven AJ, Kuijpers TW:
Mitochondria in neutrophil apoptosis. Int
J Hematol 2006; 84:199 –204
93. Sookhai S, Wang JJ, McCourt M, et al: A
novel therapeutic strategy for attenuating
neutrophil-mediated lung injury in vivo.
Ann Surg 2002; 235:285–291
94. Taneja R, Parodo J, Kapus A, et al: Delayed
neutrophil apoptosis in sepsis is associated
with maintenance of mitochondrial transmembrane potential and reduced caspase-9
activity. Crit Care Med 2004; 32:1460 –1469
95. Fadok VA, Bratton DL, Konowal A, et al:
Macrophages that have ingested apoptotic
cells in vitro inhibit proinflammatory cytokine production through autocrine/paracrine mechanisms involving TGF, PGE2,
and PAF. J Clin Invest 1998; 101:890 – 898
96. Sanford AN, Suriano AR, Herche D, et al:
Abnormal apoptosis in chronic granulomatous disease and autoantibody production
characteristic of lupus. Rheumatology
2006; 45:178 –181
97. Daleke DL: Regulation of transbilayer
plasma membrane phospholipid asymmetry. J Lipid Res 2003; 44:233–242
98. Bayir H, Kagan VE: Bench-to-bedside review: Mitochondrial injury, oxidative stress
and apoptosis—there is nothing more practical than a good theory. Crit Care 2008;
12:206
99. Tyurina YY, Basova LV, Konduru NV, et al:
Nitrosative stress inhibits the aminophospholipid translocase resulting in phosphatidylserine externalization and macrophage
engulfment: Implications for the resolution
of inflammation. J Biol Chem 2007; 282:
8498 – 8509
100. Swan R, Chung CS, Albina J, et al: Polymicrobial sepsis enhances clearance of apoptotic immune cells by splenic macrophages.
Surgery 2007; 142:253–261
101. Macdonald J, Galley HF, Webster NR: Oxidative stress and gene expression in sepsis.
Br J Anaest 2003; 90:221–232
102. Matejovic M, Krouzecky A, Rokyta R Jr, et
al: Effects of combining inducible nitric oxide synthase inhibitor and radical scavenger
during porcine bacteremia. Shock 2007; 27:
61– 68
103. Fialkow L, Wang Y, Downey GP: Reactive
oxygen and nitrogen species as signaling
molecules regulating neutrophil function.
Free Radic Biol Med 2007; 42:153–164
104. Galley HF, Davies MJ, Webster NR: Xanthine oxidase activity and free radical generation in patients with sepsis syndrome.
Crit Care Med 1996; 24:1649 –1653
105. Soriano FG, Nogueira AC, Caldini EG, et al:
Potential role of poly (adenosine 5⬘diphosphate-ribose) polymerase activation
302
106.
107.
108.
109.
110.
111.
112.
113.
114.
115.
116.
117.
118.
119.
120.
121.
in the pathogenesis of myocardial contractile dysfunction associated with human septic shock. Crit Care Med 2006; 34:
1073–1079
Ulloa L, Tracey KJ: The “cytokine profile”: A
code for sepsis. Trends Mol Med 2005; 11:
56 – 63
Zimmermann K, Volkel D, Pable S, et al:
Native versus recombinant high-mobility
group B1 proteins: functional activity in
vitro. Inflammation 2004; 28:221–229
Rouhiainen A, Tumova S, Valmu L, et al:
Pivotal advance: Analysis of proinflammatory activity of highly purified eukaryotic
recombinant HMGB1 (amphoterin). J Leukocyte Biol 2007; 81:49 –58
Bonaldi T, Talamo F, Scaffidi P, et al: Monocytic cells hyperacetylate chromatin protein
HMGB1 to redirect it towards secretion.
EMBO J 2003; 22:5551–5560
Youn JH, Shin JS: Nucleocytoplasmic shuttling of HMGB1 is regulated by phosphorylation that redirects it toward secretion.
J Immunol 2006; 177:7889 –7897
Bell CW, Jiang W, Reich CF III, et al: The
extracellular release of HMGB1 during apoptotic cell death. Am J Physiol Cell Physiol
2006; 291:C1318 –C1325
Qin S, Wang H, Yuan R, et al: Role of
HMGB1 in apoptosis-mediated sepsis lethality. J Exp Med 2006; 203:1637–1642
Hori O, Brett J, Slattery T, et al: The receptor for advanced glycation end products
(RAGE) is a cellular binding site for amphoterin: Mediation of neurite outgrowth and
co-expression of rage and amphoterin in the
developing nervous system. J Biol Chem
1995; 270:25752–25761
Park JS, Svetkauskaite D, He Q, et al: Involvement of toll-like receptors 2 and 4 in
cellular activation by high mobility group
box 1 protein. J Biol Chem 2004; 279:
7370 –7377
Wang H, Bloom O, Zhang M, et al: HMG-1
as a late mediator of endotoxin lethality in
mice. Science 1999; 285:248 –251
Mitola S, Belleri M, Urbinati C, et al: Cutting edge: Extracellular high mobility
group box-1 protein is a proangiogenic cytokine. J Immunol 2006; 176:12–15
Tzeng HP, Fan J, Vallejo JG, et al: Negative
inotropic effects of high-mobility group box
1 protein in isolated contracting cardiac
myocytes. Am J Physiol Heart Circ Physiol
2008; 294:H1490 –H1496
Wang H, Yu M, Ochani M, et al: Nicotinic
acetylcholine receptor ␣7 receptor is an essential regulator of inflammation. Nature
2003; 421:384 –388
Pavlov VA, Wang H, Czura CJ, et al: The
cholinergic anti-inflammatory pathway: A
missing link in neuromodulation. Mol Med
2003; 9:125–134
Wang H, Liao H, Ochani M, et al: Cholinergic agonists inhibit HMGB1 release and
improve survival in experimental sepsis.
Nat Med 2004; 10:1216 –1221
Huston JM, Gallowitsch-Puerta M, Ochani
122.
123.
124.
125.
126.
127.
128.
129.
130.
131.
132.
133.
134.
135.
M, et al: Transcutaneous vagus nerve stimulation reduces serum high mobility group
box 1 levels and improves survival in murine sepsis. Crit Care Med 2007; 35:
2762–2768
Goldstein RS, Bruchfeld A, Yang L, et al:
Cholinergic anti-inflammatory pathway activity and High Mobility Group Box-1
(HMGB1) serum levels in patients with
rheumatoid arthritis. Mol Med 2007;
13(3– 4):210 –215
Youn JH, Oh YJ, Kim ES, et al: High Mobility Group Box 1 protein binding to lipopolysaccharide facilitates transfer of lipopolysaccharide to CD14 and enhances
lipopolysaccharide-mediated TNF-{alpha}
production in human monocytes. J Immunol 2008; 180:5067–5074
Sha Y, Zmijewski J, Xu Z, et al: HMGB1
develops enhanced proinflammatory activity by binding to cytokines. J Immunol
2008; 180:2531–2537
Sundén-Cullberg J, Norrby-Teglund A, Rouhiainen A, et al: Persistent elevation of high
mobility group box-1 protein (HMGB1) in
patients with severe sepsis and septic shock.
Crit Care Med 2005; 33: 564 –573
Gibot S, Massin F, Cravoisy A, et al: Highmobility group box 1 protein plasma concentrations during septic shock. Intensive
Care Med 2007; 33:1347–1353
Karlsson S, Pettilä V, Tenhunen J, et al:
HMGB1 as a predictor of organ dysfunction
and outcome in patients with severe sepsis.
Intensive Care Med 2008; 34:1046 –1053.
Harris HE, Raucci A: Alarmin(g) news about
danger. EMBO Rep 2006; 7:774 –778
Chavakis T, Bierhaus A, Al-Fakhri N, et al:
The pattern recognition receptor (RAGE) is
a counterreceptor for leukocyte integrins: A
novel pathway for inflammatory cell recruitment. J Exp Med 2003; 198:1507–1515
Lutterloh EC, Opal SM, Pittman DD, et al:
Inhibition of the RAGE products increases
survival in experimental models of severe
sepsis and systemic infection. Crit Care
2007; 11:R122
Calandra T, Bernhagen J, Metz CN, et al:
MIF as a glucocorticoid-induced modulator
of cytokine production. Nature 1995; 377:
68 –71
Calandra T, Echtenacher B, Roy DL, et al:
Protection from septic shock by neutralization of macrophage migration inhibitory
factor. Nat Med 2000; 6:164 –170
Bozza M, Satoskar AR, Lin G, et al: Targeted
disruption of migration inhibitory factor
gene reveals its critical role in sepsis. J Exp
Med 1999; 189:341–346
Roger T, David J, Glauser MP, et al: MIF
regulates innate immune responses
through modulation of Toll-like receptor
4. Nature 2001; 414:920 –924
Mitchell RA, Liao H, Chesney J, et al: Macrophage migration inhibitory factor (MIF)
sustains macrophage proinflammatory
function by inhibiting p53: Regulatory role
Crit Care Med 2009 Vol. 37, No. 1
136.
137.
138.
139.
140.
141.
142.
143.
144.
145.
146.
147.
148.
149.
150.
151.
in the innate immune response. Proc Natl
Acad Sci USA 2002; 99:345–350
Kreymann G, Grosser S, Buggisch P, et al:
Oxygen consumption and resting metabolic
rate in sepsis, sepsis syndrome, and septic
shock. Crit Care Med 1993; 21:1012–1019
Rosser DM, Stidwill RP, Jacobson D, et al:
Oxygen tension in the bladder epithelium
rises in both high and low cardiac output
endotoxemic sepsis. J Appl Physiol 1995;
79:1878 –1882
Hotchkiss RS, Swanson PE, Freeman BD, et
al: Apoptotic cell death in patients with sepsis, shock, and multiple organ dysfunction.
Crit Care Med 1999; 27:1230 –1251
Brealey D, et al: Mitochondrial dysfunction
in a long-term rodent model of sepsis and
organ failure. Am J Physiol Regul Integr
Comp Physiol 2004; 286:R491–R497
Crouser ED: Mitochondrial dysfunction in
septic shock and multiple organ dysfunction syndrome. Mitochondrion 2004;
4:729 –741
Fink MP: Cytopathic hypoxia. Mitochondrial dysfunction as mechanism contributing to organ dysfunction in sepsis. Crit Care
Clinics 2001; 17:219 –237
Brealey D, Brand M, Hargreaves I, et al:
Association between mitochondrial dysfunction and severity and outcome of septic
shock. Lancet 2002; 360:219 –223
Crouser ED, Julian MW, Blaho DV, et al:
Endotoxin-induced mitochondrial damage
correlates with impaired respiratory activity. Crit Care Med 2002; 30:276 –284
Levy RJ, Vijayasarathy C, Raj NR, et al:
Competitive and noncompetitive inhibition
of myocardial cytochrome C oxidase in sepsis. Shock 2004; 21:110 –114
Rabuel C, Renaud E, Brealey D, et al: Human septic myopathy: Induction of cyclooxygenase, heme oxygenase and activation of
the ubiquitin proteolytic pathway. Anesthesiology 2004; 101:583–590
Larche J, Lancel S, Hassoun SM, et al: Inhibition of mitochondrial permeability
transition prevents sepsis-induced myocardial dysfunction and mortality. J Am Coll
Cardiol 2006; 48:377–385
Levi M, Ten Cate H: Disseminated intravascular coagulation. N Engl J Med 1999; 341:
586 –592
Schouten M, Wiersinga WJ, Levi M, et al:
Inflammation, endothelium, and coagulation in sepsis. J Leukoc Biol 2008; 83:
536 –545
Opal SM: The nexus between systemic inflammation and disordered coagulation in
sepsis. J Endotoxin Res 2004; 10:125–129
Esmon CT: Are natural anticoagulants candidates for modulating the inflammatory
response to endotoxin? Blood 2000; 95:
1113–1116
Johnson K, Choi Y, DeGroot E, et al: Potential mechanisms for a proinflammatory vascular cytokine response to coagulation activation. J Immunol 1998; 160:
5130 –5135
Crit Care Med 2009 Vol. 37, No. 1
152. Stouthard JM, Levi M, Hack CE, et al: Interleukin-6 stimulates coagulation, not fibrinolysis, in humans. Thromb Haemost
1996; 76:738 –742
153. Aupeix K, Hugel B, Martin T, et al: The
significance of shed membrane particles
during programmed cell death in vitro, and
in vivo, in HIV-1 infection. J Clin Invest
1997; 99:1546 –1554
154. Soriano AO, Jy W, Chirinos JA, et al: Levels
of endothelial and platelet microparticles
and their interactions with leukocytes negatively correlate with organ dysfunction and
predict mortality in severe sepsis. Crit Care
Med 2005; 33:2540 –2546
155. Fujimi S, Ogura H, Tanaka H, et al: Activated polymorphonuclear leukocytes enhance production of leukocyte microparticles with increased adhesion molecules in
patients with sepsis. J Trauma 2002; 52:
443– 448
156. Amaral A, Opal SM, Vincent JL: Coagulation
in sepsis. Intensive Care Med 2004; 30:
1032–1040
157. Vervloet MG, Thijs LG, Hack CE: Derangements of coagulation and fibrinolysis in
critically ill patients with sepsis and septic
shock. Semin Thromb Hemost 1998; 24:
33– 44
158. Yan SB, Dhainut JF: Activated protein C
versus protein C in severe sepsis. Crit Care
Med 2001; 29(Suppl):S69 –S74
159. Xue M, Campbell D, Jackson CJ: Protein C
is an autocrine growth factor for human
skin keratinocytes, J Biol Chem 2007; 282:
13610 –13616
160. Xue M, March L, Sambrook PN, et al:
Endothelial protein C receptor is overexpressed in rheumatoid arthritic (RA) synovium and mediates the anti-inflammatory effects of activated protein C in RA
monocytes. Ann Rheum Dis 2007; 66:
1574 –1580
161. Regan LM, Stearns-Kurosawa DJ, Kurosawa
S, et al: The endothelial cell protein C receptor: Inhibition of activated protein C anticoagulant function without modulation of
reaction with proteinase inhibitors. J Biol
Chem 1996; 271:17499 –17503
162. Kurosawa S, Stearns-Kurosawa DJ, Carson
CW, et al: Plasma levels of endothelial cell
protein C receptor are elevated in patients
with sepsis and systemic lupus erythematosus: Lack of correlation with thrombomodulin suggests involvement of different
pathological processes. Blood 1998; 91:
725–727
163. Yan SB, Helterbrand JD, Hartman DL, et al:
Low levels of protein C are associated with
poor outcome in severe sepsis. Chest 2001;
120:915–922
164. LaRosa SP, Opal SM, Utterback B, et al:
Decreased protein C, protein S, and antithrombin levels are predictive of poor outcome in Gram-negative sepsis caused by
Burkholderia pseudomallei. Int J Infect Dis
2006; 10:25–31
165. Yan SB, Dhainaut JF: Activated protein C
166.
167.
168.
169.
170.
171.
172.
173.
174.
175.
176.
177.
178.
179.
180.
versus protein C in severe sepsis. Crit Care
Med 2001; 29(Suppl):S69 –S74
Joyce DE, Gelbert L, Ciaccia A, et al: Gene
expression profile of antithrombotic protein
C defines new mechanisms modulating inflammation and apoptosis. J Biol Chem
2001; 14:11199 –111203
Jackson CJ, Xue M: Activated protein C-An
anticoagulant that does more than stop
clots. Int J Biochem Cell Biol 2008; 40:
2692–2697
Dutt T, Toh CH: The yin-yang of thrombin
and activated protein C. Br J Haematology
2008; 140:505–515
Riewald M, Ruf W: Protease-activated receptor-1 signaling by activated protein C in
cytokine-perturbed endothelial cells is distinct from thrombin signaling. J Biol Chem
2005; 280:19808 –19814
Bae JS, Yang L, Rezaie AR: Receptors of the
protein C activation and activated protein C
signaling pathways are colocalized in lipid
rafts of endothelial cells. Proc Natl Acad Sci
USA 2007; 104:2867–2872
Bae JS, Yang L, Manithody C, et al: The
ligand occupancy of endothelial protein
C receptor switches the protease-activated
receptor 1-dependent signaling specificity
of thrombin from a permeability-enhancing to a barrier-protective response
in endothelial cells. Blood 2007; 110:
3909 –3916
Shorr AF, Bernard GR, Dhainaut JF, et al:
Protein C concentrations in severe sepsis:
An early directional change in plasma levels
predicts outcome. Crit Care 2006; 10:R92
Cinel I, Dellinger RP: Current treatment of
severe sepsis. Curr Infect Dis Rep 2006;
8:358 –365
Dellinger RP, Levy MM, Carlet JM, et al:
Surviving Sepsis Campaign: International
guidelines for management of severe sepsis
and septic shock: 2008. Crit Care Med 2008;
36:296 –327
Bae JS, Yang L, Manithody C, et al: Engineering a disulfide bond to stabilize the
calcium binding loop of activated protein C
eliminates its anticoagulant but not protective signaling properties. J Biol Chem 2007;
282:9251–9259
Kerschen EJ, Fernandez JA, Cooley BC, et
al: Endotoxemia and sepsis mortality reduction by non-anticoagulant activated protein
C. J Exp Med 2007; 204:2439 –2448
Moake JL: Thrombotic microangiopathies.
N Engl J Med 2002; 347:589 – 600
Ruggeri ZM: Von Willebrand factor, platelets and endothelial cell interactions.
J Thromb Haemost 2003; 1:1335–1342
Furlan M, Robles R, Galbusera M, et al: von
Willebrand factor-cleaving protease in
thrombotic thrombocytopenic purpura and
the hemolytic-uremic syndrome. New Engl
J Med 1998; 339:1578 –1584
Arya M, Anvari B, Romo GM, et al: Ultralarge multimers of von Willebrand factor
form spontaneous high-strength bonds
303
with the platelet glycoprotein Ib-IX complex: Studies using optical tweezers. Blood
2002; 99:3971–3977
181. Bianchi V, Robles R, Alberio L, et al: Von
Willebrand factor-cleaving protease (ADAMTS13) in thrombocytopenic disorders: A
severely deficient activity is specific for
thrombotic thrombocytopenic purpura.
Blood 2002; 100:710 –713
182. Ono T, Mimuro J, Madoiwa S, et al: Severe
secondary deficiency of von Willebrand factor-cleaving protease (ADAMTS13) in patients with sepsis-induced disseminated intravascular coagulation: Its correlation with
development of renal failure. Blood 2006;
107:528 –534
183. Nguyen TC, Liu A, Liu L, et al: Acquired
ADAMTS-13 deficiency in pediatric pa-
304
tients with severe sepsis. Haematologica
2007; 92:121–124
184. Kremer Hovinga JA, Zeerleder S, Kessler
P, et al: ADAMTS-13, von Willebrand factor and related parameters in severe sepsis and septic shock. J Thromb Haemost
2007; 5:2284 –2290
185. Bockmeyer CL, Claus RA, Budde U, et al:
Inflammation-associated ADAMTS13 deficiency promotes formation of ultra-large
von Willebrand factor. Haematologica
2008; 93:137–140
186. Reiter RA, Varadi K, Turecek PL, et al:
Changes in ADAMTS13 (von-Willebrand
factor-cleaving protease) activity after induced release of von Willebrand factor
during acute systemic inflammation.
Thromb Haemost 2005; 93:554 –558
187. Martin K, Borgel D, Lerolle N, et al: Decreased ADAMTS-13 (A disintegrin-like and
metalloprotease with thrombospondin type
1 repeats) is associated with a poor prognosis in sepsis-induced organ failure. Crit
Care Med 2007; 35:2375–2382
188. Grewal PK, Uchiyama S, Ditto D, et al: The
Ashwell receptor mitigates the lethal coagulopathy of sepsis. Nat Med 2008; 14:648–655
189. van’t Veer C, van der Poll T. Keeping blood
clots at bay in sepsis. Nat Med 2008; 14:
606 – 608
190. Treziack S, Cinel I, Dellinger RP, et al:
Resuscitating the microcirculation in severe sepsis: The central role of nitric oxide,
emerging concepts for novel therapies, and
challenges for clinical trials. Acad Emerg
Med 2008; 15:1–15
Crit Care Med 2009 Vol. 37, No. 1
vasive ventilation for acute respiratory failure. Eur Respir J 2002; 19:712–721
10. Schonhofer B, Sortor-Leger S: Equipment
needs for noninvasive mechanical ventilation. Eur Respir J 2002; 20:1029 –1036
11. Gonzalez MM, Sharshar T, Hart N, et al: Air leaks
during mechanical ventilation as a cause of persistent hypercapnia in neuromuscular disorders.
Intensive Care Med 2003; 29:596–602
12. Teschler H, Stampa J, Ragette R, et al: Effect of
mouth leak on effectiveness of nasal bilevel
ventilatory assistance and sleep architecture.
Eur Respir J 1999; 14:1251–1257
13. Meduri GU, Turner RE, Abou-Shala N, et al:
Noninvasive positive pressure ventilation via
face mask. First-line intervention in patients
with acute hypercapnic and hypoxemic respiratory failure. Chest 1996; 109:179 –193
14. Girault C, Briel A, Benichou J, et al: Interface
strategy during noninvasive positive pressure
ventilation for hypercapneic acute respiratory failure. Crit Care Med 2009; 37:124 –131
15. Kwok H, McCormack J, Cece R, et al: Controlled trial of oronasal versus nasal mask ventilation in the treatment of acute respiratory
failure. Crit Care Med 2003; 31:468 – 473
Toll-like receptor pathway signaling is differently regulated in
neutrophils and peripheral mononuclear cells of patients with
sepsis, severe sepsis, and septic shock*
I
mmunomodulation during sepsis
could be a potential therapeutic
concept. However, this requires a
detailed understanding of the time
course and pathophysiology of sepsis,
which is somehow reflected in the concepts of systemic inflammatory response
syndrome and compensatory anti-inflammatory response syndrome (1). Today, we
are still aiming for biological markers
indicating the current immune status of
sepsis patients. Equipped with such indicators, a therapeutic immunomodulatory
therapy (e.g., directed at monocytes and
neutrophils) is feasible (2). The list of
potential candidates is long such as
phagocytosis activity, hydrogen peroxide
production, expression of human leukocyte antigen-DR, CD64, toll-like receptors (TLR), triggering receptor expressed
on myeloid cells, and granulocytemacrophage colony-stimulating factor
receptor among others (3–7). In addition
to these functional and cell surface related markers, intracellular signaling cascades may also play an important role
such as TLR signaling. Extracellular signal-regulated kinase and p38 kinase signaling differ following lipopolysaccharide
stimulation in leukocytes from systemic
inflammatory response syndrome patients vs. sepsis patients (8). Furthermore, myeloid differentiation 88 short
*See also p. 132.
Key Words: toll-like receptors; sepsis; neutrophils;
monocytes; genes
The authors have not disclosed any potential conflicts of interest.
Copyright © 2008 by the Society of Critical Care
Medicine and Lippincott Williams & Wilkins
DOI: 10.1097/CCM.0b013e31819305be
346
and single immunoglobulin interleukin-1
receptor-related molecule are up-regulated in monocytes from septic patients
(9).
The complexity of the condition “inflammation” suggests that multiple
markers in concert with dynamic changes
(e.g., time and concentration) need to be
identified to discriminate the various
states within the pro- (systemic inflammatory response syndrome; sepsis, e.g.,
caused by bacteria, viruses, fungi and parasites; severe sepsis; septic shock) and
compensatory anti-inflammatory response syndrome response.
The administration of lipopolysaccharide to healthy subjects leads to a transient, time-dependent expression of 3714
individual genes in full blood for 24 hrs
(10). It has been known for a long time
that leukocytes from critical ill patients
demonstrate reduced proinflammatory
activity (e.g., proinflammatory cytokines) compared with leukocytes from
healthy subjects. Controversy still exists regarding the role of the regulation
of TLRs as a possible mechanism of this
phenomenon (11).
In this issue of Critical Care Medicine,
Salomao et al (12) have focused on the
TLR signaling pathway on the transcriptional level in leukocytes (neutrophils vs.
monocytes) from patients with sepsis, severe sepsis, or septic shock. This reflects a
reasonable and logical next step, based on
the study by Calvano et al (10) which was
performed on whole blood leukocytes
performed as genome-wide expression
analysis on lipopolysaccharide-treated
healthy volunteers. Salomao et al have
undertaken the effort to translate these
findings into the clinical context further
decrypting the findings by Calveno et al
by focusing on one central signaling cascade involved in systemic inflammation.
The authors justify their work with
the correct assumption that “. . . monocytes and neutrophil function are modulated throughout the continuum of sepsis.” However, the work of Salomao et al
suffers from two limitations. First, the
existence of such a continuum of sepsis is
questionable, and second—if it would exist—the authors have not studied this
(variable sampling time, allowing up to
72 hrs deviation in the sepsis group). This
query is further supported by various animal and human studies indicating fast
and significant changes in the expression
of genes and proteins being involved in
the inflammatory cascade (10). In addition, it is unclear whether the changes
seen by Salomao et al in gene expression
result in changes in protein levels.
The work of Salomao et al provides
evidence that TLR signaling is different in
monocytes and neutrophils. Their results
indicate that TLR expression in monocytes may not correlate with hyporesponsiveness and that intracellular downstream signals are more likely part of the
mechanism involved. Regarding neutrophils, this article is more difficult to interpret in the context of previously described (functional) characteristics of
neutrophils from patients with sepsis and
septic shock. Studies on neutrophil function or on markers which are thought to
reflect their activity resulted in inconsistent findings (5, 13, 14).
The impact of single-nucleotide polymorphisms are increasingly appreciated
Crit Care Med 2009 Vol. 37, No. 1
as players in the pathophysiology of sepsis. TLR4 polymorphism is associated
with a higher rate of Gram-negative infections in a surgically critical ill population and is detected in a higher frequency
in patients in septic shock compared with
a healthy control group. For TLR2, the
Arg753Gln polymorphism has been reported to increase the risk of Grampositive and Candida sepsis in critical ill
patients (15). Interleukin-1 receptorassociated kinase single-nucleotide polymorphism carriers (⬃14% in a white
population with sepsis) demonstrate a
worse outcome when suffering from sepsis than wild-type carriers (16).
High-throughput technologies and
multiplexing on pretranscriptional, transcriptional, and posttranscriptional levels
allow the detection of large numbers of
mediators influencing systemic inflammation. Sepsis research will become
more and more challenging in terms of
the demand of larger study populations
and, hence costs. This warrants more efforts to organize international networks
and funding opportunities.
Alexander Koch, MD
Kai Zacharowski, MD, PhD
Molecular Cardioprotection and
Inflammation Group
Department of Anaesthesia
University Hospitals Bristol
NHS Foundation Trust
Bristol, UK
REFERENCES
1. Bone RC: Sir Isaac Newton, sepsis, SIRS, and
CARS. Crit Care Med 1996; 24:1125–1128
2. Lendemans S, Kreuzfelder E, Waydhas C, et
al: Differential immunostimulating effect of
granulocyte-macrophage colony-stimulating
factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF) and interferon gamma
(IFNgamma) after severe trauma. Inflamm
Res 2007; 56:38 – 44
3. Pangault C, Le TY, Tattevin P, et al: Downmodulation of granulocyte macrophagecolony stimulating factor receptor on monocytes during human septic shock. Crit Care
Med 2006; 34:1193–1201
4. Livaditi O, Kotanidou A, Psarra A, et al:
Neutrophil CD64 expression and serum
IL-8: Sensitive early markers of severity
and outcome in sepsis. Cytokine 2006; 36:
283–290
5. Kaufmann I, Hoelzl A, Schliephake F, et al:
Polymorphonuclear leukocyte dysfunction
syndrome in patients with increasing sepsis
severity. Shock 2006; 26:254 –261
6. Mahdy AM, Lowes DA, Galley HF, et al: Production of soluble triggering receptor expressed on myeloid cells by lipopolysaccharide-stimulated human neutrophils involves
de novo protein synthesis. Clin Vaccine Immunol 2006; 13:492– 495
7. Ramsay SC, Maggs J, Powell K, et al: In
whole blood, LPS, TNF-alpha and GM-CSF
increase monocyte uptake of 99mtechnetium stannous colloid but do not affect
neutrophil uptake. Nucl Med Biol 2006;
33:645– 651
8. West MA, Koons A, Crandall M, et al: Whole
blood leukocyte mitogen activated protein
9.
10.
11.
12.
13.
14.
15.
16.
kinases activation differentiates intensive
care unit patients with systemic inflammatory response syndrome and sepsis. J Trauma
2007; 62:805– 811
Adib-Conquy M, Adrie C, Fitting C, et al:
Up-regulation of MyD88s and SIGIRR, molecules inhibiting Toll-like receptor signaling,
in monocytes from septic patients. Crit Care
Med 2006; 34:2377–2385
Calvano SE, Xiao W, Richards DR, et al: A
network-based analysis of systemic inflammation in humans. Nature 2005; 437:
1032–1037
Cavaillon JM, dib-Conquy M: Bench-tobedside review: Endotoxin tolerance as a
model of leukocyte reprogramming in sepsis.
Crit Care 2006; 10:233
Salomao R, Brunialti MKC, Gomes NE, et al:
Toll-like receptor pathway signaling is differently regulated in neutrophils and peripheral
mononuclear cells of patients with sepsis,
severe sepsis, and septic shock. Crit Care
Med 2009; 37:132–139
Dhillon SS, Mahadevan K, Bandi V, et al:
Neutrophils, nitric oxide, and microvascular
permeability in severe sepsis. Chest 2005;
128:1706 –1712
Chishti AD, Shenton BK, Kirby JA, et al:
Neutrophil chemotaxis and receptor expression in clinical septic shock. Intensive Care
Med 2004; 30:605– 611
Cook DN, Pisetsky DS, Schwartz DA: Tolllike receptors in the pathogenesis of human
disease. Nat Immunol 2004; 5:975–979
Arcaroli J, Silva E, Maloney JP, et al: Variant
IRAK-1 haplotype is associated with increased nuclear factor-kappaB activation and
worse outcomes in sepsis. Am J Respir Crit
Care Med 2006; 173:1335–1341
Etiologies of troponin elevation in critically ill patients with
gastrointestinal bleeding*
C
ardiac troponin is the most
important serum biomarker
for diagnosis and risk stratification of patients who present
with symptoms suggestive of acute coronary syndromes. Guidelines on the use
and interpretation of troponin have been
*See also p. 140.
Key Words: cardiac troponin; H. pylori; catecholamines
The author has not disclosed any potential conflicts of interest.
Copyright © 2008 by the Society of Critical Care
Medicine and Lippincott Williams & Wilkins
DOI: 10.1097/CCM.0b013e3181930fe1
Crit Care Med 2009 Vol. 37, No. 1
created from the disciplines of cardiology
(1), emergency medicine (2), and laboratory medicine (3). Despite widespread
availability and adoption into routine
clinical practice, there are still gaps in
the basic science knowledge, and clinical
interpretation of results, particularly in
patients with nonischemic etiologies. Although not absolutely proven, most clinical investigators believe that release of
troponin is an exclusive indicator of myocardial damage. Furthermore, patients
with troponin elevations typically have
worsening short- and/or long-term outcomes compared with similar patients
who have a normal troponin. Therapeutic
measures have not been established in
nonischemic injury, because the etiology
of troponin release is not known among
nonacute coronary syndrome patients.
This is particularly true for patients who
are critically ill. As the laboratory medicine community continues to improve
the analytical sensitivity of troponin assays and lowers the cutoff for myocardial
injury, the prevalence of troponin positivity among intensive care unit patients
will increase.
In this issue of Critical Care Medicine,
Vasile et al (4) described a relatively high
incidence of cardiac troponin increases in
a cohort of critically ill patients who
347
Biomarkers of sepsis
John C. Marshall, MD; Konrad Reinhart, MD; for the International Sepsis Forum
Background: A complex network of biological mediators underlies the clinical syndrome of sepsis. The nonspecific physiologic criteria of sepsis syndrome or the systemic inflammatory
response syndrome do not adequately identify patients who might
benefit from either conventional anti-infective therapies or from
novel therapies that target specific mediators of sepsis. Validated
biomarkers of sepsis may improve diagnosis and therapeutic
decision making for these high-risk patients.
Objectives: To develop a methodologic framework for the
identification and validation of biomarkers of sepsis.
Methods: A small group meeting of experts in clinical epidemiology, biomarker development, and sepsis clinical trials; selective narrative review of the biomarker literature.
Results: The utility of a biomarker is a function of the degree
to which it adds value to the available clinical information in the
S
epsis is a complex syndrome resulting from the innate host response to invasive infection.
Sepsis is considered to be severe
when accompanied by clinically important
derangements in physiologic organ system
function. When this process jeopardizes tissue perfusion, septic shock is said to be
present (1, 2). Severe sepsis and septic
shock are common indications for admis-
From the Li Ka Shing Knowledge Institute (JCM),
the Keenan Research Centre, and the Departments of
Surgery and Critical Care Medicine (JCM), St. Michael’s Hospital, and the University of Toronto (JCM),
Toronto, Ontario, Canada; and the Department of Anesthesiology and Intensive Care Medicine (KR),
Friedrich-Schiller University, Jena, Germany.
Dr. Marshall has consulted for Spatial Diagnosis and
has received honoraria from Eli Lilly. Dr. Reinhart has
consulted for BRAHMS-Diagnostics and has received
honoraria from BRAHMS-Diagnostics. Dr. Reinhart has
stock options in BRAHMS-Diagnostics and in USIRS-Lab.
This report is based on an expert colloquium on
biomarkers of sepsis convened by the International
Sepsis Forum (ISF) in October 2005. The ISF is a
not-for-profit organization dedicated to improving the
management of critically ill patients with sepsis. Its
activities are funded by unrestricted grants from a
variety of sponsors, including Eli Lilly, GSK, Eisai,
Takeda, Toray, Exponential Biotherapeutics, BRAHMS
Diagnostica, Spectral Diagnostics, Biosite, and Biomerieux.
For information regarding this article, E-mail:
marshallj@smh.toronto.on.ca
Copyright © 2009 by the Society of Critical Care
Medicine and Lippincott Williams & Wilkins
DOI: 10.1097/CCM.0b013e3181a02afc
2290
domains of screening, diagnosis, risk stratification, and monitoring of the response to therapy. We identified needs for greater
standardization of biomarker methodologies, greater methodologic rigor in biomarker studies, wider integration of biomarkers
into clinical studies (in particular, early phase studies), and increased collaboration among investigators, pharmaceutical industry, biomarker industry, and regulatory agencies.
Conclusions: Biomarkers promise to transform sepsis from a
physiologic syndrome to a group of distinct biochemical disorders. This transformation could aid therapeutic decision making,
and hence improve the prognosis for patients with sepsis, but will
require an unprecedented degree of systematic investigation and
collaboration. (Crit Care Med 2009; 37:2290 –2298)
KEY WORDS: sepsis; biomarkers; infection; risk stratification;
clinical trials
sion to an intensive care unit and the leading cause of morbidity and mortality for
critically ill patients (3, 4).
The widely used clinical definitions for
sepsis belie the fact that the process is
highly heterogeneous in its underlying
causes and expression, and that the clinical management and the prognosis for
recovery are equally variable. Patients
with sepsis typically differ with respect to
the inciting organism and focus on infection, and also vary with respect to optimal approaches to antibiotic selection
and surgical source control. A definite
microbiological diagnosis cannot be
made in one third or more of patients
with clinical manifestations of sepsis (5,
6). Furthermore, even when patients with
similar bacteriologic or anatomical presentations of infection are considered,
patterns of morbidity and the ultimate
prognosis for recovery vary from one patient to the other and from one geographic region to the next (6).
Sepsis arises through the activation of
an innate immune response, with changes
in the expression and activity of thousands
of endogenous mediators of inflammation,
coagulation, and intermediary metabolism
(7). Discrete components of this response,
therefore, are attractive experimental targets of therapy (8). Yet, unresolved heterogeneity—in both the biology of illness and
the clinical strategies used to support septic
patients— has hampered the development
and evaluation of therapies for sepsis. The
syndromes of sepsis, severe sepsis, and septic shock are defined by nonspecific alterations in physiology, rather than by specific
cellular processes that represent potential
therapeutic targets. Sepsis, as currently defined, comprises a concept (that morbidity
arises from the host response to infection)
that is imperfectly translated into a clinical
syndrome by the use of consensus-derived,
and nonspecific clinical and laboratory
variables (1, 2, 9). However, we currently
lack the capacity to delineate distinct populations of patients with a discrete disease—a key prerequisite to enable the development of specific biologically rational
therapies (10).
More than 100 distinct molecules have
been proposed as useful biological markers
of sepsis (11). It is not known which of
these provides truly useful information nor
even how such utility is best established.
The convergence of a conviction that identifying useful biomarkers of sepsis would
represent an important advance in sepsis
research, with the recognition that no explicit approaches exist to accomplish this
objective, prompted the International Sepsis Forum to convene the International
Sepsis Forum Colloquium on Biomarkers
of Sepsis in Toronto, Canada, October 28 –
30, 2005. Here, we reviewed emerging concepts in biomarker development and valiCrit Care Med 2009 Vol. 37, No. 7
Table 1. Uses of biomarkers
Screening
To identify patients at increased risk of adverse outcome to inform a prophylactic intervention,
or further diagnostic test
Diagnosis
To establish a diagnosis to inform a treatment decision, and to do so more reliably, more
rapidly, or more inexpensively than available methods
Risk stratification
To identify subgroups of patients within a particular diagnostic group who may experience
greater benefit or harm with therapeutic intervention
Monitoring
To measure response to intervention to permit the titration of dose or duration of treatment
Surrogate end point
To provide a more sensitive measure of the consequences of treatment that can substitute for a
direct measure of a patient-centered outcome
Uses of Biomarkers
Test
Positive Predictive Value:
Positive
a
b
a/a+b
Negative Predictive Value:
Negative
positive or negative likelihood ratios, respectively. Likelihood ratios have a distinct advantage over metrics, such as sensitivity, specificity, positive predictive
value, and negative predictive value, because they can be calculated for multiple
levels of the test. Furthermore, likelihood
ratios at differing values of the test can be
plotted graphically to produce a receiver
operating characteristics curve: superior
performance is reflected in a higher value
for the area under the receiver operating
characteristics curve.
c
d
d/d+c
Sensitivity
Specificity
a/a+c
d/b+d
Figure 1. Determination of the sensitivity, specificity, positive predictive value, and negative predictive
value of a diagnostic test. The positive likelihood ratio is calculated as the sensitivity/1-specificity, and
the negative likelihood ratio as 1-sensitvity/specificity. Positive likelihood ratios over the range of
values of the diagnostic test is represented by the receiver operating characteristics curve, the area
under the curve being a reflection of the accuracy of the test across a range of values.
dation, and integrated these with
recommendations of the colloquium for future research priorities.
A biomarker is “. . . a characteristic
that is objectively measured and evaluated as an indicator of normal biological
processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention” (12), or more simply, as a
“quantifiable measurement(s) of biological homeostasis that defines(s) what is
‘normal,’ therefore providing a frame of
reference for predicting or detecting what
is ‘abnormal’” (13). The utility of a biomarker lies in its capacity to provide
timely information beyond that which is
readily available from routine physiologic
data and clinical examination. This additional information may provide insight
into the pathogenesis or prognosis of a
disease process and also aid in a therapeutic decision; further, it may facilitate
titrating therapy or monitoring the response to intervention (Table 1).
The performance of a marker can be
evaluated by its sensitivity (its ability to
detect a disease in patients in whom the
disease is truly present) and its specificity
(its ability to rule out a disease in patients
in whom it is truly absent) (Fig. 1). IdeCrit Care Med 2009 Vol. 37, No. 7
ally, these properties should be established in a laboratory model of the disease
of interest to ensure that the test performs reliably and accurately under optimally controlled and reproducible circumstances. However, this is rarely
possible, and we typically use a test in an
ambiguous clinical setting where the diagnosis is uncertain. Furthermore, our
interest lies in knowing how likely it is
that if a test result indicates that the
disorder is absent, the disorder is truly
absent, and if the test result indicates
that the disorder is present, the disorder
is truly present. This information is embodied in test properties called the negative and positive predictive values, respectively (Fig. 1).
The discriminatory value of a diagnostic test is reflected in the ratio of the
measured positives in patients in whom
the disease is truly present (sensitivity),
to the measured positives in patients in
whom the disease is truly absent (1specificity). This ratio is known as the
likelihood ratio. A likelihood ratio of 1
indicates that the test performs no better
than random chance; the utility of the
test increases as the likelihood ratio becomes greater or less than 1, reflecting
A biomarker may serve one or more of
five overlapping roles (Table 1). It may
identify a patient with an increased probability of having a disease or an adverse
outcome, and also serve as a screening
test, detecting risk before the development of a clinical disease, or identifying a
patient who might warrant evaluation by
a more definitive, but expensive or invasive diagnostic test. For example, the
presence of occult blood in the stool suggests the possibility of colorectal cancer
and identifies a subpopulation of patients
who are more likely to benefit from
colonoscopy (14), whereas in a population of critically ill patients, an elevated
white blood cell count might trigger a
more intensive investigation to identify a
focus on infection.
Second, a biomarker may identify the
presence of a pathologic state or process
and also establish a diagnosis. Added
value arises from the capacity of the
marker to establish (or rule out) the diagnosis more reliably, more rapidly, or
more inexpensively than other available
measures.
Third, a biomarker may aid in risk
stratification—the parsing of an heterogeneous population of patients with a disease into a more homogeneous one, in
whom the potential for benefit with a
given therapeutic intervention is greater.
For women with breast cancer, for example, estrogen receptor positivity defines a
population of patients who might benefit
from hormonal manipulation, whereas
the presence of the human epithelial
growth factor receptor 2 biomarker identifies a subpopulation of patients who
might benefit from herceptin (15). Risk
stratification implies differential prognosis, the identification of patients who are
not only more likely to have either a
favorable or an unfavorable outcome but
2291
Table 2. Sources of variability in the measurement of cytokines in sepsis
Approaches to the Identification
of Biomarkers
Assay methodology
Bioassay
Immunoassay: enzyme-linked immunosorbent
assay, bead, radioimmunoassay
Reference standards
Site of sampling
Cellular: membrane, cytoplasmic, nuclear
Regional (e.g., bronchoalveolar lavage fluid)
Systemic (blood): whole blood, plasma,
leukocytes, leukocyte subsets
Requirement for activation
E.g., protein C, transforming growth factor ␤
Presence of soluble receptors, circulating
inhibitors, and carrier proteins
Potential biomarkers are identified by
several approaches. First, a marker may be
selected on the basis of a biologically compelling association with a disease state or a
candidate therapeutic intervention. In patients with sepsis, for example, circulating
endotoxin might be a marker of a patient
with Gram-negative infection and would be
anticipated to identify a patient who might
benefit from treatment with an agent that
neutralizes endotoxin. Conversely, circulating tumor necrosis factor (TNF), or a
downstream molecule such as interleukin-6 whose release is induced by TNF, is
an intuitively attractive marker of a patient
who might benefit from a therapy that neutralizes TNF.
A biomarker may also be identified
serendipitously on the basis of an apparent association with a disease in the absence of a biologically plausible link. Procalcitonin (PCT) levels, for example, were
observed to be increased in patients with
infection and to drop in response to adequate antibiotic therapy (19).
Finally, biomarkers may be identified
by using unbiased approaches in which
large numbers of molecular species are
assayed using microarray or proteomic
approaches to identify those species that
are differentially expressed in the population of interest. The advent of techniques
to simultaneously detect changes in
many thousands of molecular species—
messenger RNA transcripts using microarrays (20) or peptides in biological
samples using mass spectrometry approaches (21)— has opened the possibility of genome-wide screening for candidate biomarkers. At the same time, the
sheer volume of information generated
creates enormous challenges in bioinformatics. The challenge is compounded by
the fact that leukocyte transcriptomics
and plasma proteomics in systemic inflammatory response syndrome yield discordant results if the circulating cell pool
is not the source of the proteomic response (22). The selection of appropriate
controls is crucial to ensure that changes
detected are the consequence of the process of interest, and not, for example, of
an unrelated clinical intervention such as
transfusion.
also who are more or less likely to respond to a particular therapy.
Fourth, a biomarker whose levels
change dynamically as the patient responds (or fails to respond) to treatment
provides the clinician with information to
monitor the response to intervention and
also to titrate or modify the therapeutic
intervention. In the intensive care setting, glucose levels provide information
that allows the clinician to titrate insulin
therapy, whereas the activated partial
thromboplastin time guides the optimal
dosing of heparin.
Finally, if changes in the level of the
biomarker can be shown to correlate consistently with clinically important patient
outcomes, then the marker may find a
role as a surrogate outcome measure for
preventive or therapeutic interventions,
particularly during an early phase clinical
research (16). Surrogate end points are
outcomes that substitute for direct measures of how a patient feels, functions, or
survives (17). Surrogate end points include physiologic or laboratory variables
(for example, blood pressure as a surrogate end point for stroke) or measures of
subclinical disease (e.g., degree of atherosclerosis on coronary angiography as a
surrogate end point for the risk of myocardial infarction or cardiac death). The
substitution of a biomarker as a surrogate
end point for patient-important outcomes is attractive when the biomarker
can be measured earlier, more easily,
more frequently, with higher precision or
with less confounding by competing risks
or other therapies. To be valid for this purpose, the biomarker must not only correlate with the patient-important outcome
but also must capture, to the greatest possible extent, the net effect of the intervention on the patient-important outcome
(18). We will come back to this issue later.
2292
Biomarker Validation
The validation of a biomarker requires
consideration of three discrete domains
of the biomarker’s performance:
●
●
●
Demonstration that the assay truly
measures a particular molecular species, or its relevant biological activity
Demonstration that measurement of
the biomarker discriminates patients
with a disease from those who are free
from the disease, and/or stratifies patients having a disease on the basis of
their risk of adverse outcome
Demonstration that measurement of
the biomarker can inform a clinical
decision that leads to improved patient
outcomes
What Does the Assay Measure?
Conclusions from cohort studies of biomarker levels are often discordant, reflecting the multiple sources of variability
that may arise through subtle differences
in assay methodology, reagents, and site
of sampling, and the confounding effects
of carrier proteins and circulating inhibitors (Table 2).
For example, endotoxin from Gramnegative bacteria is commonly present in
the circulation of patients with both infectious and noninfectious acute illnesses
(23, 24). The classic assay for endotoxin
has been the Limulus amebocyte lysate
assay, a bioassay based on the capacity of
endotoxin to induce coagulation of a lysate from the hemolymph of the horseshoe crab, Limulus polyphemus (25). The
reaction is not specific to endotoxin, but
can also be activated by other microbial
products, particularly components of
fungal cell walls (26). Conversely, endogenous plasma proteins inhibit the reaction, reducing the reliability of the assay
in protein-containing biological fluids
(27). Furthermore, endotoxin in vivo is
transported bound to a specific carrier
protein, and its activity inhibited by other
endogenous proteins, thus even when endotoxin is detected, it may not be biologically active. A bioassay based on the
priming of neutrophil respiratory burst
activity by complexes of endotoxin and
antiendotoxin antibody has recently been
reported (24); its utility and limitations
still have to be established.
Comparable challenges arise in the assay of host-derived mediators such as
TNF. Circulating TNF can be detected by
assay of immunoreactive protein (by enzyme-linked immunosorbent assay or using multiplex bead array technology [28])
or assay of circulating bioactivity (the
L929 or Walter and Eliza Hall Institute
cell cytotoxicity assays). Quantitative data
obtained from immunoassays typically
Crit Care Med 2009 Vol. 37, No. 7
Figure 2. Cytokine data from a multicenter study of a monoclonal antibody to tumor necrosis factor
(TNF) in patients with septic shock (31). Although the antibody reduced levels of immunoreactive TNF
(A), it did not reduce the levels of bioactive TNF (B), and failed to impact levels of the downstream
cytokine, interleukin (IL)-6 (C). Thus, the absence of a mortality benefit may reflect the use of a
biologically inactive therapy. ELISA, enzyme-linked immunosorbent assay.
vary with the supplier of the assay and the
nature of the antibody and reference
standards used (29, 30). Furthermore,
the association of immunoreactive protein with biological activity is inconsistent. In a phase III trial of a monoclonal
antibody to TNF (31), treated patients
were found to have increased circulating
levels of the therapeutic antibody and reduced levels of immunoreactive TNF;
however, the levels of TNF bioactivity
were comparable in the two populations
(Fig. 2). It is further uncertain whether
the biologically active TNF is that found
in the circulation, or that which remains
expressed on the cell surface (32), how
TNF bioactivity might be modified
through the concomitant shedding of cell
surface receptors (33), and whether levels
in the circulation are relevant to disease
processes that are effected in the microenvironment of specific tissues.
Biomarker Prevalence in an AtRisk Population
In patients with sepsis, evaluation of a
biomarker hinges on appropriate consideration of two issues:
1. What is the disease, and what is the
gold standard diagnostic criterion
Crit Care Med 2009 Vol. 37, No. 7
against which the marker will be
tested?
2. What is the appropriate control group
in which the disease is considered to
be absent?
Both pose daunting challenges.
The evaluation of a novel diagnostic
marker requires its comparison with an
existing measure, colloquially known as the
gold standard. This might be a test that
definitively establishes the presence of a
disease—malignant cells in a histologic
specimen from a lymph node establishing
the presence of metastases or viable microorganisms in a lung biopsy establishing the
diagnosis of pneumonia. More often, however, the diagnostic gold standard is one
that has established its authority by use
over time—for example, S-T elevation on
an electrocardiogram as the standard for
acute myocardial infarction, or quantitative
cultures of the urine as the standard for a
urinary tract infection. However, there is
no comparable standard for the diagnosis of
sepsis. First, sepsis is a concept—that of
disease arising from the host response to
infection—rather than a measurable
pathologic process. Second, that concept is
a complex one that hinges on documentation of both infection and a response. Third,
that response is nonspecific, defined by
consensus criteria that emphasize physiologic changes in vital parameters that are
common to a number of disparate processes.
In the absence of an objective pathologic gold standard, the definition of sepsis depends not on arbitrary clinical criteria but on the specific decision that is to
be made. If the decision is to initiate
antibiotic therapy, the definition, and
therefore the diagnostic criteria, must reflect the presence or absence of infection,
and the identity of the infecting microorganism. If the decision is to use activated
protein C, the question of interest is the
presence or absence of deficient protein C
activity, or the potential to respond to
supplementation. The gold standard
against which a biomarker of sepsis is
evaluated must be defined with reference
to the clinical decision that the marker
will inform, and will also vary with the
biomarker.
The ideal control group is one that is
similar in all readily measurable characteristics to the population that the biomarker defines, but whose outcome
without intervention differs from that of
the population in which the biomarker is
present (34). In other words, the populations should reflect true diagnostic uncertainty. The apparent utility of a biomarker or diagnostic test can be
overestimated if the control group is systematically different from the population
in whom the marker is studied (for example, if the controls are healthy laboratory volunteers), a form of bias termed
spectrum bias (35).
Impact of Biomarker-Directed
Decision Making on Clinical
Outcomes
The most compelling validation of the
biomarker performance is demonstration
that the biomarker differentially identifies patients who experience benefit from
a particular intervention. For example,
demonstration of microsatellite stability
in colonic cancers identifies a subgroup
of patients who will benefit from treatment with 5-fluorouracil (36), whereas
expression of the human epithelial
growth factor receptor 2 on breast cancer cells identifies a population of patients whose survival can be prolonged
by the administration of herceptin (15).
Although documentation that a biomarker can effectively stratify patients who are
candidates for therapy provides convincing
2293
Figure 3. A large multicenter study randomized
patients with severe sepsis to treatment with an
antibody to tumor necrosis factor (TNF) or placebo,
stratifying patients on the basis of baseline levels of
interleukin (IL)-6 (38). Although the impact on
mortality was statistically significant in an adjusted
analysis of IL-6 –positive patients, the incremental
benefit over IL-6 –negative patients was minimal.
The selected cutoff of 1000 pg/mL may have been
too low: analysis of the treatment effect over a range
of IL-6 values revealed a greater separation of the
mortality curves of placebo and anti-TNF–treated
patients at higher levels of IL-6. MAb, monoclonal
antibody.
evidence of clinical utility, it does require
the performance of adequately powered
studies to document benefit when the positive predictive value of the marker is being
tested, or equivalence or noninferiority,
when it is the negative predictive value that
is the parameter of interest. Several trial
designs are possible (37). An interventional
study can be performed in which patients
receiving one or other of two therapies are
stratified on the basis of the marker of interest and differential efficacy in the two
strata compared. This approach was
used in a recently published study of an
antibody to TNF in which patients were
stratified by baseline interleukin-6 levels of more or less than 1000 pg/mL
(38) (Fig. 3). Alternatively, patients may
be randomized to have therapy directed
by the marker, or provided without
knowledge of the marker, and the differential consequences assessed. This
latter design was used in a randomized
trial assessing the utility of PCT levels
in informing therapy in patients presenting to an emergency department
with acute respiratory symptoms (39),
and in a study of the use of PCT levels
to direct the duration of antibiotic therapy for patients with communityacquired pneumonia (40).
Biomarkers as Surrogate
Outcome Measures
A surrogate outcome measure is an
“end point measured in lieu of some
2294
other so-called true end point” (41)— one
that, while not itself a measure of a patient-centered outcome, reliably and consistently predicts a clinical outcome. Surrogate outcome measures are commonly
used in clinical trials evaluating new
therapies for infectious diseases, for example, clinical response rates in studies
of antibiotic therapy for intra-abdominal
infection (42), or viral load in studies of
treatments for human immunodeficiency
virus (43). Surrogate outcomes have generally been dismissed as appropriate outcomes for sepsis trials (44), for the critical care literature is replete with studies
of interventions that have improved a
physiologic or biochemical end point, but
actually worsened survival (45– 48). Conversely, wider use of surrogate measures
could prove invaluable during an early
phase clinical research in establishing
proof of principle, in refining study entry
criteria, and in establishing optimal dose
and duration of therapy.
A valid surrogate measure must satisfy
three criteria: it must predict disease progression, be affected by therapy, and respond to the same biological processes
that are thought to mediate the clinically
important outcome (18).
The optimal use of biomarkers as surrogates in informing the design of definitive clinical trials presupposes a valid
and extensive understanding of the natural history of the biomarker in the population of interest, and how its levels are
modified by therapeutic intervention.
These data can then be integrated using
meta-analytic techniques (49) to evaluate
the capacity of a biomarker to predict a
clinically important outcome. A methodology for evaluating the level of evidence
that a given biomarker might serve as a
reliable surrogate outcome measure has
recently been proposed (50), but its utility in the assessment of biomarkers for
diseases such as sepsis where mortality is
considerable is unknown.
Biomarkers in Sepsis Research
and Clinical Management
Although biomarkers of sepsis are not
widely used in research or clinical practice, it is possible to evaluate the utility of
approaches that are currently available.
We will consider these within the framework of the nascent PIRO model—a
model that seeks to stratify patients with
sepsis in the four domains of predisposition, insult, response, and organ dysfunction (2).
Is the Patient at Increased Risk
of Adverse Outcome?
Polymorphisms in innate immunity
genes are common and result in significant interindividual variability in response to a given insult (51). Indeed, the
risk of dying from an infectious disease is
much more dependent on genetic than
on environmental factors (52). Single nucleotide polymorphisms can be readily
detected using polymerase chain reaction-based approaches (53), although
such techniques are not currently optimized for rapid diagnosis. Single nucleotide polymorphism analyses are likely to
be of greatest importance when an intervention targets a single key mediator. It
has become apparent, for example, that
the presence of a G-⬎A polymorphism at
⫺308 in the promoter region of the
TNF␣ gene is associated with differential
responsiveness to anti-TNF therapy in
rheumatoid arthritis (54), although not
in inflammatory bowel disease (55).
Current studies of genetic markers in
sepsis extend beyond individual candidate
gene variations and include genome-wide
approaches, which promise insights into
genes and their variations not commonly
studied in sepsis. New techniques, such
as genomic microarray assays, enable detection of hundreds of thousands of single nucleotide polymorphisms in a single
patient, and also mostly reflect an individual’s genomic uniqueness.
Is the Patient Infected?
Knowledge that a clinical syndrome of
systemic inflammation is likely a consequence of invasive bacterial or fungal infection prompts the clinician to initiate
appropriate empirical antibiotic therapy
and to look for a locus of infection amenable to source control measures. Conversely, confidence that infection is unlikely to be present permits the clinician
to withhold or discontinue antibiotics.
The consequences are not only a reduction in costs but also minimization of the
adverse consequences of therapy, including superinfection with organisms such
as Clostridium difficile (56).
The commonly used laboratory parameter of leukocytosis has a very low
sensitivity and specificity for the diagnosis of infection, with a likelihood ratio of
1.5; band counts have a similarly low
diagnostic accuracy (57, 58). C-reactive
protein levels provide greater diagnostic
information than temperature elevation
Crit Care Med 2009 Vol. 37, No. 7
Table 3. Summary recommendations
We recommend that steps be taken to standardize assays for the measurement of biomarkers of
sepsis, and to identify and understand the sources of differences among techniques, for example,
bioassays vs. immunoassays, cell-bound vs. free protein, target biomarkers vs. levels of
circulating inhibitors, and the confounding effects of inhibitors and carrier proteins. Similarly,
the performance of microarray analyses must be standardized with respect to platforms,
composition of arrays, and methods of data analysis
We recommend that studies of biomarkers of sepsis be performed using rigorous methodologic
approaches to characterize the added value provided by the maker. Such approaches can include
inception cohort studies, case–control studies, or randomized clinical trials, analyzed using
multivariable techniques to define the independent diagnostic or prognostic value of the marker
We recommend wider use of validated biomarkers to assist in the decision-making process in
guiding the transition from early phase clinical research to definitive trials with clinically
important end points
We urge that clinical trials be used as platforms to identify and validate potentially useful
biomarkers of sepsis—both to evaluate drug efficacy and to generate knowledge on variability in
populations and changes with the evolution of disease
Notwithstanding the insights that can be gained from intensive evaluation within clinical trials and
pooling of data across studies, we perceive a clear need for one or more large, intensive,
comprehensive international study to define the biochemical natural history of sepsis, and to
determine the association of biomarkers with disease progression, prognosis, and response to
treatment
We urge increased collaboration between companies involved in diagnostics, and those involved in
therapeutics, as well as greater collaboration among industry, clinical investigators, and
regulatory agencies to advance our understanding of biomarkers in sepsis
in the diagnosis of infection in critically
ill patients (59). However, systematic reviews suggest that PCT is superior to
C-reactive protein, as evidenced by
greater sensitivity, a higher positive likelihood ratio, and a greater area under the
receiver operating characteristics curve
(60, 61). Bronchoalveolar lavage levels of
soluble triggering receptor expressed on
myeloid cells-1 have been reported to be
particularly accurate in the diagnosis of
pneumonia, with a likelihood ratio of
10.4 (62); however, this marker has not
been evaluated as extensively as PCT or
C-reactive protein and requires the performance of an invasive procedure. The
absence of elevated levels of circulating
endotoxin appears to rule out a diagnosis
of invasive Gram-negative infection (24).
What is the Microorganism?
The identification of an infecting microorganism using conventional microbiological techniques is inherently slow.
Gram’s stain can provide general information on the presence of a microorganism; however, growth on culture media
and subsequent identification by laboratory techniques are needed to define the
species of the organism and exposure to
antibiotic-impregnated discs to determine antibiotic sensitivity. As a consequence, a definitive microbiological diagnosis may not be available until several
days after the onset of the septic episode.
Crit Care Med 2009 Vol. 37, No. 7
Rapid assays based on spectroscopy or
polymerase chain reaction are under development and hold the promise of being
able to detect multiple bacterial species,
and to provide precise information on the
presence of particular strains (63, 64).
They are available for clinical use in Europe; although they are sensitive to low
levels of bacterial DNA, their correlation
with clinically significant infection is uncertain, and they suffer from an inability
to differentiate viable from nonviable organisms.
Will This Patient Benefit from
Specific Adjunctive Therapy?
Rapid diagnosis of the presence of elevated levels of a specific target of an
adjuvant treatment—TNF or endotoxin,
for example— or of reduced levels of a
critical factor for replacement therapy—
protein C, antithrombin, or interferon
gamma, for example—is a prerequisite
for the rational use of expensive and potentially toxic therapies (65).
Initial hopes that circulating interleukin-6 might identify patients who would
benefit from treatments directed against
TNF have proven disappointing (38), although it is possible that a higher cutoff
for the diagnostic test would provide
greater diagnostic accuracy (Fig. 3). The
hypothesis that a state of relative adrenal
insufficiency—identified on the basis of
response to an adrenocorticotropic hor-
mone stimulation test— defines a highrisk population who will benefit from
treatment with exogenous corticosteroids
(66) has been challenged by a recently
published European study (67). Although
there is evidence that patients with biochemical evidence of disseminated intravascular coagulation experience greater
therapeutic benefit from activated protein C than patients who do not have
disseminated intravascular coagulation
(68), a reliable and validated biomarker to
guide the use of this agent is not currently available. Reduced expression of
the major histocompatibility marker, human leukocyte antigen, D-related, has
been proposed as a biomarker for patients
who might benefit from treatment with
recombinant interferon gamma (69);
however, further study is needed.
Given the enormous complexity and
redundancy of the innate immune response, it is entirely plausible that the
optimal use of biomarkers will require
their integration into panels involving a
number of analytes (70). Yet, even this
approach poses substantial challenges.
Wang et al (71) found that a panel of ten
biomarkers of cardiac risk provided significant prognostic information for the
population, but when applied to individual patients to evaluate capacity to predict risk beyond that available by conventional methods, the incremental benefit
was small. A strong association between
one or more biomarkers and population
outcome will only translate into a useful
diagnostic test if the distributions of the
marker in affected and unaffected patients overlap only minimally (72).
Conclusions and
Recommendations
Although there is widespread enthusiasm for a future role for the widespread
use of biomarkers to inform the optimal
management of the patient with sepsis,
the field at present is underdeveloped.
This underdevelopment provides the basis for the recommendations of this colloquium, summarized in Table 3.
First, there is substantial variability in
the performance characteristics of available assays, in the types of assays used,
and in the reference standards used to
validate the assays. This has led to divergent study findings and to often discordant conclusions regarding the implications of changes in the expression of the
biomarker of interest. We identified a
need for a greater standardization of as2295
say methodologies and for systematic
comparisons of differing assay systems to
more precisely understand their differences. We further recommend that published reports of biomarkers provide detailed information about the assay
platform used, its performance characteristics, and the methods used for calibration.
We urge that investigators engaged in
the study of novel biomarkers of sepsis
use methodologically rigorous research
designs and avail themselves of the rapidly increasing body of literature on the
optimal conduct of studies of novel biomarkers. Cohort designs should report
more than a simple association between a
marker and an adverse outcome, such as
death, and should seek to define the additional information that measurement
of the biomarker provides. For diagnostic
markers, an explicit, rigorous, and
blinded process of adjudication of the
clinical state that the marker is believed
to diagnose (for example, ventilatorassociated pneumonia or progression to
septic shock) should be used and reported. We also recommend interventional study designs can be put to more
use to assess, either indirectly or directly,
the impact of the marker on clinical outcome (37). Finally, we recommend that
authors of studies of biomarkers for sepsis adhere to emerging guidelines for the
reporting of diagnostic studies, as articulated by the Standards of Reporting of
Diagnostic Accuracy initiative (73).
We perceive an important missed opportunity in the use of biomarkers to
inform the development of an early stage
clinical research of therapies for sepsis
and encourage the wider use of biomarkers as a mechanism for post hoc stratification to detect differential therapeutic
efficacy in discrete, and biologically plausible subgroups of patients, and as surrogate outcome measures to detect proof of
concept and characterize the biochemical
consequences of intervention. Surrogate
outcome measures can be of critical importance in an early phase clinical research in defining optimal patient populations to receive an intervention and in
titrating the optimal dose and duration of
treatment.
We urge those involved in large-scale
randomized trials of treatments for sepsis
to incorporate the measurement of a
panel of biomarkers into the trial design,
both to aid in future decisions regarding
the use of the agent in the clinical arena,
and to enhance our understanding of the
2296
natural history of sepsis, and the effects
of specific interventions on its biological
evolution.
Although valuable insights into the diagnostic and prognostic role of specific
biomarkers can be gained from small cohort studies and interventional studies,
the future evolution of critical care practice would benefit greatly from an enhanced understanding of natural history,
and the development of disease descriptions based on distinct patterns of biochemical derangement, rather than on
the nonspecific physiologic consequences
of these events. We see the need for a
comprehensive biological natural history
study on the course of critical illness,
designed to characterize the biochemical
evolution, to facilitate therapeutic stratification and staging, and to understand
the interaction of the changes of acute
illness with therapeutic interventions.
Such a study would proceed through the
analysis of a large, heterogeneous cohort
of patients, recruited on the criteria of
being acutely ill (rather than the more
restrictive criteria of systemic inflammatory response syndrome or acute respiratory distress syndrome, for example) and
could evaluate the extent to which biological patterns of illness correlate with
clinical manifestations and further facilitate the development of a robust staging
system such as that proposed in the PIRO
model.
Finally, it is clear that progress in sepsis research will require much greater
collaboration among international
groups of investigators, and between academia, industry, and regulatory agencies.
We see the need for investigator-driven
initiatives to define a research agenda,
and to coordinate efforts to identify, validate, and implement clinically useful biomarkers for the management of septic
patients. We urge greater collaboration
between therapeutics and diagnostic
companies in evaluating the diagnostic
roles of specific biomarkers, and evaluating their response to therapeutic intervention. And we see a need for ongoing
interactions among clinicians, investigators, industry, and regulatory agencies to
improve the diagnosis and management
of a vulnerable population of patients.
The transformation of a clinical syndrome into one or more diseases that can
be characterized biologically is a prerequisite to the development of effective
therapies. We look forward to the continuing evolution of critical care practice
from its current role of nonspecific organ
support to a discipline whose focus is the
treatment of distinct diseases whose
pathophysiology we only dimly understand today, and whose diagnosis remains, at present, elusive.
ACKNOWLEDGMENTS
We thank Elaine Rinicker and Peter
Mainprice for logistic support for the
symposium. We also acknowledge the
contribution of all who participated in
the International Sepsis Forum Symposium on Biomarkers of Sepsis: Co-chairs:
John C. Marshall, Konrad Reinhart; Participants: Edward Abraham, Djillali Annane, Thierry Calandra, Deborah J. Cook,
R. Phillip Dellinger, Jean-Francois
Dhainaut, Paul Hébert, Daren Heyland,
Lyle Moldawer, Rui Moreno, Steven Opal,
Frank Stüber, Jean-Louis Vincent, and
Hans-Dieter Volk.
REFERENCES
1. Bone RC, Balk RA, Cerra FB, et al: Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in
sepsis. The ACCP/SCCM Consensus Conference. American College of Chest Physicians/
Society of Critical Care Medicine. Chest
1992; 101:1644 –1655
2. Levy MM, Fink M, Marshall JC, et al: 2001
SCCM/ESICM/ACCP/ATS/SIS International
Sepsis Definitions Conference. Crit Care Med
2003; 34:1250 –1256
3. Martin GS, Mannino DM, Eaton S, et al: The
epidemiology of sepsis in the United States
from 1979 through 2000. N Engl J Med 2003;
348:1546 –1554
4. Angus DC, Linde-Zwirble WT, Lidicker J, et
al: Epidemiology of severe sepsis in the
United States: Analysis of incidence, outcome, and associated costs of care. Crit Care
Med 2001; 29:1303–1310
5. Sands KE, Bates DW, Lanken PN, et al: Epidemiology of sepsis syndrome in 8 academic
medical centers. JAMA 1997; 278:234 –240
6. Vincent J-L, Sakr Y, Sprung CL, et al: Sepsis
in European intensive care units: Results of
the SOAP study. Crit Care Med 2006; 34:
344 –353
7. Calvano SE, Xiao W, Richards DR, et al: A
network-based analysis of systemic inflammation in humans. Nature 2005; 437:
1032–1037
8. Marshall JC: Such stuff as dreams are made
on: Mediator-targeted therapy in sepsis. Nat
Rev Drug Discov 2003; 2:391– 405
9. Bone RC, Fisher CJ, Clemmer TP, et al: Sepsis syndrome: A valid clinical entity. Crit
Care Med 1989; 17:389 –393
10. Marshall JC: Rethinking sepsis: From concepts to syndromes to diseases. Sepsis 1999;
3:5–10
11. Marshall JC, Vincent J-L, Fink MP, et al:
Crit Care Med 2009 Vol. 37, No. 7
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
Measures, markers, and mediators: Towards
a staging system for clinical sepsis. Crit Care
Med 2003; 31:1560 –1567
Biomarkers Definitions Working Group: Biomarkers and surrogate endpoints: Preferred
definitions and conceptual framework. Clin
Pharmacol Ther 2001; 69:89 –95
Dalton WS, Friend SH: Cancer biomarkers—An invitation to the table. Science 2006;
312:1165–1168
Fisher JA, Fikry C, Troxel AB: Cutting cost
and increasing access to colorectal cancer
screening: Another approach to following the
guidelines. Cancer Epidemiol Biomarkers
Prev 2006; 15:108 –113
Duffy MJ: Predictive markers in breast and
other cancers: A review. Clin Chem 2005;
51:494 –503
Weir CJ, Walley RJ: Statistical evaluation of
biomarkers as surrogate endpoints: A literature review. Stat Med 2006; 25:183–203
Bucher H, Guyatt G, Cook D, et al: Surrogate
outcomes. In: The Users’ Guide to the Medical Literature: A Manual for Evidence-Based
Clinical Practice. Guyatt G, Rennie D, (Eds).
Chicago, IL, AMA Publications, 2002
Prentice RL: Surrogate endpoints in clinical
trials: Definition and operational criteria.
Stat Med 1989; 8:431– 440
Assicot M, Gendrel D, Carsin H, et al: High
serum procalcitonin concentrations in patients with sepsis and infection. Lancet 1993;
341:515–518
Feezor RJ, Cheng A, Paddock HN, et al:
Functional genomics and gene expression
profiling in sepsis: Beyond class prediction.
Clin Infect Dis 2005; 41(Suppl 7):S427–S435
Liu T, Qian WJ, Gritsenko MA, et al: High
dynamic range characterization of the
trauma patient plasma proteome. Mol Cell
Proteomics 2006; 5:2167–2174
Tomic V, Russwurm S, Moller E, et al: Transcriptomic and proteomic patterns of systemic inflammation in on-pump and offpump coronary artery bypass grafting.
Circulation 2005; 112:2912–2920
Opal SM, Scannon PJ, Vincent JL, et al: Relationship between plasma levels of lipopolysaccharide (LPS) and LPS-binding protein in
patients with severe sepsis and septic shock.
J Infect Dis 1999; 180:1584 –1589
Marshall JC, Foster D, Vincent J-L, et al:
Diagnostic and prognostic implications of
endotoxemia in critical illness: Results of the
MEDIC study. J Infect Dis 2004; 190:527–534
Levin J, Bang FB: Clottable protein in Limulus: Its localization and kinetics of its coagulation by endotoxin. Thromb Diath Haemorrh 1968; 19:186 –197
Mitazaki T, Kohno S, Mitsutake K, et al:
(1–⬎3)-beta-D-glucan in culture fluid of
fungi activates factor G, a limulus coagulation factor. J Clin Lab Anal 1995; 9:334 –339
Roth RI, Levin FC, Levin J: Optimization of
detection of bacterial endotoxin in plasma
with the limulus test. J Lab Clin Med 1990;
116:153–161
Elshal MF, McCoy JP: Multiplex bead array
Crit Care Med 2009 Vol. 37, No. 7
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
assays: Performance evaluation and comparison of sensitivity to ELISA. Methods 2006;
38:317–323
Sweep FC, Fritsche HA, Gion M, et al;
EORTC-NCI Working Group: Considerations
on development, validation, application, and
quality control of immuno(metric) biomarker assays in clinical cancer research: An
EORTC-NCI working group report. Int J Oncol 2003; 23:1715–1726
Lash GE, Scaife PJ, Innes BA, et al: Comparison of three multiplex cytokine analysis systems: Luminex, SearchLight and FAST
Quant. J Immunol Methods 2006; 309:
205–208
Abraham E, Anzueto A, Gutierrez G, et al:
Double-blind randomised controlled trial of
monoclonal antibody to human tumour necrosis factor in treatment of septic shock.
Lancet 1998; 351:929 –933
Pellegrini JD, Puyana JC, Lapchak PH, et al:
A membrane TNF␣/TNFR ratio correlates to
MODS score and mortality. Shock 1996;
6:389 –396
McDermott MF: TNF and TNFR biology in
health and disease. Cell Mol Biol 2001; 47:
619 – 635
Montori VM, Guyatt GH: Summarizing studies of diagnostic performance. Clin Chem
2003; 49:1783–1784
Lijmer JG, Mol BW, Heisterkamp S, et al:
Empirical evidence of design-related bias in
studies of diagnostic tests. JAMA 1999; 282:
1061–1066
Ribic CM, Sargent DJ, Moore MJ, et al: Tumor microsatellite-instability status as a predictor of benefit from fluorouracil-based adjuvant chemotherapy for colon cancer.
N Engl J Med 2003; 349:247–257
Sargent DJ, Conley BA, Allegra C, et al: Clinical trial designs for predictive marker validation in cancer treatment trials. J Clin Oncol 2005; 23:2020 –2027
Panacek EA, Marshall JC, Albertson TE, et al:
Efficacy and safety of the monoclonal antiTNF antibody F(ab⬘)2 fragment afelimomab
in patients with severe sepsis stratified by
IL-6 level. Crit Care Med 2004; 32:2173–2182
Christ-Crain M, Jaccard-Stolz D, Bingisser R,
et al: Effect of procalcitonin-guided treatment on antibiotic use and outcome in lower
respiratory tract infections: Cluster-randomised, single-blinded intervention trial. Lancet
2004; 363:600 – 607
Christ-Crain M, Stolz D, Bingisser R, et al:
Procalcitonin guidance of antibiotic therapy
in community-acquired pneumonia—A randomized trial. Am J Respir Crit Care Med
2006; 174:84 –93
Wittes J, Lakatos E, Probstfield J: Surrogate
endpoints in clinical trials: Cardiovascular
diseases. Stat Med 1989; 8:415– 425
Solomkin JS, Reinhart HH, Dellinger EP, et
al: Results of a randomized trial comparing
sequential intravenous oral treatment with
ciprofloxacin plus metronidazole to imipenem cilastatin for intra-abdominal infections. Ann Surg 1996; 223:303–315
43. Walmsley S, Bernstein B, King M, et al: Lopinavir-ritonavir versus nelfinavir for the initial treatment of HIV infection. N Engl J Med
2002; 346:2039 –2046
44. Marshall JC, Vincent JL, Guyatt G, et al:
Outcome measures for clinical research in
sepsis: A report of the 2nd Cambridge Colloquium of the International Sepsis Forum.
Crit Care Med 2005; 33:1708 –1716
45. Hebert PC, Wells G, Blajchman MA, et al: A
multicentre randomized controlled clinical
trial of transfusion requirements in critical
care. N Engl J Med 1999; 340:409 – 417
46. Takala J, Ruokonen E, Webster NR, et al:
Increased mortality associated with growth
hormone treatment in critically ill adults.
N Engl J Med 1999; 341:785–792
47. Brower RG, Matthay MA, Morris A, et al:
Ventilation with lower tidal volumes as compared with traditional tidal volumes for acute
lung injury and the acute respiratory distress
syndrome. N Engl J Med 2000; 342:
1301–1308
48. Lopez A, Lorente JA, Steingrub J, et al: Multiple-center, randomized, placebo-controlled, double-blind study of the nitric oxide
synthase inhibitor 546C88: Effect on survival
in patients with septic shock. Crit Care Med
2004; 32:21–30
49. Daniels MJ, Hughes MD: Meta-analysis for
the evaluation of potential surrogate markers. Stat Med 1997; 16:1965–1982
50. Lassere MN, Johnson KR, Boers M, et al:
Definitions and validation criteria for biomarkers and surrogate endpoints: Development and testing of a quantitative hierarchical levels of evidence schema. J Rheumatol
2007; 34:607– 615
51. Holmes CL, Russell JA, Walley KR: Genetic
polymorphisms in sepsis and septic shock:
Role in prognosis and potential for therapy.
Chest 2003; 124:1103–1115
52. Sorenson TI, Nielsen GG, Andersen PK, et al:
Genetic and environmental influences on
premature death in adult adoptees. N Engl
J Med 1988; 318:727–732
53. Chen X, Sullivan PF: Single nucleotide polymorphism genotyping: Biochemistry, protocol, cost and throughput. Pharmacogenomics J 2003; 3:77–96
54. Seitz M, Wirthmuller U, Moller B, et al: The
-308 tumour necrosis factor-{alpha} gene
polymorphism predicts therapeutic response
to TNF{alpha}-blockers in rheumatoid arthritis and spondyloarthritis patients. Rheumatology (Oxford) 2007; 46:93–96
55. Zipperlen K, Peddle L, Melay B, et al: Association of TNF-alpha polymorphisms in
Crohn disease. Hum Immunol 2005; 66:
56 –59
56. McDonald LC, Killgore GE, Thompson A, et
al: An epidemic, toxin gene-variant strain of
Clostridium difficile. N Engl J Med 2005;
353:2433–2441
57. Davis BH, Bigelow NC: Comparison of neutrophil CD64 expression, manual myeloid
immaturity counts, and automated hematol-
2297
58.
59.
60.
61.
62.
ogy analyzer flags as indicators of infection
or sepsis. Lab Hematol 2005; 11:137–147
Bogar L, Molnar Z, Kenyeres P, et al: Sedimentation characteristics of leucocytes can
predict bacteraemia in critical care patients.
J Clin Pathol 2006; 59:523–525
Povoa P, Coelho L, Almeida E, et al: C-reactive protein as a marker of infection in critically ill patients. Clin Microbiol Infect 2005;
11:101–108
Simon L, Gauvin F, Amre DK, et al: Serum
procalcitonin and C-reactive protein levels as
markers of bacterial infection: A systematic
review and meta-analysis. Clin Infect Dis
2004; 39:206 –217
Uzzan B, Cohen R, Nicolas P, et al: Procalcitonin as a diagnostic test for sepsis in critically ill adults and after surgery or trauma: A
systematic review and meta-analysis. Crit
Care Med 2006; 34:1996 –2003
Gibot S, Cravoisy A, Levy B, et al: Soluble
triggering receptor expressed on myeloid
2298
63.
64.
65.
66.
67.
68.
cells and the diagnosis of pneumonia. N Engl
J Med 2004; 350:451– 458
Peters RP, Van Agtmael MA, Danner SA, et al:
New developments in the diagnosis of bloodstream infections. Lancet Infect Dis 2004;
4:751–760
Loy A, Bodrossy L: Highly parallel microbial
diagnostics using oligonucleotide microarrays. Clin Chim Acta 2006; 363:106 –119
Cohen J, Guyatt G, Bernard GR, et al: New
strategies for clinical trials in patients with
sepsis and septic shock. Crit Care Med 2001;
29:880 – 886
Annane D, Sebille V, Charpentier C, et al:
Effect of treatment with low doses of hydrocortisone and fludrocortisone on mortality in
patients with septic shock. JAMA 2002; 288:
862– 871
Sprung CL, Annane D, Keh D, et al: Hydrocortisone therapy for patients with septic
shock. N Engl J Med 2008; 358:111–124
Dhainaut JF, Yan SB, Joyce DE, et al: Treatment effects of drotrecogin alfa (activated) in
69.
70.
71.
72.
73.
patients with severe sepsis with or without
overt disseminated intravascular coagulation. J Thromb Haemost 2004; 2:1924 –1933
Docke WD, Randow F, Syrbe U, et al: Monocyte deactivation in septic patients: Restoration by IFN-gamma treatment. Nat Med
1997; 3:678 – 681
Ulloa L, Tracey KJ: The “cytokine profile”: A
code for sepsis. Trends Mol Med 2005; 11:
56 – 63
Wang TJ, Gona P, Larson MG, et al: Multiple
biomarkers for the prediction of first major
cardiovascular events and death. N Engl
J Med 2006; 355:2631–2639
Ware JH: The limitations of risk factors as
prognostic tools. N Engl J Med 2006; 355:
2615–2617
Bossuyt PM, Reitsma JB, Bruns DE, et al:
Towards complete and accurate reporting
of studies of diagnostic accuracy: The
STARD Initiative. Ann Intern Med 2003;
138:40 – 44
Crit Care Med 2009 Vol. 37, No. 7
REVIEWS
Harmful molecular mechanisms
in sepsis
Daniel Rittirsch, Michael A. Flierl and Peter A. Ward
Abstract | Sepsis and sepsis-associated multi-organ failure are major challenges for scientists
and clinicians and are a tremendous burden for health-care systems. Despite extensive basic
research and clinical studies, the pathophysiology of sepsis is still poorly understood. We are
now beginning to understand that sepsis is a heterogeneous, dynamic syndrome caused by
imbalances in the ‘inflammatory network’. In this Review, we highlight recent insights into
the molecular interactions that occur during sepsis and attempt to unravel the nature of the
dysregulated immune response during sepsis.
Sepsis
A systemic response to severe
infection or tissue damage,
leading to a hyperactive and
unbalanced network of
pro-inflammatory mediators.
Vascular permeability, cardiac
function and metabolic balance
are affected, resulting in tissue
necrosis, multi-organ failure
and death.
TH17 cells
(T helper 17 cells). A subset of
CD4+ T helper cells that
produce interleukin-17 (IL-17)
and that are thought to be
important in inflammatory and
autoimmune diseases. Their
generation involves IL-23 and
IL-21, as well as the
transcription factors rOrγt
(retinoic-acid-receptor-related
orphan receptor-γt) and STAT3
(signal transducer and activator
of transcription 3).
Department of Pathology,
The University of Michigan
Medical School, 1301
Catherine Road, Ann Arbor,
Michigan 48,109–0602,
USA.
Correspondence to P.A.W.
e-mail: pward@umich.edu
doi:10.1038/nri2402
Published online
19 September 2008
The clinical manifestations of sepsis were already known
to Hippocrates (460–377 bc), who introduced the term
‘wound putrefaction’. In addition, the Persian ‘father of
modern medicine’, Ibn Sina (also known as Avicenna,
ad 980–1037), observed that septicaemia was usually
accompanied by fever. However, it was not until the 18th
century that Louis Pasteur linked the decay of organic
substances to the presence of bacteria and microorganisms, and Ignaz Semmelweis observed the significant
effect of hygienic measures on decreasing the mortality
of women during childbirth. In 1914, Hugo Schottmüller
laid the foundations for a modern definition of sepsis and
was the first to describe that the presence of an infection
was a fundamental component of the disease. Decades
later, the ideas of Lewis Thomas led to a turnaround in the
understanding of sepsis by popularizing the theory that
“…it is the [host] response … that makes the disease”1.
This theory resulted in a large number of experimental
and clinical studies, which eventually shifted the focus
of sepsis research from the infectious agent to the host
immune response. Finally, the concept entered into daily
clinical practice when Roger Bone and colleagues defined
sepsis as a systemic inflammatory response syndrome
(SIRS) that can occur during infection2.
In the past, sepsis was commonly thought to be caused
by overactivation of the innate immune system, and the
ensuing pro-inflammatory cascade, in response to severe
microbial infection or extensive tissue damage (such as
caused by burns or multiple injuries)2. Activation of
the complement system and hyperactivation of cellular
innate immune responses are associated with an excessive inflammatory response that characterizes sepsis.
After being triggered by an overwhelming initial stimulus, neutrophils and macrophages produce and respond
to cytokines, chemokines, complement-activation
776 | o CToBeR 2008 | voLume 8
products and other mediators. This pro-inflammatory
environment causes the release of powerful secondary
mediators (such as lipid factors and reactive oxygen species) that further amplify the inflammatory process. The
malfunction of regulatory mechanisms during sepsis can
result in a loss of control of inflammation, eventually
leading to host damage due to overzealous activation of
the inflammatory response.
However, the failure of anti-inflammatory therapies
for sepsis in clinical trials raised the question of whether
mortality in sepsis actually derives from an uncontrolled
pro-inflammatory response3. Although some patients die
during the initial, hyperinflammatory phase of sepsis,
most patients succumb at later time points that are associated with a prolonged immunosuppressive state. Notably,
neutrophils can undergo ‘immune paralysis’ during sepsis, which involves a complete shut-down of important
intracellular signalling pathways, and dysfunction of the
adaptive immune system is also an important contributing factor to the immunosuppression that is observed in
the later stages of sepsis4,5. T cells are thought to orchestrate the inflammatory response, particularly CD4+
T helper 1 (TH1) cells and TH2 cells, which have distinct
cytokine profiles. During sepsis, the adaptive immune
response diverts from an initial TH1-cell response (characterized by interferon-γ (IFNγ) and interleukin-12
(IL-12) production) to a TH2-cell response (characterized
by IL-4, IL-5, IL-10 and IL-13 production), which can
result in profound immunosuppression. The TH1–TH2cell paradigm that describes how TH cells interact with
other immune cells has recently been expanded with the
discovery of TH17 cells, a subset of TH cells that produces
IL-17 (ref. 6). TH17 cells are thought to be important for
immunity to microorganisms that are not eliminated by
TH1- or TH2-cell-mediated immune responses.
www.nature.com/reviews/immunol
REVIEWS
Nosocomial infections
These are infections that occur
during treatment in a hospital
or a healthcare service unit and
are secondary to the patient’s
original condition. Nosocomial
stems from the Greek word
‘nosokomeion’ meaning
hospital (‘nosos’, disease;
‘komeo’, to take care of). This
type of infection is also known
as a hospital-acquired
infection.
Anaphylatoxin
The pro-inflammatory
complement-activation
fragments C3a, C4a and
C5a are also known as
anaphylatoxins. They mediate
inflammatory responses
through cell activation and
induce effects such as
chemotaxis and histamine
release.
Neutrophil extracellular
traps
(NeTs). A set of extracellular
fibres produced by activated
neutrophils to ensnare
invading microorganisms.
NeTs enhance neutrophil
killing of extracellular
pathogens while minimizing
damage to host cells.
Increased levels of apoptosis in lymphocytes and
dendritic cells (DCs) further contribute to the suppression of immune responses during sepsis (reviewed
in ref. 4). In addition to causing a marked decrease in
cell numbers, the apoptosis of lymphocytes and DCs
contributes to immunoparalysis through the immunosuppressive effects of apoptotic cells. However, different
types of immune cell receive different apoptotic signals
during sepsis. In contrast to lymphocytes and DCs, the
apoptosis of macrophages and neutrophils seems to be
unaffected or even decreased during sepsis7,8. Whereas
the increased apoptosis of lymphocytes and DCs results
in severe immunosuppression, which places the patient
at risk of nosocomial infections, decreased neutrophil
apoptosis increases the bystander damage caused by
their pro-inflammatory activity. Recent data indicate
that T-cell-mediated suppression of the early innate
immune response is required to minimize damage to
the host and maximize the host defence response9.
There is now evidence that sepsis is a condition
that affects not only the immune system but also other
biological systems, such as the coagulation system
and the autonomic nervous system (ANS)10–12. In this
Review, we describe the interplay between normally
host-protective mechanisms that, through amplification
or suppression during sepsis, can become instruments
of harm. We discuss the mechanisms that initiate dysregulation of the inflammatory response and describe
the role of specific inflammatory mediators that act as
‘central hubs’ to connect the various components of this
response. In addition, we describe the pathogenic roles
of the plasmatic cascades (the coagulation, fibrinolysis
and complement systems) and the recently recognized
interactions that occur between them, as well as new
insights regarding the influence of the ANS on the
inflammatory response. To illustrate the complexity of
the inflammatory response in sepsis, we highlight the
multidirectional interactions between the various systems that contribute to sepsis pathogenesis in a complex
‘inflammatory network’.
Initiation of the inflammatory response
Immune cells express a set of receptors known as patternrecognition receptors (PRRs) that rapidly initiate host
defence responses after detection of tissue damage or
microbial infection. The presence of a microbial infection is detected by recognizing conserved pathogenassociated molecular patterns (PAmPs) that are expressed
by both invading and innocuous microorganisms. By
contrast, immune recognition of damaged tissue is
mediated by intracellular proteins or mediators that are
released from dying cells. These proteins are known as
‘alarmins’ and, together with PAmPs, are referred to as
damage-associated molecular patterns (DAmPs)13. Tolllike receptors (TLRs), which are a subfamily of PRRs,
have emerged as crucial receptors for the recognition of
DAmPs and initiation of the inflammatory response.
During sepsis, there is a full-blown, systemic activation of immune responses due to the release of very high
levels of DAmPs from invading microorganisms and/or
damaged host tissue, which leads to the overstimulation
NATuRe RevIeWS | immunology
of immune cells. As a result, sepsis is accompanied by
a markedly imbalanced cytokine response (known as a
‘cytokine storm’), which converts responses that are
normally beneficial for fighting infections into excessive,
damaging inflammation.
TLR4-mediated recognition of lipopolysaccharide
(LPS), a well-characterized PAmP that is found in the
outer membrane of Gram-negative bacteria, is thought
to be an important trigger of the inflammatory response
in sepsis14,15. TLR4 forms a receptor complex with CD14
and mD2, the latter of which also has an important role
in the recognition of LPS16,17. In addition to LPS, various endogenous ligands for TLR4 have been described,
including high-mobility group box 1 protein (HmGB1),
which is an important mediator during the late phase of
sepsis (see later)18. In the past, however, studies of TLR4
have been problematic owing to LPS contamination in
recombinant proteins, which might limit the informative
value of some studies.
It has been postulated that crosstalk occurs between
TLR4 and the complement system, both of which are
involved in the initiation of the inflammatory response in
sepsis19,20. most strikingly, the complement anaphylatoxin
C5a negatively regulates TLR4-mediated responses19.
The extent of the regulatory effect of complement on
TLR4-mediated cytokine production correlates with the
level of complement-activation products and, in turn, the
cytokines that are induced by TLR4 activation upregulate expression of the complement anaphylatoxin receptors C5AR and C3AR20,21. The finding that activation
of TLR4 in platelets initiates the formation of neutrophil
extracellular traps to ensnare bacteria in the vasculature
further demonstrates the intricate interplay between
innate immunity and the clotting system in sepsis22.
owing to its prominent role in the initiation of the
inflammatory response, TLR4 is a potential therapeutic
target for sepsis. In a recent study, antibody-mediated
blockade of TLR4 and mD2 protected against polymicrobial sepsis23 (TABLe 1). However, the mortality of
septic mice that expressed a dysfunctional mutant TLR4
protein was not significantly different from that of wildtype mice with sepsis24. In human sepsis, clinical trials
that blocked TLR4 did not show beneficial effects25, possibly because targeting TLR4 might only be an effective
treatment for sepsis caused by Gram-negative bacteria or
LPS, whereas the incidence of Gram-positive and fungal
sepsis is increasing.
So, the early phase of sepsis, which is caused by the
excessive activation of the host pathogen-recognition
system by large-scale tissue damage and/or severe infection, leads to severe dysregulation of various body systems as a result of the pro-inflammatory environment.
Harmful central hubs in sepsis
The discovery that inflammatory mediators — not
only invading microorganisms — are involved in the
pathogenesis of sepsis has opened up a new avenue
for the investigation of pathological mechanisms of
inflammation. many different mediators have been
linked to the pathology of sepsis, some of which can
be considered to be central hubs in the inflammatory
voLume 8 | o CToBeR 2008 | 777
REVIEWS
Table 1 | Potential therapeutic targets in sepsis
System
Proposed mechanism
Target
References
Pattern- recognition
system
Inhibition of PRRs to dampen the inflammatory
response
TLR4 blockade
23
RAGE blockade
49
Pro-inflammatory
mediators
Blockade of central hubs of the inflammatory
response to reverse established sepsis
MIF blockade or inhibition of its tautomerase activity
36,37
HMGB1 blockade
44,50
IL-17A blockade
52
Complement system
Neutralization of the harmful effects of C5a;
formation of the MAC not affected
C5a neutralization
58
Dual C5AR and C5L2 blockade
29
Coagulation system
Induction of anticoagulant and
anti-inflammatory effects
Administration of activated protein C
74
Selective PAR1 and PAR2 activation
83
Autonomic nervous
system
Activation of the cholinergic anti-inflammatory Parasympathetic branch:
pathway and/or suppression of the adrenergic
• Pharmacological stimulation of α7nAChR on immune cells
pro-inflammatory pathway to restore
• Vagus-nerve stimulation
homeostasis
Sympathetic branch:
• Pharmacological modulation of α- and b-adrenergic
receptor pathways on leukocytes
42
104
12, 108
α7nAChR, α7-nicotinic acetylcholine receptor; C5AR, C5a receptor; C5L2, C5a-like receptor 2; HMGB1, high-mobility group box 1 protein; IL-17A, interleukin-17A;
MAC, membrane-attack complex; MIF, macrophage migration-inhibitory factor; PAR1, protease-activated receptor 1; PRR, pattern-recognition receptor; RAGE,
receptor for advanced glycation end-products; TLR4, Toll-like receptor 4.
network (fIG. 1). Although they differ in terms of their
source, kinetics of release and the stage of sepsis during
which they predominate, these central hubs all have
pleiotropic effects and connect various pathways of the
immune response.
C5a. As part of the innate immune response, the complement system is activated during the early stages of sepsis,
which generates large amounts of the anaphylatoxin C5a.
At high concentrations, C5a has numerous harmful
effects (reviewed in ref. 26; see later). Accordingly, C5a
acts as a central mediator in sepsis by modulating other
systems — including the coagulation cascade, TLR4mediated responses and the release of cytokines, such
as macrophage migration-inhibitory factor (mIF) and
HmGB1 (refS 10,19,27–29).
Tautomerase activity
The ability to catalyse the
tautomerization (switching from
one isomeric form to another)
of d-dopachrome and
l-dopachrome methyl ester
into their corresponding indole
derivates. This reaction was
used by early life forms for
synthetic pathways.
Macrophage migrationinhibitory factor (MIf) has been
shown to have tautomerase
activity; this evolutionarily
conserved catalytic function
is responsible for its
pro-inflammatory effects.
MIF. mIF, which was one of the first cytokines to be
discovered, has a pivotal role in regulating systemic
and local inflammatory responses (reviewed in ref. 30).
Bacterial endo- and exotoxins, and pro-inflammatory
mediators — such as tumour-necrosis factor (TNF),
IFNγ and C5a — are strong inducers of mIF secretion
by leukocytes28,30. unlike other cytokines, mIF is constitutively expressed by leukocytes and stored intracellularly30. After its secretion, mIF functions as a classical
pro-inflammatory cytokine and promotes innate and
adaptive immune responses by activating macrophages
and T cells 30. Interestingly, the pro-inflammatory
activities of mIF are mediated by its tautomerase activity,
which is encoded by a domain containing an evolutionarily conserved catalytic site31. In addition to mediating
its own pro-inflammatory effects, mIF also induces and
amplifies the production of other pro-inflammatory
cytokines and upregulates the expression of TLR4 by
phagocytes30. At high concentrations, mIF prevents the
778 | o CToBeR 2008 | voLume 8
p53-dependent apoptosis of activated macrophages,
which results in sustained inflammatory responses30.
However, the exact mechanisms by which mIF exerts
its biological effects in the context of inflammation are
not entirely clear. Although mIF activates intracellular
signalling pathways after its endocytosis (which is an
atypical mode of cytokine action)30, the CD74 receptor
complex has also been described to function as a mIF
receptor, from which signals are transduced through
CD44 (ref. 32).
mIF is unique among cytokines in that it links the
immune system with the endocrine system. In response
to stress, mIF is secreted by the hypothalamus, the
anterior pituitary gland and the adrenal glands 30,33.
Importantly, mIF antagonizes and overrides the antiinflammatory effects of endogenous steroids30, which
might have consequences for the well-established use
of corticosteroids as a therapy for sepsis. endogenous
corticosteroids induce the release of mIF from immune
cells, and so the inhibitory effect of mIF on the action
of corticosteroids is a negative-feedback loop 30,34,35.
excessive production of mIF is harmful in the acute
phase of sepsis and plasma levels of mIF correlate with
sepsis severity36. Neutralization of mIF or targeting
of its tautomerase activity attenuated the inflammatory response and improved survival in experimental
sepsis36,37. In addition, this treatment approach also
markedly improved survival even when started after
the onset of disease, which indicates that mIF is a
promising therapeutic target36,37 (TABLe 1).
HMGB1. HmGB1 was originally described as a
transcription factor38. After its redefinition as a proinflammatory cytokine39, HmGB1 became the focus
of a large number of studies. HmGB1 is expressed by
almost all cell types, except those lacking a nucleus
www.nature.com/reviews/immunol
REVIEWS
Innate
immune response
Production of
pro-inflammatory
cytokines and chemokines
Adaptive
immune response
IL-17A
Adrenergic
pathway
Cholinergic
pathway
Autonomic
nervous system
Cholinergic
pathway
HMGB1
TLR4
MIF
C5a
Endocrine system
Coagulation
Figure 1 | Central hubs of the inflammatory response in sepsis. During sepsis,
the complement anaphylatoxin C5a is generated following the activation of the
complement system and by the C5-convertase activity of thrombin of the
Nature Reviews
| Immunology
coagulation cascade. C5a triggers the release of pro-inflammatory
mediators,
including macrophage migration-inhibitory factor (MIF) and high-mobility group
box 1 protein (HMGB1), and it activates the coagulation cascade by inducing
tissue-factor expression (not shown). HMGB1 is a pleiotropic cytokine that binds to
Toll-like receptor 4 (TLR4) and acts as an endogenous alarmin to increase the release
of pro-inflammatory mediators. TLR4-mediated responses, in turn, are negatively
regulated by C5a. Similar to HMGB1, large amounts of MIF are released during
sepsis, which promotes a pro-inflammatory response by amplifying cytokine
secretion through the upregulation of TLR4 expression. MIF, which is produced by
the pituitary gland as well as by leukocytes, inhibits the anti-inflammatory effects of
endogenous glucocorticoids of the endocrine system, which, in turn, induce MIF
secretion. HMGB1 links the immune response with the autonomic nervous system,
which regulates the release of HMGB1 and other cytokines during sepsis.
Interleukin-17A (IL-17A), which is an important regulator of inflammation at the
interface between innate and adaptive immunity, orchestrates responses of both
innate and adaptive immune cells.
Cholinergic
anti-inflammatory pathway
This pathway fine-tunes
cytokine production during
inflammation in a highly
regulated and reflexive
manner. Interaction of
acetylcholine with the
α7-nicotinic acetylcholine
receptor (α7nAChr) expressed
by macrophages results
in the suppression of
pro-inflammatory cytokine
production. The main
component of this pathway is
the vagus nerve of the
parasympathetic branch of the
autonomic nervous system.
(such as erythrocytes), and the main sources of HmGB1
in inflammation are macrophages, monocytes and neutrophils40,41. HmGB1 can be secreted by immune cells
after its acetylation in the nucleus and subsequent translocation to the cytoplasm, or it can be released from
necrotic cells40. The active secretion of HmGB1 is regulated by nuclear factor-κB (NF-κB) activation, probably
through non-transcriptional mechanisms, although
how this occurs is not well understood42. Intriguingly,
although apoptotic cells are not a source of extracellular HmGB1 (ref. 43) , they cause macrophages to
release HmGB1 during sepsis44. extracellular HmGB1
specifically interacts with PRRs, including the receptor
for advanced glycation end-products (RAGe), TLR2
and TLR4. HmGB1-induced signalling has pleiotropic
effects on immune cells, promoting inflammation and
the potentially harmful disruption of epithelial barriers18,40,45. In addition to the activation of PRRs, HmGB1
increases the pro-inflammatory activity of cytokines
(such as IL-1b) through binding to these mediators,
which supports the idea that HmGB1 might not act
solely as a pro-inflammatory mediator, but might also
function as a carrier or DAmP46,47.
NATuRe RevIeWS | immunology
Although HmGB1 is released systemically during
sepsis, plasma levels do not necessarily correlate with outcome or survival40. In contrast to other sepsis-associated
cytokines, the peak of HmGB1 release occurs during
later stages of the disease, and the levels of HmGB1
do not always decrease in patients who have recovered
from sepsis39,48. Pathogen-derived molecules and proinflammatory stimuli (such as TNF, IL-1b and IFNγ)
induce the secretion of HmGB1 during inflammation40.
Interaction between C5a and its other receptor, C5a-like
receptor 2 (C5L2), also triggers the release of HmGB1
in sepsis29. Interestingly, HmGB1 secretion is under the
influence of the ANS42. Activation of the cholinergic antiinflammatory pathway suppresses HmGB1 secretion by
macrophages in sepsis and improves survival42.
owing to the pleiotropic effects of HmGB1 on the
inflammatory response and its late release in sepsis, targeting HmGB1 might be a promising therapeutic strategy.
In experimental settings, the direct blockade of HmGB1
or inhibition of RAGe improved survival in endotoxaemia
and experimental sepsis39,44,49,50 (TABLe 1). Similar to the
targeting of mIF, neutralization of HmGB1 prevented
lethality when treatment occurred after the onset of sepsis
and it reversed the development of multi-organ failure44,50
(TABLe 1). However, the complexity of the underlying
mechanisms of HmGB1 function precludes the use of
HmGB1 blockade in clinical trials at this point.
IL‑17A. The recent discovery of the IL-17 cytokine
family, the members of which have emerged as important mediators of immune regulation, has greatly
improved our understanding of the interplay between
innate and adaptive immune responses (reviewed
in ref. 51 ). IL-17A, the first described member of
the IL-17 family, is a pro-inflammatory cytokine
that is mainly produced by T H17 cells 51. IL-17A is
also secreted by various other types of immune cell,
including neutrophils, CD8+ T cells, natural killer cells,
other TH-cell subsets and γδ T cells51. In brief, IL-17A
is involved in mediating pro-inflammatory responses
by triggering the production of many other cytokines
(such as IL-1b, IL-6 and TNF) and provides crosstalk
between lymphocytes and phagocytes51.
It has recently been shown that increased IL-17A
levels have adverse effects during experimental sepsis 52. Neutralization of IL-17A markedly improved
survival, even when the treatment was administered
as late as 12 hours after the initiation of experimental sepsis52 (TABLe 1). The protective effects of IL-17A
blockade were associated with a marked attenuation
of bacteraemia and markedly decreased plasma levels
of pro-inflammatory cytokines 52. In agreement with
these data, the in vitro production of pro-inflammatory
mediators by macrophages in response to LPS was
significantly increased in the presence of recombinant
IL-17A52. However, it is not yet known whether levels
of IL-17A are increased in patients with sepsis, or during which phase of sepsis the neutralization of IL-17A
would be beneficial in the clinical setting. Because
the production of IL-17 is important for directing the
immune response against some specific infections, the
voLume 8 | o CToBeR 2008 | 779
REVIEWS
Endotoxaemia
This is caused by the presence
of endotoxins, which are
derived from Gram-negative
bacteria, in the blood. It results
in systemic activation of the
inflammatory response, the
development of shock and
multi-organ failure and death.
Models of endotoxaemia are
used in experimental settings
to induce systemic
inflammation, but they do not
necessarily mimic human
sepsis.
Septic cardiomyopathy
The decreased myocardial
function that occurs during
sepsis-associated multi-organ
failure. Hypotheses concerning
the aetiology of this decreased
function include impairment
of mitochondrial function,
dysfunction of the
b-adrenoceptor–G-protein–
adenylate cyclase system,
calcium-channel blockade
by direct and indirect
cardiodepressant factors and
contractile impairment by
activated leukocytes.
blockade of IL-17A under certain conditions might
cause more harm than good. Therefore, it remains to
be determined whether IL-17A is a useful target for
therapeutic intervention in sepsis.
Dysregulation of plasmatic cascades
Complementopathy. The complement system can be
activated through three different pathways, which converge on the generation of the anaphylatoxins C3a and
C5a, C4a and the membrane-attack complex (mAC;
also known as C5b–C9). In clinical studies of sepsis,
increased concentrations of C3a, C4a and C5a in the
plasma have been linked to poor outcome and survival53,54. Interestingly, C3a might have anti-inflammatory
properties in addition to acting as a pro-inflammatory
anaphylatoxin55. mice with C3AR deficiency were more
susceptible to endotoxin shock, which was accompanied
by an increase in the concentration of pro-inflammatory
cytokines in the plasma. Binding of C3a to C3AR can
trigger the secretion of anti-inflammatory hormones by
the pituitary gland56, which might account for the antiinflammatory properties of C3a.
New discoveries continue to increase our understanding of the numerous harmful effects of excessive C5a
production during sepsis. The effects of C5a contribute
to immunoparalysis57, multi-organ failure58, the apoptosis
of thymocytes59 and adrenal medullary cells60, and imbalances in the coagulation system61 (fIG. 2). In addition, C5a
C5L2
Tissue-factor expression
Production of proinflammatory cytokines
(MIF, HMGB1)
Hypercoagulability
DIC
SIRS
is involved in the development of septic cardiomyopathy62.
Decreased pressure in the left ventricle of the heart has
been observed following sepsis, accompanied by defective contractility of cardiomyocytes; both of these effects
were reversed by administration of a C5a-specific blocking antibody62. Furthermore, when recombinant C5a was
added to isolated rat cardiomyocytes in vitro, contractile
dysfunction was induced62, which indicates that excessive
generation of C5a during sepsis causes cardiomyopathy.
Recent studies corroborate an important role for C5a
in sepsis and indicate that it exerts its harmful effects
in a complex manner29. In addition to C5AR, C5a can
bind specifically to a second receptor, C5L2, the function
of which was unknown until recently. It was originally
hypothesized that C5L2 functions as a decoy receptor
for C5a, competing with C5AR for binding of C5a63,
although newer evidence indicates that C5L2 is a functional receptor29,64. In human sepsis, the expression of
C5L2 was downregulated on the surface of neutrophils
during septic shock65. The extent of this downregulation
correlated with the development of multi-organ failure,
which indicates that C5L2 contributes to the pathogenesis of sepsis65. There is now evidence that C5AR and
C5L2 cooperatively enhance the inflammatory response
during sepsis, although each receptor might have specific and distinct functional roles29. For example, C5ainduced release of mIF depends on C5AR signalling,
whereas C5L2 mediates the C5a-dependent release of
C5a
Neutrophil
dysfunction
C5AR
Increased
apoptosis
Septic
cardiomyopathy
Defective
clearance
of bacteria
Immunodeficiency
Adrenergic
insufficiency
Lethal
bacteraemia
Immunosuppression
Septic
shock
Heart
failure
Figure 2 | C5a is a central mediator of the inflammatory response in sepsis. During the early stages of sepsis, the
complement system is systemically activated, generating large amounts of the anaphylatoxin C5a. C5a, which is a central
molecule in the immunopathogenesis of sepsis, exerts its effects through interactions with its two
receptors,
receptor
Nature
ReviewsC5a
| Immunology
(C5AR) and C5a-like receptor 2 (C5L2). The expression of these receptors is upregulated during sepsis, and their
interactions with C5a contribute synergistically to harmful events in sepsis. The numerous effects of C5a include
activation of the coagulation cascade by the induction of tissue-factor expression, which can result in disseminated
intravascular coagulation (DIC). Furthermore, C5a triggers the release of pro-inflammatory cytokines, including
macrophage migration-inhibitory factor (MIF) and high-mobility group box 1 protein (HMGB1), which contribute to the
systemic inflammatory response syndrome (SIRS). In the later stages of sepsis, C5a is also responsible for sepsis-induced
neutrophil dysfunction, leading to the shut down of intracellular signalling (immune paralysis) and increased susceptibility
to secondary infections. C5a-induced apoptosis of thymocytes further aggravates immunosuppression, whereas the
apoptosis of adrenal medullary cells results in insufficiency of the adrenergic system, eventually leading to septic shock.
Recently, C5a and C5AR were also shown to be directly involved in the development of septic cardiomyopathy.
780 | o CToBeR 2008 | voLume 8
www.nature.com/reviews/immunol
REVIEWS
Disseminated intravascular
coagulation
(DIC). Also known as
consumptive coagulopathy,
this is a pathological process
in which the blood begins to
coagulate throughout the
entire body. During this
process, platelets and
coagulation factors are
depleted, resulting in a
paradoxical situation in which
there is a high risk of
simultaneous fatal thrombosis
and large-scale haemorrhage.
DIC often occurs in critically ill
patients with overwhelming
infection, fulminant sepsis or
malignancy.
Thrombin
Thrombin (also known as
activated factor II) is the
central serine protease that
converts soluble fibrinogen into
insoluble strands of fibrin. It
also catalyses many other
coagulation-related reactions.
Tissue factor
A pro-coagulant factor that
stimulates thrombus formation
following contact with blood by
accelerating the action of the
coagulation factors factor VIIa
and factor Xa. It can also be
expressed on the surface of
activated endothelial cells.
Activated protein C
A physiological anticoagulant.
The activated form degrades
factor Va and factor VIIIa of
the coagulation cascade.
The protein-C pathway has
anti-thrombotic activity,
as well as anti-inflammatory
and anti-apoptotic functions.
Administration of human
recombinant activated
protein C for the treatment
of sepsis might block
dysregulated coagulation,
inhibit pro-inflammatory
pathways and preserve
organ function.
Thrombomodulin
An integral membrane protein
that is expressed on the
surface of endothelial cells. It
functions as a co-factor in
thrombin-induced activation of
protein C in the anticoagulant
pathway by forming
complexes with thrombin.
Thrombomodulin–thrombin
complexes also stimulate
fibrinolysis by cleaving
thrombin-activatable
fibrinolysis inhibitor (TAfI)
into its active form.
HmGB1 from phagocytes28,29. Importantly, blockade
of either receptor protects against lethality in moderate forms of sepsis, but only the inhibition of both C5a
receptors provides protection in severe sepsis29.
Although inhibitors of other complement factors
(such as a C1 inhibitor or soluble recombinant complement receptor 1) have had limited beneficial effects
in the clinic66,67, C5a might be a promising target for
pharmaceutical intervention in sepsis. The advantage
of this strategy is that the inhibition of the harmful
effects of C5a does not interfere with the assembly of
the mAC, which is essential for defence against invading
microorganisms68. Currently, dual blockade of C5AR
and C5L2, rather than blockade of C5a alone, seems to
be an encouraging strategy for clinical trials29 (TABLe 1).
However, as complement activation is an early event in
sepsis, the availability of a reliable and sensitive bedside
test to assess the extent of complement activation in
a patient will be essential for successful intervention
directed at the complement cascade.
Coagulopathy. In the clinical setting of sepsis, dysregulation of the coagulation cascade (BOX 1) results
in major complications69. The extent of activation of
the coagulation cascade during sepsis can range from
an insignificant level to the occurrence of disseminated
intravascular coagulation (DIC). In the initial phase of
DIC, thrombin activation results in intra- and extravascular fibrin formation (a process known as hypercoagulability), followed by the consumption of coagulation
factors and platelet dysfunction (known as hypocoagulability)70. In the late phase of DIC, microvascular fibrin
deposition is often associated with the development
of multi-organ failure owing to perturbations in the
microcirculation 70. As DIC develops, inflammation
and coagulation interact in a bidirectional manner71.
Activated thrombin can promote the activation of
various pro-inflammatory pathways — including the
production of pro-inflammatory cytokines (such as
TNF, IL-1b and IL-6) and the generation of C5a — and
cytokines, in turn, can stimulate coagulation 10,72–74.
Tissue factor, which is a central molecule in the initiation of DIC, is expressed by activated endothelial cells
and by cells that are not normally exposed to blood
flow, such as sub-endothelial cells and fibroblasts,
and also by circulating immune cells75. In sepsis, the
pro-inflammatory environment causes mononuclear
cells to upregulate the expression of tissue factor on
their cell surface, leading to the systemic activation
of coagulation76.
Another consequence of DIC is the inhibition of
fibrinolysis. In addition to endothelial-cell dysfunction during sepsis, which also occurs as a result of
the pro-inflammatory environment, increased levels of plasminogen-activator inhibitor 1 (PAI1) and
thrombin-activatable fibrinolysis inhibitor (TAFI) lead
to impaired removal of fibrin77. Also, the consumption of
various factors that normally regulate the generation
of thrombin, such as antithrombin III, protein C and
tissue-factor pathway inhibitor (TFPI), contributes to
the development of DIC78.
Recombinant activated protein C is currently the only
approved drug for the treatment of sepsis that targets
the inflammatory response74 (TABLe 1). Protein C, which
is a regulator of the coagulation cascade, is activated by
thrombin bound to thrombomodulin and by endothelial
protein C receptor (ePCR) on endothelial-cell membranes79. After dissociation from ePCR, activated protein C binds to its co-factor, protein S, which then results
in the inactivation of clotting factors va and vIIIa79. In
addition to its anticoagulant activity, activated protein C
has profound anti-apoptotic and anti-inflammatory
properties. It markedly decreases the apoptosis of
endothelial cells and lymphocytes and exerts profibrinolytic effects by inhibiting PAI1 (refS 74,80). The
anti-inflammatory effects of activated protein C are
Box 1 | Coagulation
The coagulation cascade is initiated by the exposure of coagulation factors in the blood to subendothelial proteins
following damage to the blood-vessel endothelium. In primary haemostasis, circulating platelets bind to collagen
through their cell-surface glycoprotein Ia/IIa receptors to form a haemostatic plug at the site of injury. The adhesion of
platelets is stabilized by large, multimeric von-Willebrand-factor proteins, which form links between platelets,
glycoproteins and collagen fibrils. Simultaneously, the action of a complex cascade of coagulation factors (a group of
serine proteases that are activated in a sequential manner) results in the formation of fibrin strands, which further
strengthen the platelet plug (secondary haemostasis). Traditionally, the coagulation cascade has been described as two
pathways: the contact-dependent (intrinsic) activation pathway and the tissue-factor (extrinsic) pathway, the latter
being the main pathway for the initiation of blood coagulation. These two pathways converge on the activation of
thrombin, which converts fibrinogen to fibrin and ultimately results in the formation of a fibrin-crosslinked clot. The
contemporary description of physiological haemostasis in vivo does not divide coagulation into cellular and plasmatic
components or different activation pathways, but instead describes that coagulation involves three phases121. First, the
initiation phase is characterized by the exposure of tissue factor after endothelial damage, resulting in the activation of
thrombin. Second, thrombin augments coagulation by fully activating platelets and increasing platelet adhesion during
the amplification phase. Third, large amounts of thrombin are generated on the surface of activated platelets, resulting in
the stabilization of the blood clot in the propagation phase121.
Eventually, blood clots are organized (which involves the laying down of collagen and the formation of vascular
channels) or absorbed by fibrin degradation (a process known as fibrinolysis). The main protease of the fibrinolysis
cascade is plasmin, which is activated by tissue plasminogen activator, urokinase-like plasminogen activator, thrombin
and fibrin itself. Under normal conditions, the balance between the coagulation and fibrinolysis systems, which is
maintained by various regulatory mechanisms, prevents intravascular coagulation.
NATuRe RevIeWS | immunology
voLume 8 | o CToBeR 2008 | 781
REVIEWS
mediated by ePCR and the cleavage of protease-activated
receptor 1 (PAR1), which has a central role in linking
coagulation and inflammation81–83 (TABLe 1).
The protein-C pathway is particularly susceptible
to inhibition by inflammatory responses in sepsisassociated DIC71. In addition to a decrease in the level
of protein C, the downregulation, shedding and cleavage of thrombomodulin and ePCR are the main causes
of dysfunction of the protein-C pathway84. HmGB1
inhibits the protein-C pathway by interfering with the
thrombin–thrombomodulin complex and it also promotes coagulation by stimulating tissue-factor expression and inhibiting tissue plasminogen activator (TPA),
a serine protease on the surface of endothelial cells that
activates plasmin of the fibrinolysis cascade85.
The administration of activated protein C in sepsis
suppresses pro-inflammatory cytokine production
and decreases the adhesion of phagocytes to injured
endothelium through ePCR- and PAR1-dependent
signalling74,86. However, the anticoagulant activity of
activated protein C might exacerbate bleeding complications in patients who usually have a compromised
clotting system74. Future clinical trials should assess
whether a form of activated protein C that does not
have anticoagulant effects87 will improve clinical efficacy (that is, decrease sepsis mortality) and safety (that
is, decrease the incidence of bleeding complications) in
humans with sepsis.
Coagulation
Complement
Classical:
C1 and C4
FXIIa
Linking complement and coagulation. Traditionally,
the complement and coagulation systems are described
as separate cascades. As descendants of a common
ancestral pathway, both are proteolytic cascades that are
composed of serine proteases with common structural
characteristics and similar activating stimuli71,88. The
relationship is not limited to the biochemical similarity
in their serine proteases, however, as these two pathways
are also linked by many mutual connections that form a
complex network (fIG. 3).
During sepsis, the activated coagulation pathway
predisposes to thrombosis and DIC, which further
aggravate the excessive inflammatory response and
complement activation71. A well-known interaction
between the complement and coagulation systems is
the activation of the classical complement pathway by
coagulation Factor XIIa, which can activate the complement component C1 (ref. 89). more recently, it has been
shown that thrombin can function as a C5 convertase
in a C3-independent manner10. This crosstalk is particularly interesting, not only because thrombin and
C5a are central factors in their respective cascades, but
also because this indicates that C5a and the mAC can
be generated in the absence of upstream complement
activation. Similar to thrombin, kallikrein and plasmin
directly cleave C3 and its activation fragments90,91. In
an indirect negative-feedback loop, thrombin-activated
TAFI inactivates C3a and C5a92.
Lectin:
MASP2
Fibrinolysis
TPA, UPA
Alternative:
C3b
FVa
FVIIIa
FXa
Activated
protein C–protein S
PAI1,
PAI2
C4BP
C4b
C3
Tissue factor
Plasminogen
Plasmin
C3a
C5
Prothrombin
C5a
C5b
MAC
TAF1
Thrombin
Fibrinogen
Fibrin
Fibrindegradation
products
Figure 3 | Cross-talk between the complement, coagulation and fibrinolysis systems. The complement system,
the coagulation cascade and the fibrinolysis cascade communicate through many direct andNature
bidirectional
Reviews interactions
| Immunology
(indicated by red arrows). Activated clotting Factor XII (FXIIa) can activate the classical complement pathway through
cleavage of the complement component C1. Similarly, thrombin, kallikrein (not shown) and plasmin directly cleave
complement component C3, as well as its activation fragments. Moreover, thrombin can cleave C5 into C5a, which
occurs independently of C3 and therefore represents a bypass of the three traditional complement-activation
pathways (that is, the classical, lectin and alternative pathways). Thrombin-activatable fibrinolysis inhibitor (TAFI)
inactivates C3a and C5a in a negative-feedback loop. The complement system also amplifies coagulation through the
C5a-mediated induction of expression of tissue factor and plasminogen-activator inhibitor 1 (PAI1) by leukocytes,
the latter of which inhibits fibrinolysis. In addition, mannan-binding lectin serine protease 2 (MASP2) of the lectin
complement-activation pathway triggers coagulation by converting prothrombin to thrombin. C4b-binding protein
(C4BP) of the complement pathway inhibits protein S, which is a co-factor for the activated protein-C pathway of
coagulation inhibition, which indicates that the inhibition of anticoagulant mechanisms further augments the
pro-coagulant activities of complement. MAC, membrane-attack complex (C5b–C9); TPA, tissue plasminogen activator;
UPA, urokinase-like plasminogen activator.
782 | o CToBeR 2008 | voLume 8
www.nature.com/reviews/immunol
REVIEWS
Box 2 | The autonomic nervous system
The autonomic nervous system (ANS) is part of the peripheral nervous system. It has three components: the parasympathetic
branch, the sympathetic branch and the enteric nervous system. The ANS maintains homeostasis in the body by controlling vital
functions that include heart rate, respiration rate, digestion, perspiration and body temperature. Traditionally, the sympathetic
and parasympathetic branches of the ANS were thought to be endogenous neuronal antagonists. Therefore, the classical
terminology referred to adrenergic responses (sympathetic) as ‘fight or flight’ and to cholinergic responses (parasympathetic)
as ‘rest and digest’ responses. However, it is now clear that the relationship between these pathways is more complex.
Signal transmission in the parasympathetic branch of the ANS is mediated by acetylcholine and its receptors, which are
abundantly expressed by many cell types122. The main peripheral component of the parasympathetic branch of the ANS
is the vagus nerve.
The sympathetic branch of the ANS consists of sympathetic neurons and the adrenal medulla. Catecholamines, which
are the main mediators of the sympathetic branch, mediate pleiotropic effects by interacting with adrenergic receptors
that are ubiquitously expressed by nearly all tissue and cell types122. The activation of adrenergic receptors triggers an
intricate intracellular signalling network that has yet to be fully understood.
The enteric nervous system, which controls the gastrointestinal system, is also considered to be part of the ANS. Anatomically,
the enteric nervous system consists of a large number of neurons that are embedded in the lining of the gastrointestinal tract.
Although the enteric nervous system can operate autonomously, it communicates closely with the central nervous system, and
is associated with a considerable amount of sympathetic and parasympathetic innervation.
Catecholamines
Tyrosine-derived mediators
that are produced mainly by
the adrenal medulla and by the
postganglionic fibres of the
sympathetic nervous system.
recently, it has been found
that immune cells are also a
source of catecholamines. The
most abundant catecholamines
are the biogenic amines
adrenaline, noradrenaline and
dopamine, which function as
neurotransmitters in the
sympathetic branch of the
autonomic nervous system
through interaction with
adrenergic receptors expressed
by numerous cell and tissue
types.
The complement system amplifies coagulation by
modification of phospholipid membranes (which is
required for the initiation of coagulation through tissue factor), by activating platelets and by inducing the
expression of tissue factor and PAI1 by leukocytes71,93,94.
Accordingly, blockade of C5a during experimental sepsis
markedly ameliorated the effects of DIC61. In addition,
mannan-binding lectin serine protease 2 (mASP2), a protease that is characteristic of the lectin pathway of complement activation, can activate coagulation by cleaving
prothrombin into active thrombin95. The pro-coagulant
activities of complement are increased when anticoagulant mechanisms are inhibited; for example, the formation
of a complex between C4b-binding protein and protein S
results in a decrease in the availability of protein S to act
as a co-factor for the anticoagulant protein-C pathway96.
In addition, several indirect influences of the complement system on coagulation that are mediated through
other pro-inflammatory factors (such as TNF, IL-6 and
HmGB1) have been documented.
In summary, the complement, coagulation and fibrinolysis systems are tightly connected through multiple
direct interactions of serine proteases, which together
make up a ‘plasma serine-protease network’. In the setting of sepsis, crosstalk between the complement and
coagulation pathways is of particular importance, as their
uncontrolled activation is an essential contributor to the
pathogenesis of the disease.
The autonomic nervous system
Recent advances in the field of neuroimmunology have
shown that the nervous system and the immune system
communicate during inflammation. The main pathways
involved in this crosstalk are the hypothalamic–pituitary–
adrenal axis and the ANS11,97,98 (BOX 2). Immune cells can
also synthesize and release neurotransmitters and express
receptors for these mediators11,12,99. So, these neuromediators function as the biochemical language of the neuro–
endocrine–immune network, which allows the body to
adapt rapidly to changes of internal and external environments. Accordingly, munford and Tracey have suggested
that severe sepsis is a neuro–endocrine disorder100.
NATuRe RevIeWS | immunology
The parasympathetic ANS. Signalling of the vagus nerve
by engagement of cholinergic receptors expressed by
phagocytes has an important regulatory role in inflammation101. Activation of α7-nicotinic acetylcholine receptors (α7nAChRs), either by vagus-nerve stimulation or
by α7nAChR agonists, decreases intracellular cytokine
synthesis by macrophages and dampens the inflammatory response42,101 (fIG. 4). In other words, inflammation
is under neuronal control by the ANS, which can reflexively modulate the inflammatory response by inhibiting
the production of pro-inflammatory cytokines. This
concept has therefore been termed the ‘inflammatory
reflex’11. The efferent arm of the inflammatory reflex is
the cholinergic anti-inflammatory pathway102, which is
a robust regulator of cytokine production.
Recent studies have shown that the branch of the
vagus nerve that innervates the spleen is crucial for
the suppression of cytokine synthesis in sepsis103. The
spleen is an important source of TNF during sepsis
and splenectomy significantly decreases systemic and
hepatic levels of TNF in septic mice102,103. In addition,
direct cholinergic modulation of immune cells that
transit through the spleen contributes to the regulation
of inflammation at distant sites. In experimental sepsis,
activation of the cholinergic anti-inflammatory pathway
inhibited the production of pro-inflammatory mediators
(including HmGB1 and TNF) and markedly increased
survival, even when carried out as late as 24 hours after
the onset of disease42,104.
The sympathetic ANS. The main transmitters of the
sympathetic branch of the ANS are catecholamines, which
act through binding to adrenergic receptors. The early
phase of sepsis is characterized by high concentrations
of circulating catecholamines, which boost the initial
inflammatory response. Later in septic shock, the production and release of endogenous catecholamines can
become insufficient for maintaining equilibrium of the
cardiovascular system (as indicated by the need for catecholamine administration during septic shock). The
depletion of endogenous catecholamine sources might
be caused by the apoptosis of adrenal medullary cells60.
voLume 8 | o CToBeR 2008 | 783
REVIEWS
a Adrenergic
b Cholinergic
pro-inflammatory pathway
anti-inflammatory pathway
Release of catecholamines from
adrenal medulla, sympathetic neurons,
phagocytic cells and lymphocytes
Vagus-nerve stimulation
Release of acetylcholine
(or α7nAChR agonists)
Catecholamine
Adrenergic
receptor
Acetylcholine
α7nAChR
Macrophage
Increased release of
pro-inflammatory mediators
Decreased release of
pro-inflammatory mediators
Amplified inflammatory response
Suppressed inflammatory response
Figure 4 | Effects of pathways of the AnS on inflammation during sepsis. The
balance between the two branches of the autonomic nervous system (ANS) can direct
the inflammatory response towards pro- or anti-inflammatory outcomes. Whereas
Nature
Reviews
| Immunology
activation of the cholinergic anti-inflammatory pathway (part
of the
parasympathetic
branch of the ANS) dampens inflammation, stimulation of the adrenergic pathways
leads to amplification of the inflammatory response. a | In the adrenergic
pro-inflammatory pathway, high concentrations of circulating catecholamines amplify
the initial inflammatory response, particularly in the early phase of sepsis. Sources for
catecholamine production and release are the adrenal medulla, sympathetic neurons
and leukocytes (phagocytic cells and lymphocytes). Catecholamines exert their
immunomodulatory effects through α- and b-adrenergic receptors that are expressed
by various cell types, resulting in the increased release of pro-inflammatory mediators.
b | By contrast, the activation of the cholinergic anti-inflammatory pathway in sepsis
attenuates the inflammatory response. These effects are mediated through
engagement of α7-nicotinic acetylcholine receptors (α7nAChRs). Acetylcholine is
released following vagus-nerve stimulation, resulting in inhibition of the synthesis and
release of pro-inflammatory mediators such as high-mobility group box 1 protein and
tumour-necrosis factor.
Kupffer cells
The resident macrophages of
the liver, which are derived
from blood monocytes. They
phagocytose pathogenic
particles and microorganisms
that have entered the liver
sinusoids.
The concomitant dysfunctional adrenergic modulation
of heart and blood vessels during septic shock indicates
that impairment of adrenergic regulation contributes to
cardio-circulatory failure105.
It was originally thought that the synthesis of catecholamines was carried out only by the neuronal cells of
the sympathetic branch of the ANS, but it has now been
shown that leukocytes are also an abundant source of
catecholamines12,99. Leukocytes also express adrenergic
receptors, which indicates that catecholamines might
have autocrine and/or paracrine effects on immune
cells12,99. The activation of adrenergic receptors on
immune cells triggers distinct and finely tuned cytokine
responses through NF-κB-dependent mechanisms12,99.
During sepsis, catecholamines exert immunomodulatory effects through α- and b-adrenergic receptors
that are expressed by immune cells106–108. Stimulation of
these receptors alters lymphocyte trafficking, vascular
perfusion and cell proliferation and apoptosis, thereby
affecting the functional responses of leukocytes109–111.
The response of neutrophils and macrophages in
particular underlies adrenergic regulation by catecholamines, as the release of pro-inflammatory cytokines
784 | o CToBeR 2008 | voLume 8
by these cells is tightly regulated by α-adrenergic receptors12,111. Catecholamines might also contribute to the
deleterious effects of sepsis through direct stimulation
of bacterial growth in the gastrointestinal system,
which might contribute to bacteraemia through the
translocation of enteric bacteria into the lymphatic and
blood compartments112.
In summary, activation of the adrenergic pathways
of the sympathetic branch of the ANS during the early
phase of sepsis promotes pro-inflammatory responses and
aggravates adverse events, although the mechanisms that
underlie these effects have yet to be evaluated in detail.
The enteric nervous system. Sepsis can occur as a result
of inflammation in the abdominal cavity (known as peritonitis) that results from the disruption of barriers that
protect the sterile compartment of the abdominal cavity
from pathogens in the intestinal lumen. It was hypothesized that the translocation of enteric bacteria into the
blood might also occur when the gut was not the main
source of inflammation (for example, in situations such
as pneumonia or burn injury), due to a general loss of
intestinal epithelial barrier functions as a result of the proinflammatory environment. Recent research has shown
that the gut can produce large amounts of catecholamines
during sepsis, which are released into intestinal blood113.
Catecholamines that drain from the intestines through the
portal vein into the liver can alter the functional state of
Kupffer cells and hepatocytes through α2-adrenergic receptor signalling114, ultimately contributing to the release of
pro-inflammatory cytokines, hepatocellular dysfunction
and liver failure113,115. Catecholamine-induced activation
of Kupffer cells might also be an important source of the
cytokine storm during sepsis116. Additional studies are
required to identify the cell source of intestine-derived
catecholamines during sepsis. It remains possible that
either the enteric nervous system or resident immune
cells in Peyer’s patches and lymph nodes of the intestinal
system (or both) are responsible for the generation of
intestine-derived catecholamines during sepsis.
ANS‑targeted therapy. modulation of the ANS might
be a promising approach for the treatment of sepsis as
an alternative to blocking pro-inflammatory mediators
directly (TABLe 1). Whereas the cholinergic pathway
attenuates the immune response and is considered to be
anti-inflammatory11, adrenergic stimulation promotes
the release of pro-inflammatory mediators and the
recruitment of leukocytes12 (fIG. 4). Given that an imbalance between these two branches of the ANS contributes
to the development of sepsis, stimulation of the cholinergic vagus nerve and/or suppression of adrenergic pathways might help to restore homeostasis. It has recently
been shown that transcutaneous electrical stimulation
of the vagus nerve improved survival and decreased the
level of pro-inflammatory mediators in experimental
sepsis104. Although this approach might not yet be ready
for use in the clinic, the fact that this treatment for sepsis
would be non-invasive and independent of pharmacokinetics — unlike the administration of drugs — makes it
particularly attractive.
www.nature.com/reviews/immunol
REVIEWS
Invading pathogen
and/or tissue damage
DAMP
Cholinergic and
adrenergic pathways
Innate
immune cells
Lymphocytes
PRR
Cytokines
Systemic activation of
complement system
Apoptotic
cells
Activation of
coagulation system
Pro-inflammatory
mediators
DIC
Immunodeficiency,
immunosuppression
Figure 5 | The inflammatory network in sepsis. During sepsis, homeostasis between
the various biological systems of the inflammatory network is highly imbalanced. In the
initiation of sepsis, the release of a large amount of damage-associated
molecular
Nature Reviews
| Immunology
patterns (DAMPs) from invading microorganisms and/or damaged host tissue results in
the overstimulation of pattern-recognition receptors (PRRs) on immune cells. Activated
immune cells release excessive amounts of pro-inflammatory mediators (resulting in a
‘cytokine storm’), free radicals and enzymes, which converts the normally beneficial
effects of inflammation into an excessive response that damages the host. Activation of
the adrenergic branch of the autonomic nervous system (ANS) and/or decreased activity
of the cholinergic anti-inflammatory pathway (of the parasympathetic branch of the
ANS) further amplifies the pro-inflammatory responses of neutrophils, macrophages and
dendritic cells in sepsis. The presence of invading microorganisms or their products in
the blood can cause systemic activation of the complement system, which results in the
excessive generation of complement anaphylatoxins, which, at high concentrations,
induce numerous harmful effects. Simultaneous activation of the coagulation system
and the inhibition of fibrinolysis as a result of the pro-inflammatory environment and/or
damaged endothelium can result in disseminated intravascular coagulation (DIC), which
is a major complication of sepsis, and in the amplification of the inflammatory response.
The complement, coagulation and fibrinolysis systems are tightly connected through
direct interactions of serine proteases, and imbalances in each cascade are intensified in
a positive-feedback loop (fIG. 4). Finally, the sustained pro-inflammatory environment
affects the functional state of immune effector cells, eventually causing the dysfunction
of neutrophils and immunoparalysis. Alterations in leukocyte apoptosis in the later
stages of sepsis further account for immunosuppression, which increases the
susceptibility to secondary infections.
1.
2.
3.
4.
5.
6.
Thomas, L. Germs. N. Engl. J. Med. 287,
553–555 (1972).
Bone, R. C. et al. Definitions for sepsis and organ
failure and guidelines for the use of innovative
therapies in sepsis. The ACCP/SCCM Consensus
Conference Committee. American College of Chest
Physicians/Society of Critical Care Medicine. Chest
101, 1644–1655 (1992).
Remick, D. G. Cytokine therapeutics for the treatment
of sepsis: why has nothing worked? Curr. Pharm. Des.
9, 75–82 (2003).
Hotchkiss, R. S. & Nicholson, D. W. Apoptosis and
caspases regulate death and inflammation in sepsis.
Nature Rev. Immunol. 6, 813–822 (2006).
Solomkin, J. S., Jenkins, M. K., Nelson, R. D.,
Chenoweth, D. & Simmons, R. L. Neutrophil
dysfunction in sepsis. II. Evidence for the role of
complement activation products in cellular
deactivation. Surgery 90, 319–327 (1981).
Harrington, L. E. et al. Interleukin-17-producing CD4+
effector T cells develop via a lineage distinct from the
NATuRe RevIeWS | immunology
Concluding remarks
Despite more than 20 years of extensive research, none
of the promising therapeutic approaches for sepsis that
target the inflammatory response has been successfully
translated to the clinical setting, and rates of sepsis mortality have not decreased117. These failures are in part due
to the fact that some of the animal models for sepsis that
are used, such as endotoxaemia, do not accurately mimic
sepsis in humans and/or because the limitations of animal
models have been disregarded (reviewed in ref. 118). In
addition, it is now clear that the belief that a single key
mediator causes sepsis, and that neutralization of such a
factor could be a cure for all patients with sepsis, is erroneous. Instead, we now understand that sepsis is a complex,
dynamic syndrome with great heterogeneity, and not a
distinct disease. Sepsis can result from various causative
insults, and susceptibility can be influenced by premorbid
factors that include ethnicity, gender, age, genetic defects
and environmental factors119. In particular, genetic and
epigenetic changes, such as mutations in genes that
encode PRRs or mediators of inflammation and their
receptors, might have consequences for the host response.
Because the underlying inflammatory response during
sepsis varies between individual patients, various options
for therapy should be made available. Ideally, individual
patients should be precisely monitored for changes in
characteristic markers of the host immune response to aid
in the choice of specific immunomodulatory therapies.
We now know that the underlying inflammatory
response in sepsis involves a complex interplay of different biological systems and cell types, resulting in severe
dysregulation of the inflammatory network (fIG. 5). We
are just beginning to understand the underlying regulatory pathways of this network. The application of interdisciplinary approaches will improve our knowledge of
the molecular biology of inflammation in the context of
sepsis. Initial large-scale programs that aim to uncover
the molecular mechanisms of inflammation — which
include the fields of surgery, genomics, proteomics,
biostatistics, bioinformatics, computational biology
and genetics — are now underway120. Although our
current knowledge regarding inflammation might be in
its infancy, recent progress indicates that patients will
one day benefit from more advanced knowledge of the
inflammatory response in sepsis.
T helper type 1 and 2 lineages. Nature Immunol.
6, 1123–1132 (2005).
7.
Hotchkiss, R. S. et al. Accelerated lymphocyte death
in sepsis occurs by both the death receptor and
mitochondrial pathways. J. Immunol. 174,
5110–5118 (2005).
8.
Hotchkiss, R. S. et al. Depletion of dendritic cells, but
not macrophages, in patients with sepsis. J. Immunol.
168, 2493–2500 (2002).
9.
Kim, K. D. et al. Adaptive immune cells temper initial
innate responses. Nature Med. 13, 1248–1252
(2007).
10. Huber-Lang, M. et al. Generation of C5a in the
absence of C3: a new complement activation pathway.
Nature Med. 12, 682–687 (2006).
This study shows that thrombin can act as a C5
convertase, which indicates that there is direct
crosstalk between the coagulation and complement
systems.
11. Tracey, K. J. The inflammatory reflex. Nature 420,
853–859 (2002).
12. Flierl, M. A. et al. Phagocyte-derived catecholamines
enhance acute inflammatory injury. Nature 449,
721–725 (2007).
This publication identifies phagocytes as a source
of catecholamines, which enhance the inflammatory
response.
13. Bianchi, M. E. DAMPs, PAMPs and alarmins: all we
need to know about danger. J. Leukocyte Biol. 81,
1–5 (2007).
14. Medzhitov, R. & Janeway, C. Jr. Innate immunity.
N. Engl. J. Med. 343, 338–344 (2000).
15. Poltorak, A. et al. Defective LPS signaling in
C3H/HeJ and C57BL/10ScCr mice: mutations
in Tlr4 gene. Science 282, 2085–2088
(1998).
In this study, TLR4 is defined as the recognition
receptor for LPS.
16. Ohto, U., Fukase, K., Miyake, K. & Satow, Y. Crystal
structures of human MD-2 and its complex with
antiendotoxic lipid IVa. Science 316, 1632–1634
(2007).
voLume 8 | o CToBeR 2008 | 785
REVIEWS
17. Kim, H. M. et al. Crystal structure of the TLR4–MD-2
complex with bound endotoxin antagonist Eritoran.
Cell 130, 906–917 (2007).
18. Park, J. S. et al. Involvement of Toll-like receptors 2
and 4 in cellular activation by high mobility group
box 1 protein. J. Biol. Chem. 279, 7370–7377
(2004).
19. Hawlisch, H. et al. C5a negatively regulates Toll-like
receptor-4-induced immune responses. Immunity 22,
415–426 (2005).
This study describes a negative effect of C5a on
TLR4-mediated responses as an important
mechanism for regulating TH1-cell polarization in
response to activation of the innate and adaptive
immune systems.
20. Zhang, X. et al. Regulation of Toll-like receptormediated inflammatory response by complement
in vivo. Blood 110, 228–236 (2007).
21. Koleva, M. et al. Induction of anaphylatoxin C5a
receptors in rat hepatocytes by lipopolysaccharide
in vivo: mediation by interleukin-6 from Kupffer cells.
Gastroenterology 122, 697–708 (2002).
22. Clark, S. R. et al. Platelet TLR4 activates neutrophil
extracellular traps to ensnare bacteria in septic blood.
Nature Med. 13, 463–469 (2007).
23. Daubeuf, B. et al. TLR4/MD-2 monoclonal antibody
therapy affords protection in experimental models of
septic shock. J. Immunol. 179, 6107–6114 (2007).
24. McMasters, K. M., Peyton, J. C., Hadjiminas, D. J. &
Cheadle, W. G. Endotoxin and tumour necrosis factor
do not cause mortality from caecal ligation and
puncture. Cytokine 6, 530–536 (1994).
25. van der Poll, T. & Opal, S. M. Host–pathogen
interactions in sepsis. Lancet Infect. Dis. 8, 32–43
(2008).
26. Ward, P. A. The dark side of C5a in sepsis. Nature Rev.
Immunol. 4, 133–142 (2004).
27. Ritis, K. et al. A novel C5a receptor–tissue factor
cross-talk in neutrophils links innate immunity to
coagulation pathways. J. Immunol. 177, 4794–4802
(2006).
28. Riedemann, N. C. et al. Regulatory role of C5a on
macrophage migration inhibitory factor release from
neutrophils. J. Immunol. 173, 1355–1359 (2004).
29. Rittirsch, D. et al. Functional roles for C5a receptors in
sepsis. Nature Med. 14, 551–557 (2008).
This study indicates that both C5a receptors,
C5AR and C5L2, synergistically contribute to
harmful events in sepsis. In contrast to previous
discussions, the authors conclude that C5L2
seems to be a functional receptor rather than
a decoy receptor.
30. Calandra, T. & Roger, T. Macrophage migration
inhibitory factor: a regulator of innate immunity.
Nature Rev. Immunol. 3, 791–800 (2003).
31. Lubetsky, J. B. et al. The tautomerase active site of
macrophage migration inhibitory factor is a potential
target for discovery of novel anti-inflammatory agents.
J. Biol. Chem. 277, 24976–24982 (2002).
32. Shi, X. et al. CD44 is the signaling component of the
macrophage migration inhibitory factor–CD74
receptor complex. Immunity 25, 595–606 (2006).
33. Bernhagen, J. et al. MIF is a pituitary-derived cytokine
that potentiates lethal endotoxaemia. Nature 365,
756–759 (1993).
34. Leng, L. et al. MIF signal transduction initiated by
binding to CD74. J. Exp. Med. 197, 1467–1476
(2003).
35. Mitchell, R. A., Metz, C. N., Peng, T. & Bucala, R.
Sustained mitogen-activated protein kinase (MAPK)
and cytoplasmic phospholipase A2 activation by
macrophage migration inhibitory factor (MIF).
Regulatory role in cell proliferation and
glucocorticoid action. J. Biol. Chem. 274,
18100–18106 (1999).
36. Calandra, T. et al. Protection from septic shock by
neutralization of macrophage migration inhibitory
factor. Nature Med. 6, 164–170 (2000).
This study defines a crucial role for MIF in the
pathogenesis of septic shock and identifies MIF as
a new target for therapeutic intervention.
37. Al-Abed, Y. et al. ISO-1 binding to the tautomerase
active site of MIF inhibits its pro-inflammatory activity
and increases survival in severe sepsis. J. Biol. Chem.
280, 36541–36544 (2005).
38. Muller, S. et al. New EMBO members’ review. The
double life of HMGB1 chromatin protein: architectural
factor and extracellular signal. EMBO J. 20,
4337–4340 (2001).
39. Wang, H. et al. HMG-1 as a late mediator of endotoxin
lethality in mice. Science 285, 248–251 (1999).
786 | o CToBeR 2008 | voLume 8
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
53.
54.
55.
56.
57.
58.
59.
60.
61.
62.
63.
64.
65.
66.
This work defined, for the first time, an extracellular
role for HMGB1 as a pro-inflammatory mediator in
endotoxaemia and sepsis.
Lotze, M. T. & Tracey, K. J. High mobility group box 1
protein (HMGB1): nuclear weapon in the immune
arsenal. Nature Rev. Immunol. 5, 331–342 (2005).
Kim, J. Y. et al. HMGB1 contributes to the
development of acute lung injury after hemorrhage.
Am. J. Physiol. Lung Cell. Mol. Physiol. 288,
L958–L965 (2005).
Wang, H. et al. Cholinergic agonists inhibit HMGB1
release and improve survival in experimental sepsis.
Nature Med. 10, 1216–1221 (2004).
Scaffidi, P., Misteli, T. & Bianchi, M. E. Release of
chromatin protein HMGB1 by necrotic cells triggers
inflammation. Nature 418, 191–195 (2002).
Qin, S. et al. Role of HMGB1 in apoptosis-mediated
sepsis lethality. J. Exp. Med. 203, 1637–1642 (2006).
Hori, O. et al. The receptor for advanced glycation
end products (RAGE) is a cellular binding site for
amphoterin. Mediation of neurite outgrowth and
co-expression of rage and amphoterin in the
developing nervous system. J. Biol. Chem. 270,
25752–25761 (1995).
Sha, Y., Zmijewski, J., Xu, Z. & Abraham, E. HMGB1
develops enhanced proinflammatory activity by
binding to cytokines. J. Immunol. 180, 2531–2537
(2008).
Klune, J. R., Dhupar, R., Cardinal, J., Billiar, T. R. &
Tsung, A. HMGB1: endogenous danger signaling.
Mol. Med. 14, 476–484 (2008).
Sunden-Cullberg, J. et al. Persistent elevation of high
mobility group box-1 protein (HMGB1) in patients
with severe sepsis and septic shock. Crit. Care Med.
33, 564–573 (2005).
Liliensiek, B. et al. Receptor for advanced glycation
end products (RAGE) regulates sepsis but not the
adaptive immune response. J. Clin. Invest. 113,
1641–1650 (2004).
Yang, H. et al. Reversing established sepsis with
antagonists of endogenous high-mobility group box 1.
Proc. Natl Acad. Sci. USA 101, 296–301 (2004).
Weaver, C. T., Hatton, R. D., Mangan, P. R. &
Harrington, L. E. IL-17 family cytokines and the
expanding diversity of effector T-cell lineages. Annu.
Rev. Immunol. 25, 821–852 (2007).
Flierl, M. A. et al. Adverse functions of IL-17A in
experimental sepsis. FASEB J. 22, 2198–2205 (2008).
Nakae, H. et al. Serum complement levels and severity
of sepsis. Res. Commun. Chem. Pathol. Pharmacol.
84, 189–195 (1994).
Gerard, C. Complement C5a in the sepsis syndrome —
too much of a good thing? N. Engl. J. Med. 348,
167–169 (2003).
Kildsgaard, J. et al. Cutting edge: targeted disruption
of the C3a receptor gene demonstrates a novel
protective anti-inflammatory role for C3a in endotoxinshock. J. Immunol. 165, 5406–5409 (2000).
Francis, K. et al. Complement C3a receptors in the
pituitary gland: a novel pathway by which an innate
immune molecule releases hormones involved in the
control of inflammation. FASEB J. 17, 2266–2268
(2003).
Huber-Lang, M. S. et al. Complement-induced
impairment of innate immunity during sepsis.
J. Immunol. 169, 3223–3231 (2002).
Huber-Lang, M. et al. Role of C5a in multiorgan failure
during sepsis. J. Immunol. 166, 1193–1199 (2001).
Riedemann, N. C. et al. C5a receptor and thymocyte
apoptosis in sepsis. FASEB J. 16, 887–888 (2002).
Flierl, M. A. et al. The complement anaphylatoxin C5a
induces apoptosis in adrenomedullary cells during
experimental sepsis. PLoS ONE 3, e2560 (2008).
Laudes, I. J. et al. Anti-c5a ameliorates coagulation/
fibrinolytic protein changes in a rat model of sepsis.
Am. J. Pathol. 160, 1867–1875 (2002).
Niederbichler, A. D. et al. An essential role for
complement C5a in the pathogenesis of septic cardiac
dysfunction. J. Exp. Med. 203, 53–61 (2006).
Gerard, N. P. et al. An anti-inflammatory function for
the complement anaphylatoxin C5a-binding protein,
C5L2. J. Biol. Chem. 280, 39677–39680 (2005).
Chen, N. J. et al. C5L2 is critical for the biological
activities of the anaphylatoxins C5a and C3a. Nature
446, 203–207 (2007).
Huber-Lang, M. et al. Changes in the novel orphan,
C5a receptor (C5L2), during experimental sepsis and
sepsis in humans. J. Immunol. 174, 1104–1110 (2005).
Zeerleder, S. et al. Administration of C1 inhibitor
reduces neutrophil activation in patients with sepsis.
Clin. Diagn. Lab. Immunol. 10, 529–535 (2003).
67. Caliezi, C. et al. C1-inhibitor in patients with severe
sepsis and septic shock: beneficial effect on renal
dysfunction. Crit. Care Med. 30, 1722–1728 (2002).
68. Flierl, M. A. et al. Functions of the complement
components C3 and C5 during sepsis. FASEB J.
27 June 2008 (doi:10.1096/fj.08-110595).
69. Levi, M. & Ten Cate, H. Disseminated intravascular
coagulation. N. Engl. J. Med. 341, 586–592
(1999).
70. Abraham, E. Coagulation abnormalities in acute lung
injury and sepsis. Am. J. Respir. Cell. Mol. Biol. 22,
401–404 (2000).
71. Esmon, C. T. The impact of the inflammatory response
on coagulation. Thromb. Res. 114, 321–327 (2004).
72. Stouthard, J. M. et al. Interleukin-6 stimulates
coagulation, not fibrinolysis, in humans. Thromb.
Haemost. 76, 738–742 (1996).
73. Bevilacqua, M. P. et al. Recombinant tumor necrosis
factor induces procoagulant activity in cultured human
vascular endothelium: characterization and
comparison with the actions of interleukin-1.
Proc. Natl Acad. Sci. USA 83, 4533–4537 (1986).
74. Bernard, G. R. et al. Efficacy and safety of
recombinant human activated protein C for severe
sepsis. N. Engl. J. Med. 344, 699–709 (2001).
This study showed that treatment with activated
protein C significantly decreased mortality in
patients with severe sepsis, but might be
associated with an increased risk of bleeding.
75. Maugeri, N. et al. Human polymorphonuclear
leukocytes produce and express functional tissue
factor upon stimulation. J. Thromb. Haemost.
4, 1323–1330 (2006).
76. Osterud, B. & Flaegstad, T. Increased tissue
thromboplastin activity in monocytes of patients with
meningococcal infection: related to an unfavourable
prognosis. Thromb. Haemost. 49, 5–7 (1983).
77. Zeerleder, S., Schroeder, V., Hack, C. E., Kohler, H. P.
& Wuillemin, W. A. TAFI and PAI-1 levels in human
sepsis. Thromb. Res. 118, 205–212 (2006).
78. Levi, M., de Jonge, E. & van der Poll, T. New treatment
strategies for disseminated intravascular coagulation
based on current understanding of the
pathophysiology. Ann. Med. 36, 41–49 (2004).
79. Esmon, C. T. The protein C pathway. Chest 124,
26S–32S (2003).
80. Joyce, D. E., Gelbert, L., Ciaccia, A., DeHoff, B. &
Grinnell, B. W. Gene expression profile of
antithrombotic protein C defines new mechanisms
modulating inflammation and apoptosis. J. Biol.
Chem. 276, 11199–11203 (2001).
81. Riewald, M., Petrovan, R. J., Donner, A., Mueller,
B. M. & Ruf, W. Activation of endothelial cell protease
activated receptor 1 by the protein C pathway. Science
296, 1880–1882 (2002).
82. Niessen, F. et al. Dendritic cell PAR1–S1P3 signalling
couples coagulation and inflammation. Nature 452,
654–658 (2008).
83. Kaneider, N. C. et al. ‘Role reversal’ for the receptor
PAR1 in sepsis-induced vascular damage. Nature
Immunol. 8, 1303–1312 (2007).
84. Fukudome, K. & Esmon, C. T. Identification, cloning,
and regulation of a novel endothelial cell protein C/
activated protein C receptor. J. Biol. Chem. 269,
26486–26491 (1994).
85. Ito, T. et al. High-mobility group box 1 protein
promotes development of microvascular thrombosis
in rats. J. Thromb. Haemost. 5, 109–116 (2007).
86. Cheng, T. et al. Activated protein C blocks p53mediated apoptosis in ischemic human brain
endothelium and is neuroprotective. Nature Med.
9, 338–342 (2003).
87. Kerschen, E. J. et al. Endotoxemia and sepsis
mortality reduction by non-anticoagulant activated
protein C. J. Exp. Med. 204, 2439–2448 (2007).
88. Krem, M. M. & Di Cera, E. Evolution of enzyme
cascades from embryonic development to blood
coagulation. Trends Biochem. Sci. 27, 67–74
(2002).
89. Ghebrehiwet, B., Silverberg, M. & Kaplan, A. P.
Activation of the classical pathway of complement by
Hageman factor fragment. J. Exp. Med. 153,
665–676 (1981).
90. Goldberger, G. et al. NH2-terminal structure and
cleavage of guinea pig pro-C3, the precursor of the
third complement component. J. Biol. Chem. 256,
12617–12619 (1981).
91. Thoman, M. L., Meuth, J. L., Morgan, E. L., Weigle,
W. O. & Hugli, T. E. C3d-K, a kallikrein cleavage
fragment of iC3b is a potent inhibitor of cellular
proliferation. J. Immunol. 133, 2629–2633 (1984).
www.nature.com/reviews/immunol
REVIEWS
92. Campbell, W., Okada, N. & Okada, H.
Carboxypeptidase R is an inactivator of complementderived inflammatory peptides and an inhibitor of
fibrinolysis. Immunol. Rev. 180, 162–167 (2001).
93. Wojta, J. et al. C5a stimulates production of
plasminogen activator inhibitor-1 in human mast cells
and basophils. Blood 100, 517–523 (2002).
94. Muhlfelder, T. W. et al. C5 chemotactic fragment
induces leukocyte production of tissue factor activity:
a link between complement and coagulation. J. Clin.
Invest. 63, 147–150 (1979).
95. Krarup, A., Wallis, R., Presanis, J. S., Gal, P. & Sim,
R. B. Simultaneous activation of complement and
coagulation by MBL-associated serine protease 2.
PLoS ONE 2, e623 (2007).
96. Rezende, S. M., Simmonds, R. E. & Lane, D. A.
Coagulation, inflammation, and apoptosis: different
roles for protein S and the protein S–C4b binding
protein complex. Blood 103, 1192–1201 (2004).
97. Sternberg, E. M. Neural regulation of innate
immunity: a coordinated nonspecific host response to
pathogens. Nature Rev. Immunol. 6, 318–328
(2006).
98. Elenkov, I. J., Wilder, R. L., Chrousos, G. P. & Vizi, E. S.
The sympathetic nerve — an integrative interface
between two supersystems: the brain and the immune
system. Pharmacol. Rev. 52, 595–638 (2000).
99. Bergquist, J., Tarkowski, A., Ekman, R. & Ewing, A.
Discovery of endogenous catecholamines in
lymphocytes and evidence for catecholamine
regulation of lymphocyte function via an autocrine
loop. Proc. Natl Acad. Sci. USA 91, 12912–12916
(1994).
100. Munford, R. S. & Tracey, K. J. Is severe sepsis a
neuroendocrine disease? Mol. Med. 8, 437–442
(2002).
101. Wang, H. et al. Nicotinic acetylcholine receptor α7
subunit is an essential regulator of inflammation.
Nature 421, 384–388 (2003).
This work shows that the α7-nicotinic acetylcholine
receptor is required for acetylcholine-mediated
inhibition of cytokine production by macrophages,
which is also known as the cholinergic
anti-inflammatory pathway.
102. Tracey, K. J. Physiology and immunology of the
cholinergic antiinflammatory pathway. J. Clin. Invest.
117, 289–296 (2007).
103. Huston, J. M. et al. Splenectomy inactivates the
cholinergic antiinflammatory pathway during lethal
endotoxemia and polymicrobial sepsis. J. Exp. Med.
203, 1623–1628 (2006).
NATuRe RevIeWS | immunology
104. Huston, J. M. et al. Transcutaneous vagus nerve
stimulation reduces serum high mobility group box 1
levels and improves survival in murine sepsis. Crit.
Care Med. 35, 2762–2768 (2007).
105. Annane, D. et al. Inappropriate sympathetic activation
at onset of septic shock: a spectral analysis approach.
Am. J. Respir. Crit. Care Med. 160, 458–465
(1999).
106. Bergmann, M. & Sautner, T. Immunomodulatory
effects of vasoactive catecholamines. Wien. Klin.
Wochenschr. 114, 752–761 (2002).
107. Oberbeck, R. Catecholamines: physiological
immunomodulators during health and illness. Curr.
Med. Chem. 13, 1979–1989 (2006).
108. Oberbeck, R. et al. Adrenergic modulation of survival
and cellular immune functions during polymicrobial
sepsis. Neuroimmunomodulation 11, 214–223
(2004).
109. Kradin, R., Rodberg, G., Zhao, L. H. & Leary, C.
Epinephrine yields translocation of lymphocytes to the
lung. Exp. Mol. Pathol. 70, 1–6 (2001).
110. Ackerman, K. D., Madden, K. S., Livnat, S., Felten,
S. Y. & Felten, D. L. Neonatal sympathetic denervation
alters the development of in vitro spleen cell
proliferation and differentiation. Brain Behav. Immun.
5, 235–261 (1991).
111. Spengler, R. N., Allen, R. M., Remick, D. G.,
Strieter, R. M. & Kunkel, S. L. Stimulation of
α-adrenergic receptor augments the production of
macrophage-derived tumor necrosis factor.
J. Immunol. 145, 1430–1434 (1990).
112. Freestone, P. P. et al. Growth stimulation of intestinal
commensal Escherichia coli by catecholamines: a
possible contributory factor in trauma-induced sepsis.
Shock 18, 465–470 (2002).
113. Zhou, M., Das, P., Simms, H. H. & Wang, P. Gutderived norepinephrine plays an important role in
up-regulating IL-1b and IL-10. Biochim. Biophys. Acta
1740, 446–452 (2005).
114. Yang, S., Zhou, M., Chaudry, I. H. & Wang, P.
Norepinephrine-induced hepatocellular dysfunction in
early sepsis is mediated by activation of
α2-adrenoceptors. Am. J. Physiol. Gastrointest. Liver
Physiol. 281, G1014–G1021 (2001).
115. Yang, S., Koo, D. J., Zhou, M., Chaudry, I. H. & Wang, P.
Gut-derived norepinephrine plays a critical role in
producing hepatocellular dysfunction during early
sepsis. Am. J. Physiol. Gastrointest. Liver Physiol.
279, G1274–G1281 (2000).
116. Zhou, M. et al. The role of Kupffer cell
α2-adrenoceptors in norepinephrine-induced TNF-α
production. Biochim. Biophys. Acta 1537, 49–57
(2001).
117. Dombrovskiy, V. Y., Martin, A. A., Sunderram, J. &
Paz, H. L. Rapid increase in hospitalization and
mortality rates for severe sepsis in the United States:
a trend analysis from 1993 to 2003. Crit. Care Med.
35, 1244–1250 (2007).
This publication is the most recent study to
describe the epidemiology of sepsis in the
United States. Most importantly, the rates of
hospitalization and mortality from severe sepsis
increased significantly over the observation period
from 1993 to 2003.
118. Rittirsch, D., Hoesel, L. M. & Ward, P. A. The
disconnect between animal models of sepsis and
human sepsis. J. Leukocyte Biol. 81, 137–143
(2007).
119. Levy, M. M. et al. 2001 SCCM/ESICM/ACCP/ATS/SIS
International Sepsis Definitions Conference. Crit. Care
Med. 31, 1250–1256 (2003).
120. Calvano, S. E. et al. A network-based analysis of
systemic inflammation in humans. Nature 437,
1032–1037 (2005).
121. Rossaint, R. et al. Key issues in advanced bleeding
care in trauma. Shock 26, 322–331 (2006).
122. Westfall, T. C. & Westfall, D. P. in Goodman & Gilman’s
The Pharmacological Basis of Therapeutics (eds
Brunton, L. L., Lazo, J. S. & Parker, K. L.) 153–158
(McGraw-Hill, New York, 2006).
Acknowledgements
This work was supported by grants GM-29,507, HL-31963
and GM-61656 from the National Institutes of Health, USA,
to P.A.W.
DATABASES
Entrez Gene: http://www.ncbi.nlm.nih.gov/entrez/query.
fcgi?db=gene
antithrombin III | C3AR | C5AR | C5L2 | CD14 | CD44 | CD74 |
EPCR | HMGB1 | IFNγ | IL-1b | IL-4 | IL-5 | IL-6 | IL-10 | IL-12 |
IL-13 | IL-17A | MASP2 | MD2 | MIF | PAI1 | PAR1 | protein C |
protein S | RAGE | TAFI | TFPI | thrombin | tissue factor | TLR2 |
TLR4 | TNF | TPA
FURTHER INFORMATION
Peter Ward’s homepage: http://www.med.umich.edu/
immprog/faculty/wardp.htm
All linkS ARE ACTivE in ThE onlinE Pdf
voLume 8 | o CToBeR 2008 | 787
Protection from lethal Gram-negative bacterial sepsis
by targeting Toll-like receptor 4
Thierry Rogera,1, Céline Froidevauxa,1, Didier Le Roya,1, Marlies Knaup Reymonda, Anne-Laure Chansona, Davide Maurib,
Kim Burnsc, Beat Michel Riedererd, Shizuo Akirae, and Thierry Calandraa,2
aInfectious
Diseases Service, Department of Medicine, Centre Hospitalier Universitaire Vaudois and University of Lausanne, CH-1011 Lausanne, Switzerland;
Biochemicals, CH-1066 Epalinges, Switzerland; cDepartment of Biochemistry, University of Lausanne, CH-1066 Epalinges, Switzerland; dDepartment
of Cell Biology and Morphology, University of Lausanne, CH-1005 Lausanne, Switzerland; and eDepartment of Host Defense, Research Institute for Microbial
Diseases, Osaka University, Suita, Osaka 565-0871, Japan
bApotech
Edited by Charles A. Dinarello, University of Colorado Health Sciences Center, Denver, CO, and approved December 19, 2008 (received for review
August 18, 2008)
Toll-like receptor 4 (TLR4), the signal-transducing molecule of the
LPS receptor complex, plays a fundamental role in the sensing of
LPS from Gram-negative bacteria. Activation of TLR4 signaling
pathways by LPS is a critical upstream event in the pathogenesis of
Gram-negative sepsis, making TLR4 an attractive target for novel
antisepsis therapy. To validate the concept of TLR4-targeted treatment strategies in Gram-negative sepsis, we first showed that
TLR4ⴚ/ⴚ and myeloid differentiation primary response gene 88
(MyD88)ⴚ/ⴚ mice were fully resistant to Escherichia coli–induced
septic shock, whereas TLR2ⴚ/ⴚ and wild-type mice rapidly died of
fulminant sepsis. Neutralizing anti-TLR4 antibodies were then
generated using a soluble chimeric fusion protein composed of the
N-terminal domain of mouse TLR4 (amino acids 1–334) and the Fc
portion of human IgG1. Anti-TLR4 antibodies inhibited intracellular
signaling, markedly reduced cytokine production, and protected
mice from lethal endotoxic shock and E. coli sepsis when administered in a prophylactic and therapeutic manner up to 13 h after
the onset of bacterial sepsis. These experimental data provide
strong support for the concept of TLR4-targeted therapy for
Gram-negative sepsis.
endotoxic shock 兩 Gram-negative bacteria 兩 lipopolysaccharide 兩 TLR4
T
he incidence of sepsis is rising, and the mortality remains
high, reaching 25%–30% in patients with severe sepsis and
50%–60% in those who develop septic shock (1). Despite initial
encouraging results, the benefits of most new antisepsis therapies
(e.g., drotrecogin-alpha activated, corticosteroids, intensive insulin therapy, and vasopressin) remain uncertain (2). Thus,
identification of new treatment options for septic patients remains imperative.
Endotoxin (LPS) is a major component of the outer membrane of Gram-negative bacteria and a critical actor in the
pathogenesis of Gram-negative sepsis (3). Sensing of LPS by
innate immune cells is vital for host defenses against Gramnegative bacteria. This multistep recognition process is initiated
by the binding of LPS to the LPS-binding protein (LBP) that
conveys LPS to a cell surface receptor complex composed of
CD14, MD-2, and Toll-like receptor (TLR4) (4–10). LPS binds
to CD14 and is then delivered to the MD-2–TLR4 complex (11).
Structural studies of the interactions among the LPS antagonists
lipid IVa, eritoran (E5564), MD-2, and TLR4 have revealed that
LPS binds to an hydrophobic internal pocket of MD-2 that itself
is bound to the concave surface of the N-terminal and central
domains of TLR4 (12, 13). Binding of LPS to the MD-2–TLR4
complex causes TLR4 dimerization and sets off intracellular
signaling initiated by the Toll/IL-1 receptor (TIR) domain–
containing adaptor molecules MyD88, TIR domain–containing
adaptor–inducing IFN-␤ (TRIF), TIR domain–containing adaptor protein (TIRAP), and TRIF-related adapter molecule
(TRAM) (14). The TIRAP-MyD88–dependent signaling pathway activates NF-␬B and the MAPKs (ERK-1/2, JNK, and p38),
resulting in the expression of numerous genes encoding cyto2348 –2352 兩 PNAS 兩 February 17, 2009 兩 vol. 106 兩 no. 7
kines and other inflammatory molecules. The TRAM-TRIF–
dependent signaling pathway activates IFN response factor 3,
inducing the production of type I IFN. Cytokines, chemokines,
and type I IFN are critical to the host antimicrobial defense
response.
Regulation of innate immune responses is a delicate balancing
act, and dysregulated innate immune reactions, by either default
or excess, have dramatic consequences for the infected host, as
seen in severe sepsis. Given its central role in the pathogenesis
of Gram-negative sepsis, TLR4 is a target of choice for the
development of novel antisepsis therapies. Here we report that
anti-TLR4 antibodies raised against the ectodomain of TLR4
improved survival in experimental models of Gram-negative
bacterial sepsis when administered both prophylactically and
therapeutically.
Results
TLR4 and MyD88 Are Critical Effector Molecules in Escherichia coli
Sepsis. To validate the concept of immunomodulation of the
TLR4 activation pathway as a treatment strategy for Gramnegative sepsis, we studied cytokine production profiles and
survivals of wild-type (WT), TLR4⫺/⫺, TLR2⫺/⫺, and MyD88⫺/⫺
mice in a model of lethal peritonitis induced by E. coli, the most
common cause of Gram-negative sepsis (15). Given the critical
role played by TLR2 in the sensing of Gram-positive bacteria and
some Gram-negative bacteria (16, 17), we used TLR2⫺/⫺ mice as
controls. At 4 h after bacterial challenge, very high concentrations of bioactive TNF were detected in the circulation of the WT
and TLR2⫺/⫺ mice (median, 6.5 ng/mL vs. 9.7 ng/mL; P ⫽ .5)
(Fig. 1A). In contrast, TNF was either strikingly reduced or
undetectable in the TLR4⫺/⫺ and MyD88⫺/⫺ mice (0.5 and 0
ng/mL, respectively; P ⫽ .002). Likewise, circulating levels of
bioactive IL-6 were much higher in the WT and TLR2⫺/⫺ mice
(8.0 and 10.6 ng/mL; P ⫽ .31) than in the TLR4⫺/⫺ and
MyD88⫺/⫺ mice (4.2 and 2.0 ng/mL; P ⫽ .04 and .002) (Fig. 1B).
Blunted proinflammatory responses were associated with full
survival of the TLR4⫺/⫺ and MyD88⫺/⫺ mice, whereas all but 1
of the WT and TLR2⫺/⫺ mice died (P ⬍ .001) (Fig. 1C). This
indicates that the activation of TLR4, but not of TLR2, is critical
to the host response to E. coli sepsis.
Author contributions: T.R. and T.C. designed research; T.R., C.F., D.L.R., M.K.R., and A.-L.C.
performed research; D.M., K.B., B.M.R., and S.A. contributed new reagents/analytic tools;
T.R., C.F., D.L.R., and T.C. analyzed data; and T.R. and T.C. wrote the paper.
The authors declare no conflict of interest.
This article is a PNAS Direct Submission.
1T.R.,
2To
C.F., and D.L.R. contributed equally to this work.
whom correspondence should be addressed. E-mail: thierry.calandra@chuv.ch.
This article contains supporting information online at www.pnas.org/cgi/content/full/
0808146106/DCSupplemental.
© 2009 by The National Academy of Sciences of the USA
www.pnas.org兾cgi兾doi兾10.1073兾pnas.0808146106
8
1–334) fused to the Fc domain of human IgG1 (mTLR4-Fc). The
recombinant mTLR4-Fc protein was produced in HEK 293T
cells to ensure posttranscriptional modifications. In the presence of serum as a source of soluble MD-2, LPS was shown to
bind to mTLR4-Fc (Fig. S1 A). mTLR4-Fc also was shown to
inhibit LPS-induced TNF release in a whole-blood assay (Fig.
S1B). Together, these data indicate that the recombinant
mTLR4-Fc protein expresses TLR4 domains critical for the
binding of MD-2–LPS complexes, and that mTLR4-Fc acts as
a decoy soluble receptor capable of inhibiting the activation of
membrane-bound TLR4 –MD2 receptor complex by LPS.
14
12
10
4
8
6
4
2
0
W
-/-
T
T
2
LR
T
C
0
-/-
-/-
4
LR
M
yD
88
W
TL
-/-
-/-
-/-
T
R2
TL
R4
M
yD
88
Survival (%)
100
TLR4-/MyD88-/WT
TLR2-/-
75
50
Anti-TLR4 Antibodies Inhibit Innate Immune Responses Induced by LPS
and Gram-Negative Bacteria. mTLR4-Fc was used to generate high
25
0
0
1 2 3 4 5 6
Days post-infection
Fig. 1. TLR4-deficient and MyD88-deficient mice are protected from lethal
Gram-negative bacterial sepsis. (A–C) WT, TLR2⫺/⫺, TLR4⫺/⫺, and MyD88⫺/⫺
C57BL/6 mice were injected i.p. with 2 ⫻ 109 cfu of E. coli O18 and treated with
antibiotics as described in Materials and Methods. Plasma concentrations of
TNF (A) and IL-6 (B) were measured 4 h after bacterial challenge. The horizontal line represents the median cytokine concentration (TNF: P ⬍ .005 for
TLR4⫺/⫺ or MyD88⫺/⫺ vs. WT or TLR2⫺/⫺, P ⫽ .15 for TLR4⫺/⫺ vs. MyD88⫺/⫺, and
P ⫽ .48 for WT vs. TLR2⫺/⫺; IL-6: P ⬍ .05 and ⬍ .005 for TLR4⫺/⫺ and MyD88⫺/⫺
vs. WT or TLR2⫺/⫺, P ⫽ .13 for TLR4⫺/⫺ vs. MyD88⫺/⫺, and P ⫽ .31 for WT vs.
TLR2⫺/⫺). (C) Survival of TLR4⫺/⫺, MyD88⫺/⫺, TLR2⫺/⫺, and WT mice (P ⬍ .001).
Data points are from 1 experiment (n ⫽ 6 to 7 mice per treatment groups).
Chimeric Mouse TLR4 –Human Fc Fusion Protein. TLR4 is composed
1.5
B
mTLR4-Fc
mGITR-Fc
1
.5
0
10-3
10-1
10-2
100
Antibody dilution
C
TLR4+/+
Cell count
OD450
A
TLR4-/-
100
101
102
103
104
Relative luciferase activity
of N-terminal, central, and C-terminal domains. MD-2 binds to
the concave surface of the N-terminal and central TLR4 domains (12, 18). To obtain anti-TLR4 antibodies, we first generated a soluble recombinant chimeric protein composed of the
N-terminal half of the mouse TLR4 ectodomain (amino acids
titers of rabbit anti-mouse TLR4 antibodies, which were purified
through a 3-step procedure as described in Materials and Methods. Specificity was confirmed by demonstrating that anti-TLR4
antibodies recognized mTLR4-Fc but not an irrelevant chimeric
fusion protein (mGITR-Fc) by ELISA (Fig. 2A), and also by the
staining of WT but not TLR4⫺/⫺ mouse peritoneal macrophages
by flow cytometry (Fig. 2B). We then studied the capacity of
anti-TLR4 antibodies to inhibit responses of innate immune cells
stimulated with LPS in vitro. Compared with control antibodies,
anti-TLR4 antibodies strongly inhibited LPS-induced intracellular signal transduction, as demonstrated by the luciferase
reporter activity driven by NF-␬B in RAW 264.7 macrophages
(Fig. 2C) and by phosphorylation of ERK-1/2 in bone marrow–
derived macrophages (Fig. 2D). Anti-TLR4 antibodies also
markedly inhibited LPS- and E. coli–induced TNF and IL-6
production by RAW 264.7 macrophages and by mouse whole
blood (Fig. 2E–H and data not shown). In contrast, anti-TLR4
antibodies did not affect signal transduction or cytokine production by macrophages or by whole blood stimulated with other
TLR ligands, such as Pam3CSK4 (Fig. 2C and D), peptidoglycan
(Fig. 2E), and cytosine guanine dinucleotide (CpG) oligonucleotides (ODNs) (Fig. 2F–H). The biological activity of anti-TLR4
antibodies also was demonstrated through a proof-of-principle
12
D
Control
Anti-TLR4
-
8
LPS
Pam3 CSK4
Anti- Control AntiTLR4
TLR4
Control
*
p-ERK1/2
4
ERK1/2
0
Medium LPS Pam3 CSK4
Fluorescence intensity
2
0
**
0
** **
1 10 100
LPS (ng/ml)
10
PGN
( g/ml)
6
2
1
0
0
**
10
**
100
LPS (ng/ml)
0.1
CpG
( M)
18
Control
Anti-TLR4
6
6
4
**
2
0 Medium E. coli CpG
O18
H 600
IL-6 (pg/ml)
4
G
Control
Anti-TLR4
20
TNF (ng/ml)
F
Control
Anti-TLR4
6
TNF (ng/ml)
TNF (ng/ml)
E
Control
Anti-TLR4
400
200
*
0 Medium E. coli CpG
O18
Fig. 2. Anti-TLR4 antibodies bind to TLR4 and inhibit the activation of macrophages induced by LPS. (A) Anti-TLR4 antibodies binding to immobilized mTLR4-Fc
but not to mGITR-Fc by ELISA. (B) Flow cytometry analysis of anti-TLR4 antibodies (gray area) binding to WT (i.e., TLR4⫹/⫹) (Upper) but not to TLR4⫺/⫺ (Lower)
thioglycollate-elicited mouse peritoneal macrophages. Background staining using control antibodies is shown in white. (C) NF-␬B activity in RAW 264.7
macrophages transiently transfected with a trimeric ␬B site luciferase reporter vector and preincubated for 30 min with anti-TLR4 and control antibodies (100
␮g/mL) before stimulation with LPS (10 ng/mL) or Pam3CSK4 (2 ␮g/mL) for 18 h. Data on relative luciferase activity are expressed as mean ⫾ SD of 4 replicates
from 1 representative experiment. *P ⫽ .001 for anti-TLR4 versus control antibodies. (D) Western blot analyses of phosphorylated-ERK1/2 (p-ERK1/2) and total
ERK1/2 expression in bone marrow– derived macrophages preincubated for 20 min with 10 or 100 ␮g/mL of anti-TLR4 or control antibodies before stimulation
with LPS (1 ng/mL) and Pam3CSK4 (1 ␮g/mL) for 20 min. (E–H) TNF and IL-6 production by RAW 264.7 macrophages (E) or mouse whole blood (F–H) preincubated
for 30 min with anti-TLR4 or control antibodies (100 ␮g/mL) before stimulation with 100 ng/mL of LPS, 10 ␮g/mL of PGN, 0.1 ␮M CpG ODN (CpG), or 106 cfu/mL
of heat-killed E. coli O18 for 4 h. Data are expressed as mean ⫾ SD of triplicates from 1 representative experiment. *.005 ⬍ P ⬍ .05 and **P ⬍ .005for anti-TLR4
versus control antibodies.
Roger et al.
PNAS 兩 February 17, 2009 兩 vol. 106 兩 no. 7 兩 2349
MEDICAL SCIENCES
B
20
16
12
12
IL-6 (ng/ml)
TNF (ng/ml)
A
Survival (%)
C
100
75
50
Anti-TLR4
TLR4-/Control
0
24
48
72
Hours post-challenge
100
100
Anti-TLR4
Survival (%)
6
B
0
Control AntiTLR4
75
50
25
0
Control
0
1 2 3 4 5 6
Days post-infection
Anti-TLR4
C
75
50
Control
25
0
12
0
Control AntiTLR4
Control AntiTLR4
D
18
1
0
TLR4-/-
25
0
2
0 24 48 72 96 120
Hours post-challenge
Fig. 3. Anti-TLR4 antibodies inhibit cytokine production and protect mice
from lethal endotoxemia when administered prophylactically and therapeutically. (A–C) Mice injected i.v. with 40 mg/kg of anti-TLR4 or control antibodies
and TLR4⫺/⫺ mice were sensitized with D-galactosamine 15 min before an i.v.
injection of 50 ng of E. coli O111:B4 LPS. Plasma concentrations of TNF (A) and
of IL-6 (B) were measured 1 h after LPS injection. The horizontal line represents
the median cytokine concentration. Control versus anti-TLR4 antibodies, P ⬍
.0001 for TNF and P ⫽ .005 for IL-6. (C) Prophylaxis. Survival of mice treated
with anti-TLR4 versus control antibodies (n ⫽ 19 and 21 mice per treatment
group; P ⫽ .0001) and TLR4⫺/⫺ mice (n ⫽ 8). Data points are from 4 independent experiments for antibody evaluation. (D) Therapy. Survival of BALB/c
mice treated with anti-TLR4 or control antibodies (40 mg/kg i.p.) 4 h after i.p.
injection of 1 mg of E. coli O111:B4 LPS (P ⫽ .025). Data points are from 1
experiment (n ⫽ 8 mice per treatment group).
type experiment demonstrating that immunoneutralization of
TLR4 activity, like TLR4 deficiency, increased circulating bacterial counts and mortality in nonsevere E. coli peritonitis and
Klebsiella pneumoniae pneumonia models (Fig. S2). Together,
these results provide compelling evidence that anti-TLR4 antibodies recognize membrane-bound TLR4 and inhibit innate
immune responses of cells stimulated with LPS or Gramnegative bacteria in vitro and in vivo.
Anti-TLR4 Antibodies Protect Against Lethal Endotoxemia. Affording
protection against lethal endotoxemia is important in patients
with fulminant meningococcemia associated with high levels of
circulating endotoxin (19). We explored the protective capacity
of the anti-TLR4 antibodies in a model of endotoxemia in
D-galactosamine–sensitized mice. Consistent with the results
observed in vitro, anti-TLR4 antibodies given i.p. 15 min before
an LPS challenge almost completely eliminated TNF production
(P ⬍ .0001) (Fig. 3A) and strongly reduced IL-6 production (P ⫽
.005) (Fig. 3B). Of note, the amount of TNF produced by mice
treated with anti-TLR4 antibodies was comparable to that
produced by TLR4⫺/⫺ mice. Prevention of cytokine release by
anti-TLR4 was associated with improved survival (controls, 94%
in anti-TLR4 and 92% in TLR4⫺/⫺, compared with 37% in
controls; P ⫽ .0001) (Fig. 3C). Time-course analyses of the
magnitude and duration (up to 60 h) of the inhibition of cytokine
production and protection afforded by a single dose of antiTLR4 antibodies against lethal endotoxemia (Table S1) suggests
the possibility that anti-TLR4 treatment also could work when
given after the LPS challenge. Indeed, as shown in Fig. 3D,
anti-TLR4 treatment remained fully protective when given up to
4 h after LPS exposure (P ⫽ .025). Anti-TLR4 antibodies did not
protect mice from toxic shock induced by Pam3CSK4, a Grampositive lipopeptide and activator of TLR1-TLR2 heterodimers
(Fig. S3), providing evidence of TLR4 specificity.
Anti-TLR4 Antibodies Protect Against Lethal Live E. coli Sepsis. We
studied the impact of anti-TLR4 antibodies in a classical Gram2350 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0808146106
Survival (%)
0
Control AntiTLR4
4
28
4
2
D
100
75
Anti-TLR4
50
25
0
Control
0
1 2 3 4 5
Days post-infection
Survival (%)
1
A
IL-6 (ng/ml)
IL-6 (ng/ml)
2
10
8
6
TNF (ng/ml)
B
20
4
3
Survival (%)
TNF (ng/ml)
A
100
Anti-TLR4
75
50
25
0
Control
0
1
2
3
Days post-infection
Fig. 4. Prophylactic and therapeutic administration of anti-TLR4 antibodies
protect mice from lethal Gram-negative bacterial sepsis. (A–D) BALB/c mice
were injected i.p. with anti-TLR4 or control antibodies (160 mg/kg for A–C and
200 mg/kg for D) given before (prophylactically; A and B) or after (therapeutically; C and D) an i.p. injection of a high (2 ⫻ 109 cfu) inoculum (A–C) or low
(2 ⫻ 105 cfu) inoculum (D) of E. coli O18. (A) Plasma concentrations of TNF and
IL-6 were measured 4 h after the bacterial challenge. The horizontal line
represents the median cytokine concentration. P ⬍ .005 for TNF and IL-6. (B–D)
Survival of mice treated prophylactically (B) (at ⫺4, ⫺0.5, and ⫹ 4 h) or
therapeutically either early (⫹1 and ⫹ 4 h) (C) or late (⫹13 h) (D). P ⬍ .0001,
.02, and .03, respectively. Data points are from 1 experiment (n ⫽ 10 –12 mice
per treatment group).
negative bacterial sepsis model induced by an i.p. injection of live
E. coli, the most frequent cause of bacterial sepsis in humans
(15). Prophylactic administration of anti-TLR4 antibodies led to
a 5-fold reduction in the median circulating TNF level (4.2 ng/mL
in controls vs. 0.8 ng/mL in anti-TLR4; P ⬍ .005), a 2-fold
reduction of IL-6 (11.1 vs. 6.3 ng/mL; P ⬍ .005) (Fig. 4A), and
a striking increase in survival (0 vs. 80%; P ⬍ .0001) (Fig. 4B).
To test anti-TLR4 antibodies in a condition mimicking their
clinical use in patients with sepsis, we administered therapy after
the onset of infection in 2 different severity models. In the first
model, mice were challenged with a high E. coli inoculum (2 ⫻
109 cfu), which caused a fulminant, rapidly lethal sepsis. Delayed
(⫹1 h) administration of anti-TLR4 was associated with increased survival rate (30% vs. 10%; P ⫽ .02) and prolonged
survival time (median time to death, 30 h in anti-TLR4 mice vs.
4 h in control mice; P ⫽ .008) (Fig. 4C). In the second model,
mice were challenged with a lower E. coli inoculum (2 ⫻ 105 cfu),
which caused an acute but less fulminant course of sepsis.
Initiation of anti-TLR4 therapy as much as 13 h after the onset
of infection, at which point clinical signs of sepsis were established and circulating levels of endotoxin were elevated (mean ⫾
SD, 13.1 ⫾ 15.2 ng/mL; range, 2.91–45.7 ng/mL; n ⫽ 7),
remained associated with improved survival (75% vs. 30%; P ⫽
.03) (Fig. 4D). Together, these results demonstrate that antiTLR4 antibodies are highly efficacious as adjunctive therapy for
E. coli sepsis, with a window of clinical application including both
prophylactic and therapeutic intervention modalities.
Discussion
Major breakthroughs in our understanding of the pathogenesis
of Gram-negative sepsis are providing new treatment opportunities for severe sepsis and septic shock. For example, TLR4 and
MD-2 have recently emerged as critical sensors of LPS (4–6, 20).
As the signal-transducing component of the LPS receptor complex, TLR4 is a very attractive target for new antisepsis therapy.
Here we provide compelling experimental evidence supporting
the efficacy of anti-TLR4 adjunctive therapy for Gram-negative
sepsis. Using a recombinant chimeric fusion protein composed
Roger et al.
Roger et al.
An anti-TLR4 treatment strategy also is supported by recent
data obtained with eritoran (E5564), a synthetic LPS antagonist
that binds to MD-2 (12, 31), and TAK-242, a cyclohexene
derivative that inhibits TLR4-mediated signal transduction,
which prevented lethality in experimental models of LPS shock
or bacterial sepsis in rodents (32, 33). At a time when most
antisepsis clinical trials have yielded frustratingly negative results (2, 34), our experimental data lend strong support to
TLR4-targeted therapy (i.e., eritoran and TAK-242) currently
under development in patients with Gram-negative sepsis.
Materials and Methods
Mice. Eight- to 10-week-old female OF1, BALB/c, and C57BL/6 mice were
purchased from Charles River Laboratories. MyD88⫺/⫺, TLR2⫺/⫺, and TLR4⫺/⫺
C57BL/6 mice have been described previously (4, 17, 35). Mice were bred and
housed in specific pathogen-free conditions in groups of 5–10 mice per cage
with free access to food and water. All animal procedures were approved by
the Office Vétérinaire du Canton de Vaud (authorization numbers 876.5,
877.5, and 1009.4) and performed in accordance with the institutional guidelines for animal experiments.
Cells and Reagents. HEK 293T cells were cultured in OptiMEM medium. RAW
264.7 murine macrophages were grown in RPMI medium 1640 containing 2
mM glutamine. Mouse bone marrow– derived macrophages (BMDMs) were
obtained as described previously (36) and cultured in Iscove’s modified Dulbecco’s medium containing 2-mercaptoethanol. All media were supplemented with 10% heat-inactivated FCS (Seromed) and antibiotics. Thioglycollate-elicited peritoneal macrophages were harvested from mice 3 days
after i.p. injection of 2 mL of 3% thioglycollate solution (BD Biosciences).
Heparinized blood was collected from OF1 mice. Where indicated, cells, or
blood were incubated with 1–100 ng/mL of Salmonella minnesota Ultra Pure
LPS (List Biologicals Laboratories), 10 ␮g/mL of Staphylococcus aureus peptidoglycan (PGN; Sigma), 1 ␮g/mL of Pam3CSK4 (EMC microcollections), or 0.1
␮M CpG ODN (Coley Pharmaceutical Group).
Soluble Chimeric mTLR4-Fc. A DNA fragment encoding for amino acids 1–334
of mouse TLR4 (mTLR4) was amplified by PCR using the Expand High-Fidelity
PCR system (Roche Applied Science) and mT4Fc sense (TCCGTCGACGCCACCATGATGCCTCCCTGGCTC) and mT4Fc antisense (GGGTCGACTGATAAGGATTGCCATTTGAA) oligonucleotides containing a SalI site (indicated in bold). The
amplicon was cloned into the pGEM-T Easy vector (Promega), sequenced,
excised with SalI, and subcloned upstream of the sequence encoding for the
human IgG1 Fc segment into the pFc plasmid (Apotech). Recombinant
mTLR4pFc-expressing vector was transfected into HEK 293T cells using the
calcium-precipitation method. The transfected HEK 293T cells were incubated
for 3 days in OptiMEM medium (Invitrogen). Supernatant was collected and
centrifuged, and soluble recombinant mTLR4-Fc fusion protein was purified
by protein A (APBiotech) immunoaffinity chromatography. The molecular
weight of the recombinant protein was verified by SDS/PAGE analysis, and the
presence of the Fc fragment of human IgG was confirmed by Western blot
analysis using the mouse GG-7 Fc-specific anti-human IgG antibody (Sigma).
Anti-TLR4 Antibodies. Anti-TLR4 antibodies were produced in New Zealand
White rabbits by repeated immunization with 100 ␮g of purified mTLR4-Fc
fusion protein in Specol. Anti-TLR4 antibody titers were measured by ELISA as
described below. Rabbits were bled when anti-TLR4 antibody titers reached a
plateau. Nonimmune and anti–mTLR4-Fc antibodies were isolated from rabbit
serum by protein A affinity chromatography following the manufacturer’s
recommendations (GE Healthcare). Affinity-purified anti–mTLR4 antibodies
used in some experiments were isolated from anti–mTLR4-Fc sera using a
3-step procedure that included IgG purification using protein A chromatography, followed by anti-Fc antibody depletion using an mGITR-Fc– coupled
affinity column and a final step of mTLR4-specific antibody purification
using a mTLR4-Fc– coupled affinity Hi-trap NHS-activated column (APBiotech). The endotoxin content of the purified antibodies was 100 pg per mg
of antibodies as measured by the limulus amebocyte lysate assay (Charles
River Laboratories).
ELISA for Measurement of Anti-TLR4 Antibodies. First, 96-well plates were
coated overnight at 4 °C with 1 ␮g/mL of mTLR4-Fc or mGITR-Fc fusion protein
as a negative control. After washing, the plates were incubated for 1 h at 37 °C
with PBS containing 5% FCS and then with serial dilutions of preimmune or
immune rabbit serum, before a final incubation step with HRP-conjugated
PNAS 兩 February 17, 2009 兩 vol. 106 兩 no. 7 兩 2351
MEDICAL SCIENCES
of the N-terminal and central domains (amino acids 1–334) of
the extracellular part of TLR4 and the Fc portion of human
IgG1, we produced anti-TLR4 antibodies that inhibited LPSinduced intracellular signaling and cytokine production and
protected mice from lethal endotoxic shock and E. coli bacterial
sepsis, even when treatment was delayed for several hours after
endotoxemia or the onset of sepsis. Resolution of the crystal
structures of the human and mouse TLR4—MD-2 complexes
has provided an explanation for the mode of action of these
anti-TLR4 antibodies (12). Based on the identification of the
residues implicated in the contact between TLR4 and MD-2 and
present in the chimeric mTLR4-Fc immunogen, anti-TLR4
antibodies likely impede the binding of the MD-2–LPS complex
to TLR4.
The protective effects of the anti-TLR4 therapy were impressive and in some respects unique. Previous studies conducted
with anti-LBP or anti-CD14 antibodies in experimental models
of endotoxic shock and Gram-negative bacterial sepsis uniformly
failed to show protection when treatment was administered after
LPS (anti-LBP) or simultaneously with or shortly after bacterial
challenge (anti-LBP and anti-CD14) (21–23). In contrast, antiTLR4 antibodies were found to prevent death from endotoxic
shock even when treatment was delayed for as much as 4 h after
the LPS challenge (Fig. 3D). These findings provide strong
support for an anti-TLR4 treatment strategy in patients with
fulminant meningococcemia associated with high levels of circulating endotoxin in whom anti-LPS (i.e., recombinant bactericidal/permeability-increasing protein) and anti-sepsis (i.e., activated protein C) therapies have failed (24, 25). Unlike
monoclonal antibodies raised against TLR4–MD-2, which work
only when administered prophylactically in bacterial sepsis (26,
27), anti-TLR4 antibodies afforded remarkable protection
against lethal E. coli sepsis when treatment was delayed for as
much as 13 h after the onset of infection (Fig. 4D), offering a
much broader window of therapeutic intervention.
Some Gram-negative endotoxin species also are sensed by
TLR2 (28–30), and several bacterial components (i.e., peptidoglycan, lipopeptides, flagellin, CpG DNA motifs) are recognized by other members of the TLR family besides TLR4,
including TLR1, TLR2, TLR5, TLR6, and TLR9. These properties support the potential need for combined anti-TLR therapies. Along these lines, Spiller et al. (27) recently proposed the
need for dual blockade of TLR2 and TLR4–MD-2 to protect
against Gram-negative sepsis when therapy is initiated after the
onset of infection. Challenging the concept of a need for dual
TLR2 and TLR4–MD-2 targeted therapy (27), our findings
demonstrate that TLR2 clearly was not a key player in the
pathogenesis of Gram-negative sepsis. Indeed, unlike the
TLR4⫺/⫺ mice, the TLR2⫺/⫺ mice produced an abundant
amount of cytokines during E. coli sepsis and had a rapidly fatal
clinical course identical to that of WT mice (Fig. 1), an observation consistent with recent in vitro data indicating that TLR4–
MD-2 is the main recognition system for enterobacteria like E.
coli and K. pneumoniae (29). Furthermore, the sole blockade of
TLR4 was sufficient to protect against Gram-negative sepsis
caused by E. coli, even when therapy was administered long after
the start of sepsis. Although somewhat overlooked, prophylactic
anti-TLR4 monotherapy also has been shown to be protective
against lethal E. coli infection (27), suggesting that administration of repeated doses of anti-TLR4 antibody might increase
survival when given therapeutically, as shown in the present
study. Other plausible reasons for the divergent results between
our study and the study of Spiller et al. (27) could include the
much broader antibody repertoire of polyclonal antibodies; the
use of different E. coli and mouse strains, bacterial inocula, and
antibiotic classes; and differences in the timing of antibiotic
administration.
goat anti-rabbit IgG (Pierce). Peroxidase activity was assessed with the TMB
(3,3⬘, 5,5⬘-tetramethylbenzidine) substrate kit (Pierce), with optical density
measured at 450 nm.
anti-rabbit IgG. Signals were measured using the ECL Western blot analysis
system (GE Healthcare). Membranes were then stripped and reprobed with
anti-ERK1/2 antibodies (Cell Signaling Technology).
Flow Cytometric Analysis. After Fc receptors were blocked with 2.4G2 hybridoma supernatant, expression of TLR4 was evaluated by first incubating thioglycollate-elicited peritoneal macrophages with affinity-purified anti-TLR4 or
control antibodies and then with phycoerythrin-conjugated sheep anti-rabbit
IgG (Serotec). Acquisition and analysis were performed with a FACSCalibur
flow cytometer (BD Biosciences) and FlowJo 8.5.3 software (FlowJow).
Endotoxic Shock and Bacterial Sepsis Models. Two models of endotoxic shock
were used. In the low-dose LPS model, mice were sensitized with an i.p.
injection of 40 mg of D-galactosamine (Sigma) administered 15 min before an
i.v. injection of 50 ng of E. coli ultra Pure O111:B4 LPS (List Biological Laboratories). In the high-dose model, mice were injected i.p. with 1 mg of E. coli
O111:B4 LPS.
In the bacterial sepsis models, bacterial peritonitis was induced by an i.p.
injection of either 2 ⫻ 105 or 2 ⫻ 109 cfu of E. coli O18. Mice were treated with
ceftriaxone (100 mg/kg i.p.) plus gentamicin (20 mg/kg i.p.) given at ⫹ 15 min
(ceftriaxone), ⫹4 h (ceftriaxone and gentamicin) and then every 12 h in mice
inoculated with 2 ⫻ 109 cfu of E. coli O18 and at ⫹ 12 h (ceftriaxone) and ⫹ 24 h
(ceftriaxone and gentamicin) and then every 12 h in mice inoculated with 2 ⫻
105 cfu of E. coli O18. Anti-TLR4 and control antibodies were administered
either prophylactically or therapeutically, as described in Fig. 4. Mice were
monitored at least twice daily until death or complete recovery occurred.
Blood samples were harvested from the tail vein for quantification of circulating bacteria and measurements of serum TNF and IL-6 concentrations.
Cytokine Measurements. RAW 264.7 murine macrophages were plated at a
density of 2 ⫻ 104 cells per well in 96-well culture plates (Costar). A wholeblood stimulation assay was performed in the 96-well culture plates in a total
volume of 200 ␮L (90 ␮L of blood and 110 ␮L of RPMI medium 1640). Cells and
whole blood were stimulated for 4 h with LPS, PGN, Pam3CSK4, or CpG ODN
with or without a 30-min preincubation with anti-TLR4 or control antibodies.
The concentrations of TNF and IL-6 in cell culture supernatants were measured
as described previously (37).
Transient Transfection. RAW 264.7 macrophages grown at 60% confluency in
24-well plates (Costar) were transiently transfected with 500 ng of a trimeric
␬B site–pGL2 luciferase vector and 100 ng of the Renilla pRL-TK vector (Promega) as described previously (38). At 8 h after transfection, cells were
preincubated for 30 min with 100 ␮g/mL of either anti-TLR4 or control
antibodies and then stimulated for 18 h with 10 ng/mL of LPS or 2 ␮g/mL of
Pam3CSK4. Luciferase and Renilla luciferase activities were measured using the
Dual-Luciferase Reporter Assay System (Promega). Results are expressed as
relative luciferase activity (ratio of luciferase activity to Renilla luciferase
activity).
Western Blot Analyses. BMDMs were plated at a density of 2 ⫻ 106 cells per well
in 6-well culture plates and incubated as described in Fig. 2D. Cell lysates were
fractioned through 12% SDS/PAGE gels and then transferred onto nitrocellulose membranes. Membranes were incubated overnight at 4 °C with antibodies specific for ERK1/2 (Cell Signaling Technology). After washing,
membranes were incubated for 1 h with secondary HRP-conjugated goat
1. Martin GS, Mannino DM, Eaton S, Moss M (2003) The epidemiology of sepsis in the United
States from 1979 through 2000. N Engl J Med 348:1546 –1554.
2. Russell JA (2006) Management of sepsis. N Engl J Med 355:1699 –1713.
3. Beutler B, Rietschel ET (2003) Innate immune sensing and its roots: The story of endotoxin.
Nat Rev Immunol 3:169 –176.
4. Hoshino KO, et al. (1999) Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are
hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product. J Immunol 162:3749 –3752.
5. Poltorak A, et al. (1998) Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice:
Mutations in Tlr4 gene. Science 282:2085–2088.
6. Qureshi ST, et al. (1999) Endotoxin-tolerant mice have mutations in Toll-like receptor 4
(Tlr4). J Exp Med 189:615– 625.
7. Schumann RR, et al. (1990) Structure and function of lipopolysaccharide binding protein.
Science 249:1429 –1431.
8. Shimazu R, et al. (1999) MD-2, a molecule that confers lipopolysaccharide responsiveness
on Toll-like receptor 4. J Exp Med 189:1777–1782.
9. Tobias PS, Soldau K, Ulevitch RJ (1986) Isolation of a lipopolysaccharide-binding acutephase reactant from rabbit serum. J Exp Med 164:777–793.
10. Wright SD, Ramos RA, Tobias PS, Ulevitch RJ, Mathison JC (1990) CD14, a receptor for
complexes of lipopolysaccharide (LPS) and LPS-binding protein. Science 249:1431–1433.
11. Kim JI, et al. (2005) Crystal structure of CD14 and its implications for lipopolysaccharide
signaling. J Biol Chem 280:11347–11351.
12. Kim HM, et al. (2007) Crystal structure of the TLR4 –MD-2 complex with bound endotoxin
antagonist Eritoran. Cell 130:906 –917.
13. Ohto U, Fukase K, Miyake K, Satow Y (2007) Crystal structures of human MD-2 and its
complex with antiendotoxic lipid IVa. Science 316:1632–1634.
14. Kawai T, Akira S (2007) TLR signaling. Semin Immunol 19:24 –32.
15. Annane D, Bellissant E, Cavaillon JM (2005) Septic shock. Lancet 365:63–78.
16. Takeuchi O, Hoshino K, Akira S (2000) Cutting edge: TLR2-deficient and MyD88-deficient
mice are highly susceptible to Staphylococcus aureus infection. J Immunol 165:5392–5396.
17. Takeuchi O, et al. (1999) Differential roles of TLR2 and TLR4 in recognition of gramnegative and gram-positive bacterial cell wall components. Immunity 11:443– 451.
18. Brodsky I, Medzhitov R (2007) Two modes of ligand recognition by TLRs. Cell 130:979 –981.
19. Brandtzaeg P, Ovsteboo R, Kierulf P (1992) Compartmentalization of lipopolysaccharide
production correlates with clinical presentation in meningococcal disease. J Infect Dis
166:650 – 652.
20. Nagai Y, et al. (2002) Essential role of MD-2 in LPS responsiveness and TLR4 distribution.
Nat Immunol 3:667– 672.
21. Frevert CW, et al. (2000) Effect of CD14 blockade in rabbits with Escherichia coli pneumonia and sepsis. J Immunol 164:5439 –5445.
2352 兩 www.pnas.org兾cgi兾doi兾10.1073兾pnas.0808146106
Endotoxin Measurements. Endotoxin was measured in heparinized mouse
plasma using Limulus Amebocyte Lysate Test Cartridges and the Endosafe PTS
Portable Test System (Charles River Laboratories). The detection limit of the
assay was 5 pg/mL.
Statistical Analyses. Comparisons among treatment groups were performed
using Fisher’s exact test for categorical data and the Mann-Whitney test for
continuous variables. The Kaplan-Meier method was used for survival, and
differences were analyzed by the log-rank sum test. All analyses were performed using GraphPad PRISM. All reported P values are 2-sided, and values
.05 are considered to indicate statistical significance.
ACKNOWLEDGMENTS. This work was supported by grants from the Swiss
National Science Foundation (3100 – 066972.01 and 3100 –118266.07), the
Bristol-Myers Squibb Foundation, the Leenaards Foundation, and the SantosSuarez Foundation for Medical Research (to T.C.).
22. Gallay P, Heumann D, Le Roy D, Barras C, Glauser MP (1993) Lipopolysaccharide-binding
protein as a major plasma protein responsible for endotoxemic shock. Proc Natl Acad Sci
U S A 90:9935–9938.
23. Le Roy D, et al. (2001) Critical role of lipopolysaccharide-binding protein and CD14 in
immune responses against gram-negative bacteria. J Immunol 167:2759 –2765.
24. Levin M, et al. (2000) Recombinant bactericidal/permeability-increasing protein (rBPI21) as
adjunctive treatment for children with severe meningococcal sepsis: A randomised trial.
rBPI21 Meningococcal Sepsis Study Group. Lancet 356:961–967.
25. Nadel S, et al. (2007) Drotrecogin alfa (activated) in children with severe sepsis: A multicentre phase III randomised controlled trial. Lancet 369:836 – 843.
26. Daubeuf B, et al. (2007) TLR4/MD-2 monoclonal antibody therapy affords protection in
experimental models of septic shock. J Immunol 179:6107– 6114.
27. Spiller S, et al. (2008) TLR4-induced IFN-{gamma} production increases TLR2 sensitivity and
drives gram-negative sepsis in mice. J Exp Med 205:1747–1754.
28. Akira S, Uematsu S, Takeuchi O (2006) Pathogen recognition and innate immunity. Cell
124:783– 801.
29. Elson G, Dunn-Siegrist I, Daubeuf B, Pugin J (2007) Contribution of Toll-like receptors to the
innate immune response to gram-negative and gram-positive bacteria. Blood 109:1574 –
1583.
30. Werts C, et al. (2001) Leptospiral lipopolysaccharide activates cells through a TLR2dependent mechanism. Nat Immunol 2:346 –352.
31. Lynn M, et al. (2003) Blocking of responses to endotoxin by E5564 in healthy volunteers
with experimental endotoxemia. J Infect Dis 187:631– 639.
32. Mullarkey M, et al. (2003) Inhibition of endotoxin response by e5564, a novel Toll-like
receptor 4 – directed endotoxin antagonist. J Pharmacol Exp Ther 304:1093–1102.
33. Solomon SB, et al. (2006) Effective dosing of lipid A analogue E5564 in rats depends on the
timing of treatment and the route of Escherichia coli infection. J Infect Dis 193:634 – 644.
34. Marshall JC (2008) Sepsis: Rethinking the approach to clinical research. J Leukoc Biol
83:471– 482.
35. Adachi O, et al. (1998) Targeted disruption of the MyD88 gene results in loss of IL-1– and
IL-18 –mediated function. Immunity 9:143–150.
36. Roger T, Ding X, Chanson AL, Renner P, Calandra T (2007) Regulation of constitutive and
microbial pathogen-induced human macrophage migration inhibitory factor (MIF) gene
expression. Eur J Immunol 37:3509 –3521.
37. Roger T, David J, Glauser MP, Calandra T (2001) MIF regulates innate immune responses
through modulation of Toll-like receptor 4. Nature 414:920 –924.
38. Roger T, Chanson AL, Knaup-Reymond M, Calandra T (2005) Macrophage migration
inhibitory factor promotes innate immune responses by suppressing glucocorticoidinduced expression of mitogen-activated protein kinase phosphatase-1. Eur J Immunol
35:3405–3413.
Roger et al.
SHOCK, Vol. 29, No. 3, pp. 315Y321, 2008
Review Article
ROLE OF TOLL-LIKE RECEPTORS IN THE DEVELOPMENT OF SEPSIS
Hironori Tsujimoto,* Satoshi Ono,* Philip A. Efron,† Philip O. Scumpia,†
Lyle L. Moldawer,† and Hidetaka Mochizuki*
*Department of Surgery, National Defense Medical College, 3-2 Namiki, Tokorozawa, Japan; and
†
Department of Surgery, University of Florida College of Medicine, Gainesville, Florida
Received 7 Jun 2007; first review completed 20 Jun 2007; accepted in final form 1 Aug 2007
ABSTRACT—The outcome of sepsis and septic shock has not significantly improved in recent decades despite the
development of numerous drugs and supportive care therapies. To reduce sepsis-related mortality, a better understanding of
molecular mechanism(s) associated with the development of sepsis and sepsis-related organ injury is essential. There is
increasing evidence that Toll-like receptors (TLRs) play a key role in the mediation of systemic responses to invading
pathogens during sepsis. However, the role of TLRs in the development of sepsis and in sepsis-related organ injury remains
debatable. In this review, we focus on the biological significance of TLRs during sepsis. Medline was searched for pertinent
publications relating to TLRs, with emphasis on their clinical and pathophysiological importance in sepsis. In addition, a
summary of the authors’ own experimental data from this field was set in the context of current knowledge regarding TLRs. In
both animal models and human sepsis, TLRs are highly expressed on monocytes/macrophages, and this TLR expression
may not simply be a ligand-specific response in such an environment. The fact that TLR signaling enables TLRs to recognize
harmful mediators induced by invading pathogens may be associated with a positive feedback loop for the inflammatory
response among different cell populations. This mechanism(s) may contribute to the organ dysfunction and mortality that
occurs in sepsis. A better understanding of TLR biology may unveil novel therapeutic approaches for sepsis.
KEYWORDS—Pathogen-associated molecular pattern, systemic response, innate immunity, organ injury
INTRODUCTION
leucopenia, elevated cardiac output, and reduced systemic
vascular resistance (5). In 1991, the American College of Chest
Physicians/Society Critical Care Medicine Consensus Conference altered the definition of sepsis to the systemic response to
a microbial infection. Recently, the term Bsepsis[ has been
supplanted by the term Bsepsis syndrome[ to include patients
manifesting the physiological and metabolic responses associated with sepsis but without a documented severe infection (6).
Sepsis/sepsis syndrome is a complex clinical syndrome that
results in both the activation and dysfunction of the innate and
adaptive branches of the immune system. The systemic
administration of bacterial LPS is known to recapitulate many
of the clinical features of septic shock (7), including the early
release of a number of proinflammatory mediators. However,
there are a number of critical differences between LPS- and
bacteria-induced septic shocks, including the pattern of
cytokine expression. Thus, the LPS and other classical models
of sepsis may be limited in their applications because they do
not properly reflect all forms and presentations of sepsis in a
clinical setting. This supports the proposal that other components, including other bacterial molecular elements, may
contribute to the development of sepsis (8).
Sepsis affects more than 500,000 patients in the United
States annually, and its incidence continues to increase (1).
Despite continuous progress in the development of antibiotics
and other supportive care therapies, sepsis remains a leading
cause of morbidity and mortality in the intensive care unit (2).
The outcome of sepsis and septic shock has not improved
significantly in the past 50 years (1). It is apparent that the
clinical trials of anti-inflammatory agents and anticytokine
therapies have, in general, failed (3, 4). These disappointing
results may be partially due to the lack of understanding
of the molecular mechanisms associated with the development of sepsis and sepsis-related organ injury. This review
focuses on the role of Toll-like receptors (TLRs) during
sepsis and their association with sepsis and sepsis-related
organ injury.
Medline was searched for publications relating to TLRs,
with emphasis on their clinical and pathophysiological
importance in sepsis. In addition, a summary of the authors’
own experimental data from this field was set in the context of
current knowledge regarding TLRs and their ligands.
SEPSIS AND SEPSIS SYNDROME
TOLL-LIKE RECEPTORS AND THEIR LIGANDS
Historically, sepsis has been defined as a clinical syndrome
consisting of a severe infection with fever, leukocytosis or
The innate immune system is phylogenetically conserved
and present in almost all organisms (9). The mechanisms used
by the innate immune system to recognize nonself have been
elucidated only recently, and the discovery of TLRs has
revolutionized the field of microbial pathogenesis and human
immunology. The Toll-signaling pathway was initially described in Drosophila for its role in dorsalYventral patterning
Address reprint requests to Hironori Tsujimoto, MD, PhD, Department of
Surgery, National Defense Medical College, 3-2 Namiki, Tokorozawa 359-8513,
Japan. E-mail: Tsujiflorida@aol.com.
DOI: 10.1097/SHK.0b013e318157ee55
Copyright Ó 2008 by the Shock Society
315
316
SHOCK VOL. 29, NO. 3
TSUJIMOTO
ET AL.
during embryogenesis. Medzhitov et al. (10) previously
demonstrated that human TLR-4 was the principal receptor
for LPS that mediates the activation of nuclear factorY.B and
the synthesis of proinflammatory cytokines. In general, TLRs
are a family of transmembrane receptors consisting of an extracellular leucine-rich repeat domain that interacts with relevant
pathogen-associated molecular patterns and an intracellular
Toll/IL-1 receptor domain, which is involved in signaling. To
date, at least 11 human TLRs have been identified, and each
is known to detect a specific pathogen-associated molecular
pattern and have a specific intracellular signaling pathway.
Toll-like receptors 1, 2, 4, 5, and 6 mainly recognize bacterial
products, whereas TLR-3, TLR-7, and TLR-8 are specific for
viral detection. Toll-like receptor 9 seems to be involved in
both microbial and viral recognition (Table 1).
TOLL-LIKE RECEPTOR EXPRESSION
DURING SEPSIS
Increasing experimental and clinical evidence demonstrates
the importance of TLR expression on various cell types during
sepsis. Our laboratory (11) and Armstrong et al. (12) reported
that monocytic expression of TLR-2 and TLR-4 in septic
TABLE 1. Exogenous and endogenous ligands for TLRs
Ligands
TLR
Exogenous
1
Triacyl lipopeptide*
2
Peptidoglycan
Lipoprotein
Endogenous
Necrotic cells
HSPs (HSP-60, HSP-70, Gp-96)
Biglycan
3
4
Double-stranded RNA
Self-messenger RNA
LPS
Extra domain AYcontaining fibronectin
FIG. 1. Toll-like receptor 4/MD-2 expression on liver and splenic
macrophages and BALF cells, and MIP-2 production by LPS-induced
MNC and BALF cells. The expression of TLR-4/MD-2 on liver and splenic
macrophages was significantly increased in CLP mice compared with shamoperated mice. Similarly, the MFI of TLR-4/MD-2 on BALF cells was
significantly enhanced in CLP mice (A). LPS-induced MIP-2 production by
BALF cells and liver MNC from CLP mice were significantly increased,
whereas there was no difference in LPS-induced MIP-2 production by
splenic MNC between CLP and sham-operated mice (B). All data are mean T
SEM. *P G 0.05 versus sham-operated mice. MFI, mean fluorescence
intensity; MNC, mononuclear cells. n = 7 per group. Adapted from Shock.
2005;23:39Y44.
Taxol (mouse TLR-4 only) Fibrinogen
Polysaccharide fragments of
heparan sulfate
Oligosaccharides of hyaluronic acid
"-Defensin 2
Oxidized low-density lipoprotein
HSPs
Surfactant protein A in the lung
epithelium 1
Neutrophil elastase
High mobility group box 1 protein
Biglycan
5
Flagellin
6
Diacyl lipopeptide*
7
Single-stranded RNA
8
Single-stranded RNA
9
Unmethylated CpG DNA
10
Unknown
11
Uropathogenic Escherichia
coli
Chromatin-IgG complex
Ig indicates immunoglobulin; TLR, toll-like receptor; HSP, heat shock
protein; CpG, deoxy-cystidylate-phospate-deoxy-guanylate.
patients was significantly up-regulated compared with the
expression in healthy individuals. In addition, we have demonstrated that the expression of TLR-2 and TLR-4/MD-2 in
hepatic and splenic macrophages is significantly up-regulated
in mice with experimental peritonitis induced by cecum ligation and puncture (CLP) (Fig. 1A) (13). Williams et al. (14)
also demonstrated that TLR-2 and TLR-4 mRNA expression in
the lungs and liver of CLP mice were significantly up-regulated
as compared with that in sham-operated mice, which occurred as
early as 1 h after the onset of peritonitis. Andonegui et al. (15)
reported that expression of TLR-4, particularly on alveolar
endothelial cells, played an important role in neutrophil
recruitment into the lungs after LPS administration, suggesting
that TLRs on nonimmune cells and immune cells may be
involved in tissue injury during sepsis. Thus, both experimental models of sepsis and septic human patients display
significantly up-regulated TLR expression in various organs
(Table 2).
Viemann et al. (16) demonstrated that TLR-4 showed no
remarkable changes in neonates with sepsis as compared with
healthy individuals, and Renshaw et al. (17) indicated that
TLR expression declined with age. In addition, our laboratory
reported differential regulation of TLRs during sepsis between
SHOCK MARCH 2008
TOLL-LIKE RECEPTORS
IN
SEPSIS
317
men and women (18). Thus, it should be noted that there
is a critical difference in TLR regulation and baseline TLR
expression depending on age and sex in patients with sepsis.
EXPRESSION OF TOLL-LIKE RECEPTORS AND
THEIR RESPONSE TO SPECIFIC LIGANDS UNDER
NONSEPTIC CONDITIONS
In vitro studies have demonstrated that preexposure to LPS
reduces responsiveness to subsequent LPS challenges. This
phenomenon has been designated as LPS tolerance. LPS
tolerance has also been observed in in vivo animal models,
with a decreased response and protection from lethality in
response to a secondary stimulation with a sublethal dose of
LPS. Nomura et al. (19) concluded that one of the mechanisms responsible for hyporesponsiveness to LPS might be the
down-regulation of TLR-4/MD-2 expression in purified
murine peritoneal macrophages. Indeed, we obtained similar
results using murine bone marrowYderived dendritic cells
(20). On the other hand, Bihl et al. (21) reported that
transgenic mice having several copies of TLR-4 showed an
enhanced immune response to LPS, suggesting a good
correlation between the level of TLR-4 mRNA expression
and sensitivity to LPS both in vitro and in vivo. Paterson et al.
(22) reported that thermal injury augments TLR-2 and TLR-4
expression and primes the innate immune system for
enhanced TLR reactivity, resulting in LPS-induced mortality.
Motegi et al. (23) have demonstrated that human peripheral
blood mononuclear cells (PBMCs), which show up-regulated
TLR-4 expression in monocytes after IL-12 stimulation, show
augmented TNF-! production after subsequent LPS stimulation, and they conclude that this phenomena may be
responsible for the generalized Shwartzman reaction. Thus,
TLR-4 regulation may be associated with the extent of the
biological response to subsequent TLR ligand stimulation
under such conditions. One possible mechanism for regulation
of TLR-4 expression in monocytes/macrophages involves
TABLE 2. TLRs expression during septic condition
Organs
Lung
Liver
Spleen
TLR
Change
of expression
Reference/s
TLR-2 mRNA
Up-regulated
14, 80
TLR-4 mRNA/protein
Up-regulated
14, 80
TLR-2 mRNA/protein
Up-regulated
13, 14
TLR-4 mRNA/protein
Up-regulated
13, 14
TLR-9 protein
Up-regulated
81
TLR-2 protein
Up-regulated
13
TLR-4 protein
Up-regulated
13
Kidney
TLR-4 protein
Up-regulated
29
Intestine
TLR-2 mRNA
Up-regulated
82
TLR-4 mRNA
Up-regulated
82
Peripheral blood
TLR-2 protein
Up-regulated
16, 33
TLR-4 protein
Up-regulated
30, 33
TLR-9 protein
Up-regulated
83
FIG. 2. Toll-like receptors 2, 4, and CD14 expression on peripheral
blood monocytes, and LPS-induced IL-1" production. A, CD14+ monocytes from both septic (n = 15) and surgical patients (n = 34) showed
significantly increased expression of TLR-4 compared with healthy controls
(n = 13), although no significant difference in TLR-4 expression was
observed between CD14+ monocytes from septic and surgical patients. B,
Peripheral blood mononuclear cells from septic, surgical, and control patients
were isolated, and 1.0 106 PBMCs were incubated in the presence of 1
2g/mL of LPS for 24 h. The supernatants were collected, and IL-1" concentrations were measured by enzyme-linked immunosorbent assays. All data
are mean T SEM. *P G 0.05 compared with the controls; † P G 0.05 compared
with the surgical patients. Septic patients were diagnosed with sepsis due to
an intra-abdominal infection, and surgical patients had gastrointestinal cancer
and underwent nonseptic elective surgery. MFI indicates mean fluorescence
intensity. Adapted from Clin Immunol. 2006;119:180Y187.
proinflammatory cytokines such as interferon-+ and TNF-!
(24), and an interferon-+Yresponsive element was found in the
promoter region of the gene encoding TLR-4 (25).
EXPRESSION OF TOLL-LIKE RECEPTORS
AND THEIR RESPONSE TO SPECIFIC LIGANDS
DURING SEPSIS
In contrast to the resting state and nonseptic condition, it
remains unclear whether TLR expression may be associated with
the response after exposure to TLR-specific ligands during
sepsis. It is well known that peripheral blood monocytes isolated
from septic patients synthesize and/or secrete reduced quantities
of proinflammatory cytokines after ex vivo LPS stimulation
(26Y28) regardless of their up-regulated TLR expression in
both experimental and human sepsis (29Y32). What determines
such differential responses during sepsis? To elucidate this, we
investigated whether LPS-induced chemokine (macrophage
inflammatory protein 2 [MIP-2]) is produced by bronchoalveolar lavage fluid (BALF), liver, and spleen cells from CLP and
sham-operated mice. Cecal ligation and puncture mice showed
significantly increased TLR-4 expression on BALF cells and on
macrophages of the liver and spleen as compared with shamoperated mice (13) (Fig. 1A). We demonstrated that LPSinduced MIP-2 production by BALF and liver mononuclear
cells from CLP mice was significantly increased, although
there was no difference in splenic MIP-2 production between
CLP and sham-operated mice (Fig. 1B). In the human study,
we demonstrated that PBMCs from the septic patients, having
up-regulated TLR-4 expression, showed significantly reduced
IL-1" production after LPS exposure as compared with healthy
individuals. In contrast, PBMCs from patients after a nonseptic
elective surgical operation who had up-regulated TLR-4
318
SHOCK VOL. 29, NO. 3
TSUJIMOTO
ET AL.
FIG. 3. Relationship between APACHE II score and TLR-2, TLR-4, and CD14 expression in septic patients. Acute physiology and chronic health
evaluation II score showed no correlation with TLR-2, TLR-4, and CD14 expression on peripheral blood monocytes in septic patients. ) indicates patients with
favorable outcome; &, patients with unfavorable outcome. MFI indicates mean fluorescence intensity. Adapted from Shock. 2005;23:39Y44.
expression showed significantly greater IL-1" production after
LPS stimulation as compared with cells obtained from both the
septic group and healthy controls (Fig. 2) (33). Taking these
results together, the responses to specific ligands against TLR
during sepsis seem to depend not only on the degree of TLR
expression but also on organ specificity or the expression of
intracellular inhibitory molecules (34).
TOLL-LIKE RECEPTOR EXPRESSION
AND SEVERITY OF SEPSIS
A limited number of studies have investigated how highly
expressed TLRs may contribute to the severity of illness or
mortality during sepsis. We have previously investigated the
relationship between the severity of illness and the expression of
TLR-2, TLR-4, and CD14 on monocytes. There was no significant correlation between the acute physiology and chronic
health evaluation II (APACHE II) scores (35) and the expression of these molecules (Fig. 3) (13). The reason may be that
severely septic patients, especially patients with APACHE II
scores greater than 20 and an unfavorable clinical outcome, did
not have increased expression of TLRs relative to less severely
injured patients. The association between TLR expression and
the severity of illness in septic patients, however, remains elusive, and further investigations will be necessary.
GENETIC DETERMINATION OF THE
INFLAMMATORY RESPONSE
Epidemiological studies suggest a strong genetic influence
on the outcome of sepsis, and genetics may explain the variation in the individual response to infection that has long puzzled clinicians (36Y39). The TLR-4 gene is mutated or deleted
in the LPS-resistant mouse strainsVC3H/HeJ and C57BL10/
ScCrVexhibiting a greatly diminished LPS response (40, 41).
Hagberg et al. (42) demonstrated that C3H/HeJ mice had
significantly increased susceptibility to gram-negative bacteria in experimental urinary tract infection. On the other
hand, it has been reported that the presence of mutant TLR-4
does not correlate with either cytokine response or the development of organ injury in polymicrobial sepsis (43, 44). There
has been extensive research on whether genetic variations can
be used to identify patients at high risk for the development of
sepsis and organ dysfunction during severe infection (37, 45,
46). Single-base variations, known as single-nucleotide poly-
morphisms, are the most commonly used variants. Several
mutations within the extracellular region of TLR-4 were
identified, including the Asp(299)Gly and Thr(399)Ile mutations (47). Some groups have shown that individuals with
polymorphisms in TLR-4 are hyporesponsive to endotoxin
(47, 48), whereas other investigators have not (49, 50).
Although septic patients with TLR-4 polymorphism have
been shown to have reduced levels of circulating inflammatory cytokines (51) and an increased risk of bacterial infection
(52, 53), the association of mortality with polymorphism in
TLRs during sepsis is still controversial (Table 3) (44). It has
been reported that genetic polymorphisms vary according to
race and certain other factors (54, 55); in particular, Asian
people seem to have a very rare TLR-4 Asp(299)Gly mutation
and/or Thr(399)Ile polymorphisms (54Y56). Although positive
or negative association between a polymorphism and clinical
outcome has been identified in septic patients, the confidence
is often tenuous because of small sample sizes. Thus, further
research is required to determine whether genetic variation in
TABLE 3. TLR-4 polymorphism and its correlation with
clinical outcome
Diagnosis
Association with
clinical outcome
Odds
ratio
Reference
SIRS patients
Yes
4.3
84
Severe RSV bronchitis
Yes
ND
85
Chronic periodontitis
Yes
5.6
86
Brucellosis
Yes
2.9
87
Candida infection
Yes
3.0
88
Acute pancreatitis
Yes
ND
89
Aggressive periodontitis
Yes
ND
90
Thermal injury
Yes
ND
91
Acute pancreatitis
No
ND
92
Necrotizing enterocolitis in very
low birth weight infant
No
ND
93
Sepsis
No
ND
44
Cardiac surgery
No
ND
94
Esophagectomy
No
ND
95
Pneumococcal infection
No
ND
96
RSV infection
No
ND
97
ND indicates not defined; RSV, respiratory syncytial virus; SIRS,
systemic inflammatory response syndrome.
SHOCK MARCH 2008
FIG. 4. Schema of possible mechanisms of sepsis-related organ
injury by the endogenous mediators through the binding with TLRs.
This mechanism may contribute to the organ dysfunction and high mortality
that occurs in sepsis.
TLRs affects the organ injury and/or mortality in polymicrobial sepsis.
ENDOGENOUS LIGANDS FOR
TOLL-LIKE RECEPTORS
Another recent important observation is that TLRs are also
involved in the recognition of endogenous ligands, some of
which have been recently named Balarmins[ (57) (Table 1).
Toll-like receptor 4 was shown to be involved in the recognition of extra domain AYcontaining fibronectin (58), fibrinogen (59), polysaccharide fragments of heparan sulfate (60),
oligosaccharides of hyaluronic acid (61), "-defensin 2 (62),
oxidized low-density lipoprotein (63), several heat shock proteins (HSPs) (64Y67), surfactant protein A in the lung epithelium 1 (68), neutrophil elastase (13, 69), and high-mobility
group box 1 protein (HMGB-1) (70, 71). Toll-like receptor 2
has also been suggested to play a role in the recognition of
HSP-60 (72) and unidentified factors from necrotic cells (73).
Recently, TLR-3 was also shown to recognize self-messenger
RNA (74), and TLR-9 was shown to recognize self-DNA and
chromatinYimmunoglobulin G complexes (75). In addition,
one of the small leucine-rich proteoglycans (biglycan) was
demonstrated to be recognized by both TLR-2 and TLR-4
(76). Thus, the discovery that TLRs also have the capacity to
recognize endogenous or harmful self-antigens suggests that
their function may not be restricted to the recognition of
extrinsic pathogens. Taking these findings together, we
consider that TLRs play a key role in the development of
sepsis and sepsis-related organ injury through both exogenous
pathogens and endogenous ligands.
ENDOGENOUS LIGANDS CONTRIBUTE TO ORGAN
INJURY LIKE A CYTOKINE THROUGH TOLL-LIKE
RECEPTOR BINDING
Although several endogenous ligands have been implicated
for TLRs, it is unclear how they contribute to sepsis-related
organ injury through interaction with TLRs. High-mobility
group box 1 is a nuclear protein that is released extracellularly
TOLL-LIKE RECEPTORS
IN
SEPSIS
319
as a late mediator of lethality in sepsis and after necrotic, but
not apoptotic, death (77, 78). Recent in vitro studies suggest
that some of the effects of HMGB-1 result from its interaction
with TLR-2 or TLR-4, and with the receptor for advanced
glycation end products (70, 71). Tsung et al. (71) clearly
demonstrated that HMGB-1 mediates inflammation and organ
damage in hepatic I/R injury depending upon the activation of
TLR-4 signaling. Their findings suggest that a harmful
mediator, HMGB-1, secreted from activated immunocompetent cells during sepsis, can in turn activate TLRs, resulting in
further inflammation and organ injury. Johnson et al. (79)
demonstrated that TLR-4 mutant mice were defective against
the administration of heparan sulfate, which was degraded by
proteases in inflammatory, traumatic, and septic conditions,
whereas TLR-4 wild-type mice were killed. In addition, we
investigated the roles of neutrophil elastase, MIP-2, and TLR-4
in organ injury in septic mice, showing that chemokine-induced
recruitment of neutrophils into the lungs and liver in sepsis
likely results in the augmented release of neutrophil elastase,
which in turn may be associated with the production of higher
levels of chemokines through binding with highly expressed
TLR-4 (13). Together with these findings, the fact that
endogenous ligands released through TLR signaling especially
during sepsis engage with TLRs supports the idea of the
perpetuation of a cycle of progressive organ injury during
sepsis (Fig. 4). This mechanism may contribute to the organ
dysfunction and high mortality that occurs in sepsis.
CONCLUDING REMARKS
It is likely that the expression and function of TLRs greatly
influence the quality and control of innate immune response
in patients with infectious disease. Modulation of TLR-4
expression may be a double-edged sword because TLRs play
an important role in the host’s defense against invading
microbes. Indeed, mice with genetically mutated TLR-4 were
reported to be highly susceptible to gram-negative bacterial
infection compared with wild-type mice (42), although such
mutant mice have defective responses against the endogenous
danger signals that are subsequently produced in severe
infection. Taking these findings together, we can conclude
that TLRs are essential for triggering the host’s immune
response, acting as a sensor against invading pathogens. They
may also serve as receptors for endogenous toxic signals,
leading to tissue damage, especially in organs away from the
site of infection or after successful elimination of microbes by
drainage, antibiotics, or surgery. We believe that TLR antagonism should be useful in the latter case. Thus, new knowledge
regarding TLRs suggests that the manipulation of TLR signaling pathways has great therapeutic potential especially in
the treatment of organ injury accompanying sepsis. Further
understanding of the biology of TLRs will open avenues for
novel therapeutic approaches for sepsis.
REFERENCES
1. Wheeler AP, Bernard GR: Treating patients with severe sepsis. N Engl J Med
340:207Y214, 1999.
2. Stone R: Search for sepsis drugs goes on despite past failures. Science 264:
365Y367, 1994.
320
SHOCK VOL. 29, NO. 3
3. Abraham E: Why immunomodulatory therapies have not worked in sepsis.
Intensive Care Med 25:556Y566, 1999.
4. Zeni F, Freeman B, Natanson C: Anti-inflammatory therapies to treat sepsis
and septic shock: a reassessment. Crit Care Med 25:1095Y1100, 1997.
5. Efron P, Moldawer LL: Sepsis and the dendritic cell. Shock 20:386Y401, 2003.
6. Fry DE: Sepsis syndrome. Am Surg 66:126Y132, 2000.
7. Opal SM, Huber CE: Bench-to-bedside review: Toll-like receptors and their
role in septic shock. Crit Care 6:125Y136, 2002.
8. Hotchkiss RS, Karl IE: The pathophysiology and treatment of sepsis. N Engl J
Med 348:138Y150, 2003.
9. Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RA: Phylogenetic
perspectives in innate immunity. Science 284:1313Y1318, 1999.
10. Medzhitov R, Preston-Hurlburt P, Janeway CA Jr: A human homologue of the
Drosophila Toll protein signals activation of adaptive immunity. Nature 388:
394Y397, 1997.
11. Tsujimoto H, Ono S, Hiraki S, Majima T, Kawarabayashi N, Sugasawa H,
Kinoshita M, Hiraide H, Mochizuki H: Hemoperfusion with polymyxin Bimmobilized fibers reduced the number of CD16+ CD14+ monocytes in
patients with septic shock. J Endotoxin Res 10:229Y237, 2004.
12. Armstrong L, Medford AR, Hunter KJ, Uppington KM, Millar AB: Differential expression of Toll-like receptor (TLR)-2 and TLR-4 on monocytes in
human sepsis. Clin Exp Immunol 136:312Y319, 2004.
13. Tsujimoto H, Ono S, Majima T, Kawarabayashi N, Takayama E, Kinoshita M,
Seki S, Hiraide H, Moldawer LL, Mochizuki H: Neutrophil elastase, MIP-2,
and TLR-4 expression during human and experimental sepsis. Shock 23:39Y44,
2005.
14. Williams DL, Ha T, Li C, Kalbfleisch JH, Schweitzer J, Vogt W, Browder IW:
Modulation of tissue Toll-like receptor 2 and 4 during the early phases of
polymicrobial sepsis correlates with mortality. Crit Care Med 31:1808Y1818,
2003.
15. Andonegui G, Bonder CS, Green F, Mullaly SC, Zbytnuik L, Raharjo E, Kubes P:
Endothelium-derived Toll-like receptor-4 is the key molecule in LPS-induced
neutrophil sequestration into lungs. J Clin Invest 111:1011Y1020, 2003.
16. Viemann D, Dubbel G, Schleifenbaum S, Harms E, Sorg C, Roth J: Expression
of Toll-like receptors in neonatal sepsis. Pediatr Res 58:654Y659, 2005.
17. Renshaw M, Rockwell J, Engleman C, Gewirtz A, Katz J, Sambhara S: Cutting
edge: impaired Toll-like receptor expression and function in aging. J Immunol
169:4697Y4701, 2002.
18. Ono S, Tsujimoto H, Hiraki S, Takahata R, Kinoshita M, Mochizuki H: Sex
differences in cytokine production and surface antigen expression of peripheral
blood mononuclear cells after surgery. Am J Surg 190:439Y444, 2005.
19. Nomura F, Akashi S, Sakao Y, Sato S, Kawai T, Matsumoto M, Nakanishi K,
Kimoto M, Miyake K, Takeda K, et al.: Cutting edge: endotoxin tolerance in
mouse peritoneal macrophages correlates with down-regulation of surface
Toll-like receptor 4 expression. J Immunol 164:3476Y3479, 2000.
20. Tsujimoto H, Efron PA, Matsumoto T, Ungaro RF, Abouhamze A, Ono S,
Mochizuki H, Moldawer LL: Maturation of murine bone marrow-derived
dendritic cells with poly(I:C) produces altered TLR-9 expression and response
to CpG DNA. Immunol Lett 107:155Y162, 2006.
21. Bihl F, Salez L, Beaubier M, Torres D, Lariviere L, Laroche L, Benedetto A,
Martel D, Lapointe JM, Ryffel B, et al.: Overexpression of Toll-like receptor 4
amplifies the host response to lipopolysaccharide and provides a survival
advantage in transgenic mice. J Immunol 170:6141Y6150, 2003.
22. Paterson HM, Murphy TJ, Purcell EJ, Shelley O, Kriynovich SJ, Lien E,
Mannick JA, Lederer JA: Injury primes the innate immune system for
enhanced Toll-like receptor reactivity. J Immunol 171:1473Y1483, 2003.
23. Motegi A, Kinoshita M, Sato K, Shinomiya N, Ono S, Nonoyama S, Hiraide H,
Seki S: An in vitro Shwartzman reactionYlike response is augmented agedependently in human peripheral blood mononuclear cells. J Leukoc Biol
79:463Y472, 2006.
24. Bosisio D, Polentarutti N, Sironi M, Bernasconi S, Miyake K, Webb GR,
Martin MU, Mantovani A, Muzio M: Stimulation of toll-like receptor 4
expression in human mononuclear phagocytes by interferon-gamma: a
molecular basis for priming and synergism with bacterial lipopolysaccharide.
Blood 99:3427Y3431, 2002.
25. Rehli M, Poltorak A, Schwarzfischer L, Krause SW, Andreesen R, Beutler B:
PU.1 and interferon consensus sequence-binding protein regulate the myeloid
expression of the human Toll-like receptor 4 gene. J Biol Chem 275:
9773Y9781, 2000.
26. Ertel W, Kremer JP, Kenney J, Steckholzer U, Jarrar D, Trentz O, Schildberg FW:
Downregulation of proinflammatory cytokine release in whole blood from
septic patients. Blood 85:1341Y1347, 1995.
27. Munoz C, Carlet J, Fitting C, Misset B, Bleriot JP, Cavaillon JM:
Dysregulation of in vitro cytokine production by monocytes during sepsis.
J Clin Invest 88:1747Y1754, 1991.
28. McCall CE, Grosso-Wilmoth LM, LaRue K, Guzman RN, Cousart SL:
Tolerance to endotoxin-induced expression of the interleukin-1 beta gene in
TSUJIMOTO
29.
30.
31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
48.
49.
50.
51.
52.
ET AL.
blood neutrophils of humans with the sepsis syndrome. J Clin Invest 91:
853Y861, 1993.
El-Achkar TM, Huang X, Plotkin Z, Sandoval RM, Rhodes GJ, Dagher PC:
Sepsis induces changes in the expression and distribution of Toll-like
receptor 4 in the rat kidney. Am J Physiol Renal Physiol 290:F1034YF1043,
2006.
Brandl K, Gluck T, Huber C, Salzberger B, Falk W, Hartmann P: TLR-4
surface display on human monocytes is increased in septic patients. Eur J Med
Res 10:319Y324, 2005.
Calvano JE, Agnese DM, Um JY, Goshima M, Singhal R, Coyle SM, Reddell MT,
Kumar A, Calvano SE, Lowry SF: Modulation of the lipopolysaccharide
receptor complex (CD14, TLR4, MD-2) and Toll-like receptor 2 in systemic
inflammatory response syndromeYpositive patients with and without infection: relationship to tolerance. Shock 20:415Y419, 2003.
Murphy TJ, Paterson HM, Mannick JA, Lederer JA: Injury, sepsis, and the
regulation of Toll-like receptor responses. J Leukoc Biol 75:400Y407, 2004.
Tsujimoto H, Ono S, Majima T, Efron PA, Kinoshita M, Hiraide H, Moldawer LL,
Mochizuki H: Differential Toll-like receptor expression after ex vivo
lipopolysaccharide exposure in patients with sepsis and following surgical
stress. Clin Immunol 119:180Y187, 2006.
Kobayashi K, Hernandez LD, Galan JE, Janeway CA Jr, Medzhitov R,
Flavell RA: IRAK-M is a negative regulator of Toll-like receptor signaling.
Cell 110:191Y202, 2002.
Knaus WA, Draper EA, Wagner DP, Zimmerman JE: APACHE II: a severity
of disease classification system. Crit Care Med 13:818Y829, 1985.
Holmes CL, Russell JA, Walley KR: Genetic polymorphisms in sepsis and
septic shock: role in prognosis and potential for therapy. Chest 124:
1103Y1115, 2003.
Arcaroli J, Fessler MB, Abraham E: Genetic polymorphisms and sepsis. Shock
24:300Y312, 2005.
Sutherland AM, Russell JA: Issues with polymorphism analysis in sepsis. Clin
Infect Dis 41(Suppl 7):S396YS402, 2005.
Sutherland AM, Walley KR, Russell JA: Polymorphisms in CD14, mannosebinding lectin, and Toll-like receptor-2 are associated with increased prevalence of infection in critically ill adults. Crit Care Med 33:638Y644, 2005.
Akira S, Takeda K, Kaisho T: Toll-like receptors: critical proteins linking
innate and acquired immunity. Nat Immunol 2:675Y680, 2001.
Janeway CA Jr, Medzhitov R: Innate immune recognition. Annu Rev Immunol
20:197Y216, 2002.
Hagberg L, Hull R, Hull S, McGhee JR, Michalek SM, Svanborg Eden C:
Difference in susceptibility to gram-negative urinary tract infection between
C3H/HeJ and C3H/HeN mice. Infect Immun 46:839Y844, 1984.
Weighardt H, Kaiser-Moore S, Vabulas RM, Kirschning CJ, Wagner H,
Holzmann B: Cutting edge: myeloid differentiation factor 88 deficiency
improves resistance against sepsis caused by polymicrobial infection. J Immunol
169:2823Y2827, 2002.
Feterowski C, Emmanuilidis K, Miethke T, Gerauer K, Rump M, Ulm K,
Holzmann B, Weighardt H: Effects of functional Toll-like receptor-4 mutations on the immune response to human and experimental sepsis. Immunology
109:426Y431, 2003.
Gao L, Grant A, Halder I, Brower R, Sevransky J, Maloney JP, Moss M,
Shanholtz C, Yates CR, Meduri GU, et al.: Novel polymorphisms in the
myosin light chain kinase gene confer risk for acute lung injury. Am J Respir
Cell Mol Biol 34:487Y495, 2006.
Villar J, Maca-Meyer N, Perez-Mendez L, Flores C: Bench-to-bedside
review: understanding genetic predisposition to sepsis. Crit Care 8:180Y189,
2004.
Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, Frees K, Watt JL,
Schwartz DA: TLR4 mutations are associated with endotoxin hyporesponsiveness in humans. Nat Genet 25:187Y191, 2000.
Michel O, LeVan TD, Stern D, Dentener M, Thorn J, Gnat D, Beijer ML,
Cochaux P, Holt PG, Martinez FD, et al.: Systemic responsiveness to
lipopolysaccharide and polymorphisms in the Toll-like receptor 4 gene in
human beings. J Allergy Clin Immunol 112:923Y929, 2003.
Erridge C, Stewart J, Poxton IR: Monocytes heterozygous for the Asp299Gly
and Thr399Ile mutations in the Toll-like receptor 4 gene show no deficit in
lipopolysaccharide signalling. J Exp Med 197:1787Y1791, 2003.
Imahara SD, Jelacic S, Junker CE, O’Keefe GE: The TLR4 +896 polymorphism is not associated with lipopolysaccharide hypo-responsiveness in
leukocytes. Genes Immun 6:37Y43, 2005.
Kiechl S, Lorenz E, Reindl M, Wiedermann CJ, Oberhollenzer F, Bonora E,
Willeit J, Schwartz DA: Toll-like receptor 4 polymorphisms and atherogenesis.
N Engl J Med 347:185Y192, 2002.
Agnese DM, Calvano JE, Hahm SJ, Coyle SM, Corbett SA, Calvano SE,
Lowry SF: Human Toll-like receptor 4 mutations but not CD14 polymorphisms are associated with an increased risk of gram-negative infections.
J Infect Dis 186:1522Y1525, 2002.
SHOCK MARCH 2008
53. Lorenz E, Mira JP, Frees KL, Schwartz DA: Relevance of mutations in the
TLR4 receptor in patients with gram-negative septic shock. Arch Intern Med
162:1028Y1032, 2002.
54. Nakada T, Hirasawa H, Oda S, Shiga H, Matsuda K, Nakamura M, Watanabe E,
Abe R, Hatano M, Tokuhisa T: Influence of Toll-like receptor 4, CD14,
tumor necrosis factor, and interleukine-10 gene polymorphisms on clinical
outcome in Japanese critically ill patients. J Surg Res 129:322Y328, 2005.
55. Yoon HJ, Choi JY, Kim CO, Park YS, Kim MS, Kim YK, Shin SY, Kim JM,
Song YG: Lack of Toll-like receptor 4 and 2 polymorphisms in Korean
patients with bacteremia. J Korean Med Sci 21:979Y982, 2006.
56. Hang J, Zhou W, Zhang H, Sun B, Dai H, Su L, Christiani DC: TLR4
Asp299Gly and Thr399Ile polymorphisms are very rare in the Chinese
population. J Endotoxin Res 10:238Y240, 2004.
57. Bianchi ME: DAMPs, PAMPs and alarmins: all we need to know about
danger. J Leukoc Biol 81:1Y5, 2007.
58. Okamura Y, Watari M, Jerud ES, Young DW, Ishizaka ST, Rose J, Chow JC,
Strauss JF III: The extra domain A of fibronectin activates Toll-like receptor 4.
J Biol Chem 276:10229Y10233, 2001.
59. Smiley ST, King JA, Hancock WW: Fibrinogen stimulates macrophage
chemokine secretion through toll-like receptor 4. J Immunol 167:2887Y2894,
2001.
60. Johnson GB, Brunn GJ, Kodaira Y, Platt JL: Receptor-mediated monitoring of
tissue well-being via detection of soluble heparan sulfate by Toll-like receptor
4. J Immunol 168:5233Y5239, 2002.
61. Termeer C, Benedix F, Sleeman J, Fieber C, Voith U, Ahrens T, Miyake K,
Freudenberg M, Galanos C, Simon JC: Oligosaccharides of hyaluronan
activate dendritic cells via Toll-like receptor 4. J Exp Med 195:99Y111, 2002.
62. Biragyn A, Ruffini PA, Leifer CA, Klyushnenkova E, Shakhov A, Chertov O,
Shirakawa AK, Farber JM, Segal DM, Oppenheim JJ, et al.: Toll-like receptor
4Ydependent activation of dendritic cells by beta-defensin 2. Science
298:1025Y1029, 2002.
63. Xu XH, Shah PK, Faure E, Equils O, Thomas L, Fishbein MC, Luthringer D,
Xu XP, Rajavashisth TB, Yano J, et al.: Toll-like receptor-4 is expressed by
macrophages in murine and human lipid-rich atherosclerotic plaques and
upregulated by oxidized LDL. Circulation 104:3103Y3108, 2001.
64. Ohashi K, Burkart V, Flohe S, Kolb H: Cutting edge: heat shock protein 60 is a
putative endogenous ligand of the toll-like receptorY4 complex. J Immunol
164:558Y561, 2000.
65. Vabulas RM, Ahmad-Nejad P, Ghose S, Kirschning CJ, Issels RD, Wagner H:
HSP70 as endogenous stimulus of the Toll/interleukin-1 receptor signal
pathway. J Biol Chem 277:15107Y15112, 2002.
66. Cohen-Sfady M, Nussbaum G, Pevsner-Fischer M, Mor F, Carmi P, ZaninZhorov A, Lider O, Cohen IR: Heat shock protein 60 activates B cells via the
TLR4-MyD88 pathway. J Immunol 175:3594Y3602, 2005.
67. Zanin-Zhorov A, Tal G, Shivtiel S, Cohen M, Lapidot T, Nussbaum G,
Margalit R, Cohen IR, Lider O: Heat shock protein 60 activates cytokineassociated negative regulator suppressor of cytokine signaling 3 in T cells:
effects on signaling, chemotaxis, and inflammation. J Immunol 175:276Y285,
2005.
68. Guillot L, Balloy V, McCormack FX, Golenbock DT, Chignard M, Si-Tahar M:
Cutting edge: the immunostimulatory activity of the lung surfactant
proteinYA involves Toll-like receptor 4. J Immunol 168:5989Y5992, 2002.
69. Devaney JM, Greene CM, Taggart CC, Carroll TP, O’Neill SJ, McElvaney NG:
Neutrophil elastase up-regulates interleukin-8 via toll-like receptor 4. FEBS Lett
544:129Y132, 2003.
70. Park JS, Svetkauskaite D, He Q, Kim JY, Strassheim D, Ishizaka A, Abraham E:
Involvement of Toll-like receptors 2 and 4 in cellular activation by high mobility
group box 1 protein. J Biol Chem 279:7370Y7377, 2004.
71. Tsung A, Sahai R, Tanaka H, Nakao A, Fink MP, Lotze MT, Yang H, Li J,
Tracey KJ, Geller DA, et al.: The nuclear factor HMGB1 mediates hepatic
injury after murine liver ischemia-reperfusion. J Exp Med 201:1135Y1143, 2005.
72. Vabulas RM, Ahmad-Nejad P, da Costa C, Miethke T, Kirschning CJ, Hacker H,
Wagner H: Endocytosed HSP60s use toll-like receptor 2 (TLR2) and TLR4 to
activate the Toll/interleukin-1 receptor signaling pathway in innate immune cells.
J Biol Chem 276:31332Y31339, 2001.
73. Li M, Carpio DF, Zheng Y, Bruzzo P, Singh V, Ouaaz F, Medzhitov RM, Beg AA:
An essential role of the NF-kappa B/Toll-like receptor pathway in induction of
inflammatory and tissue-repair gene expression by necrotic cells. J Immunol
166:7128Y7135, 2001.
74. Kariko K, Ni H, Capodici J, Lamphier M, Weissman D: mRNA is an
endogenous ligand for Toll-like receptor 3. J Biol Chem 279:12542Y12550,
2004.
75. Leadbetter EA, Rifkin IR, Hohlbaum AM, Beaudette BC, Shlomchik MJ,
Marshak-Rothstein A: Chromatin-IgG complexes activate B cells by dual
engagement of IgM and Toll-like receptors. Nature 416:603Y607, 2002.
76. Schaefer L, Babelova A, Kiss E, Hausser HJ, Baliova M, Krzyzankova M,
Marsche G, Young MF, Mihalik D, Gotte M, et al.: The matrix component
TOLL-LIKE RECEPTORS
77.
78.
79.
80.
81.
82.
83.
84.
85.
86.
87.
88.
89.
90.
91.
92.
93.
94.
95.
96.
97.
IN
SEPSIS
321
biglycan is proinflammatory and signals through Toll-like receptors 4 and 2 in
macrophages. J Clin Invest 115:2223Y2233, 2005.
Yang H, Ochani M, Li J, Qiang X, Tanovic M, Harris HE, Susarla SM, Ulloa L,
Wang H, DiRaimo R, et al.: Reversing established sepsis with antagonists of
endogenous high-mobility group box 1. Proc Natl Acad Sci U S A 101:296Y301,
2004.
Wang H, Bloom O, Zhang M, Vishnubhakat JM, Ombrellino M, Che J, Frazier A,
Yang H, Ivanova S, Borovikova L, et al.: HMG-1 as a late mediator of endotoxin
lethality in mice. Science 285:248Y251, 1999.
Johnson GB, Brunn GJ, Platt JL: Cutting edge: an endogenous pathway to
systemic inflammatory response syndrome (SIRS)Ylike reactions through Tolllike receptor 4. J Immunol 172:20Y24, 2004.
Edelman DA, Jiang Y, Tyburski J, Wilson RF, Steffes C: Toll-like receptor4 message is up-regulated in lipopolysaccharide-exposed rat lung pericytes.
J Surg Res 134:22Y27, 2006.
Tsujimoto H, Ono S, Matsumoto A, Kawabata T, Kinoshita M, Majima T,
Hiraki S, Seki S, Moldawer LL, Mochizuki H: A critical role of CpG motifs in
a murine peritonitis model by their binding to highly expressed toll-like
receptor-9 on liver NKT cells. J Hepatol 45:836Y843, 2006.
Yu M, Shao D, Liu J, Zhu J, Zhang Z, Xu J: Effects of ketamine on levels of
cytokines, NF-kappaB and TLRs in rat intestine during CLP-induced sepsis.
Int Immunopharmacol 7:1076Y1082, 2007.
Baiyee EE, Flohe S, Lendemans S, Bauer S, Mueller N, Kreuzfelder E,
Grosse-Wilde H: Expression and function of Toll-like receptor 9 in severely
injured patients prone to sepsis. Clin Exp Immunol 145:456Y462, 2006.
Child NJ, Yang IA, Pulletz MC, de Courcy-Golder K, Andrews AL,
Pappachan VJ, Holloway JW: Polymorphisms in Toll-like receptor 4 and the
systemic inflammatory response syndrome. Biochem Soc Trans 31:652Y653,
2003.
Tal G, Mandelberg A, Dalal I, Cesar K, Somekh E, Tal A, Oron A, Itskovich S,
Ballin A, Houri S, et al.: Association between common Toll-like receptor 4
mutations and severe respiratory syncytial virus disease. J Infect Dis
189:2057Y2063, 2004.
Schroder NW, Meister D, Wolff V, Christan C, Kaner D, Haban V, Purucker P,
Hermann C, Moter A, Gobel UB, et al.: Chronic periodontal disease is associated
with single-nucleotide polymorphisms of the human TLR-4 gene. Genes Immun
6:448Y451, 2005.
Rezazadeh M, Hajilooi M, Rafiei A, Haidari M, Nikoopour E, Kerammat F,
Mamani M, Ranjbar M, Hashemi H: TLR4 polymorphism in Iranian patients
with brucellosis. J Infect 53:206Y210, 2006.
Van der Graaf CA, Netea MG, Morre SA, Den Heijer M, Verweij PE, Van der
Meer JW, Kullberg BJ: Toll-like receptor 4 Asp299Gly/Thr399Ile polymorphisms are a risk factor for Candida bloodstream infection. Eur Cytokine
Netw 17:29Y34, 2006.
Gao HK, Zhou ZG, Li Y, Chen YQ: Toll-like receptor 4 Asp299Gly
polymorphism is associated with an increased risk of pancreatic necrotic
infection in acute pancreatitis: a study in the Chinese population. Pancreas
34:295Y298, 2007.
James JA, Poulton KV, Haworth SE, Payne D, McKay IJ, Clarke FM,
Hughes FJ, Linden GJ: Polymorphisms of TLR4 but not CD14 are associated
with a decreased risk of aggressive periodontitis. J Clin Periodontol 34:
111Y117, 2007.
Barber RC, Chang LY, Arnoldo BD, Purdue GF, Hunt JL, Horton JW, Aragaki CC:
Innate immunity SNPs are associated with risk for severe sepsis after burn
injury. Clin Med Res 4:250Y255, 2006.
Hofner P, Balog A, Gyulai Z, Farkas G, Rakonczay Z, Takacs T, Mandi Y:
Polymorphism in the IL-8 gene, but not in the TLR4 gene, increases the
severity of acute pancreatitis. Pancreatology 6:542Y548, 2006.
Szebeni B, Szekeres R, Rusai K, Vannay A, Veres G, Treszl A, Arato A,
Tulassay T, Vasarhelyi B: Genetic polymorphisms of CD14, Toll-like receptor
4, and caspase-recruitment domain 15 are not associated with necrotizing
enterocolitis in very low birth weight infants. J Pediatr Gastroenterol Nutr
42:27Y31, 2006.
Schippers EF, van ’t Veer C, van Voorden S, Martina CA, le Cessie S, van
Dissel JT: TNF-alpha promoter, Nod2 and Toll-like receptorY4 polymorphisms
and the in vivo and ex vivo response to endotoxin. Cytokine 26:16Y24, 2004.
Azim K, McManus R, Brophy K, Ryan A, Kelleher D, Reynolds JV: Genetic
polymorphisms and the risk of infection following esophagectomy. Positive
association with TNF-alpha gene-308 genotype. Ann Surg 246:122Y128,
2007.
Moens L, Verhaegen J, Pierik M, Vermeire S, De Boeck K, Peetermans WE,
Bossuyt X: Toll-like receptor 2 and Toll-like receptor 4 polymorphisms in
invasive pneumococcal disease. Microbes Infect 9:15Y20, 2007.
Paulus SC, Hirschfeld AF, Victor RE, Brunstein J, Thomas E, Turvey SE:
Common human Toll-like receptor 4 polymorphismsVrole in susceptibility to
respiratory syncytial virus infection and functional immunological relevance.
Clin Immunol 123:252Y257, 2007.
Review
Host–pathogen interactions in sepsis
Tom van der Poll, Steven M Opal
Lancet Infect Dis 2008; 8: 32–43
Published Online
December 5, 2007
DOI: 10.1016/S14733099(07)70265-7
Academic Medical Centre,
University of Amsterdam,
Centre for Infection and
Immunity–Amsterdam, and
Centre for Experimental and
Molecular Medicine,
Amsterdam, Netherlands
(Prof T van der Poll MD); and
Infectious Disease Division,
Memorial Hospital and the
Warren Alpert Brown Medical
School, Providence, RI, USA
(Prof S M Opal MD)
Correspondence to:
Prof Tom van der Poll, Academic
Medical Center, Meibergdreef 9,
G2-130, 1105 AZ, Amsterdam,
Netherlands.
Tel +31 20 5665910;
fax +31 20 6977192;
t.vanderpoll@amc.uva.nl
Sepsis is a major health problem. The concept that sepsis mortality is the result of an uncontrolled hyperinflammatory
host response has recently been challenged. It is now widely thought that the host response to sepsis involves many,
concomitant, integrated, and often antagonistic processes that involve both exaggerated inflammation and immune
suppression. Several novel mediators and pathways have been shown to play a part. Moreover, evidence is accumulating
that microbial virulence and bacterial load contribute to the host response and the outcome of severe infections. A
complex and dynamic interaction exists between pathogens and host immune-defence mechanisms during the
course of invasive infection. Some pathogens have acquired the capacity to communicate with each other and sense
the host’s vulnerabilities. Bidirectional signals are detectable at the critical interface between the host and microbial
invaders. The outcome of this interaction determines the fate of the host at the outset of the septic process. A
formidable array of innate and acquired immune defences must be breached if a pathogen is to successfully
disseminate and cause severe sepsis and septic shock. This Review summarises current knowledge of microbial
pathogenesis and host–pathogen interactions during sepsis and the ensuing development of potential therapeutics.
Introduction
Sepsis is the second most common cause of death in
non-coronary intensive care units and the tenth leading
cause of death overall in high-income countries.1,2 During
the past two decades, the incidence of sepsis has increased
annually by 9% to reach 240 per 100 000 population in the
USA by 2000.3 Until very recently, the prevailing concept
of the pathogenesis of sepsis was that mortality is the
consequence of an uncontrolled hyperinflammatory,
predominantly cytokine-mediated, response of the host.
In part because of the failure of dozens of clinical trials
that assessed anti-inflammatory agents in severe sepsis,
and in part because of growing insights from preclinical
models that more closely resemble clinical sepsis than
originally used in this area of research, current knowledge
of host–pathogen interactions and their consequences in
sepsis have increased tremendously. Additionally,
virulence and bacterial load are now thought to contribute
to the host response and the outcome of severe infections.
This Review summarises recent advances in the
understanding of microbial pathogenesis and
host–pathogen interactions during severe sepsis. The
increased insights into the pathogenesis of sepsis have
led to the design and development of novel therapies,
some of which have reached the clinical phase of
assessment.
The pathogen: microbial pathogenesis and
virulence characteristics
32
this form of sepsis has a particularly poor prognosis. The
most commonly isolated Gram-positive bacterial
pathogens are Staphylococcus aureus and Streptococcus
pneumoniae, and the most common Gram-negative
pathogens are Escherichia coli, Klebsiella spp, and
Pseudomonas aeruginosa.4
Expression and regulation of microbial virulence
Microbial genomics have established the remarkable
array of genetic determinants that are needed for the full
expression of microbial virulence.5 Pathogenic strains of
bacterial species differ from commensal strains by the
acquisition and expression of specific clusters of virulence
genes. Potential pathogens face enormous challenges
when attempting to invade a human host. They must
attach to host tissue, cross the mucosal surface or
integument, replicate, and disseminate faster than the
host’s antimicrobial defence systems.6,7
A myriad of rather ingenious defensive and offensive
weaponry are expressed by microbial invaders in sepsis.8
Global regulators of the entire collection of virulence
genes (known as the virulome) have recently been
characterised.9 Virulence genes scattered across the
bacterial chromosome are now recognised to work
together in patterns with sequential sets of transcriptional
programmes. The regulation of virulence expression is
increasingly being elucidated, and this may offer new
therapeutic targets in the care of septic patients.6
Causative microorganisms
Bacterial toxins
Whereas, until the early 1980s, Gram-negative bacteria
were the predominant organisms that caused sepsis, the
incidence of Gram-positive sepsis has steadily increased.
In a large survey done in 2000 in the USA, Gram-positive
bacteria accounted for 52·1% of sepsis cases,
Gram-negative bacteria 37·6%, polymicrobial infections
4·7%, anaerobes 1·0%, and fungi 4·6%; the greatest
relative changes were seen in the incidence of
Gram-positive and fungal infections.3 The increasing
frequency of fungal sepsis is a worrisome trend because
Much of the damage inflicted on the septic host is
attributable to microbial toxins and the host’s response to
them. There are many extracellular enzymes and
microbial mediators that contribute to tissue injury in
sepsis. Three functional classes of toxins exist and three
basic delivery systems are used by bacterial pathogens.
Type 1 toxins cause injury to the host without entering
host cells. Superantigen-mediated toxic shock syndrome
produced by either S aureus or Streptococcus pyogenes
exemplify these toxins.10 Type II toxins are direct
http://infection.thelancet.com Vol 8 January 2008
Review
eukaryotic membrane toxins and include haemolysins
and phospholipases produced by various microbial
pathogens. These toxins damage cell membranes of host
cells and allow pathogens access to intracellular contents
while disrupting the host cellular response to invading
pathogens at the onset of sepsis. Type III toxins are
known as A/B toxins owing to their obligate binary
nature. The specific binding moiety (the B component)
links with an active enzymatic component (the A moiety).
Many well-known bacterial toxins, such as cholera toxin,
anthrax lethal toxin, and shiga-like toxin, are examples of
type III toxins. Many common human pathogens, such
as S aureus, S pneumoniae, S pyogenes, E coli, and
P aeruginosa, secrete an array of A/B toxins during
microbial invasion. These toxins work in concert to
damage cellular defences, break down barriers to
invasion, and allow the pathogen to disseminate within
the host.
Bacterial exotoxins are secreted by various mechanisms
of which the type III secretion system is perhaps the
most ingenious. Type III secretion systems emanate
from a clustered set of linked genes that include over
20 gene products. This system has a sensing mechanism
that detects the cell surface of host cells. A needle-like
projection system is then assembled whereupon an array
of intracellular toxins are delivered directly into the
cytoplasm in target cells.11
One crucially important microbial toxin in the
pathogenesis of sepsis is lipopolysaccharide. Lipopolysaccharide is often referred to as endotoxin because of its
unique place in microbial physiology and in the molecular
pathogenesis of sepsis. Lipopolysaccharide is the major
structural component of the outer membrane of
Gram-negative bacteria and accounts for approximately
70% of the outer leaflet. It is essential for cell viability for
virtually all Gram-negative bacterial pathogens, with the
exception of one strain of Neisseria meningitidis.12 Despite
the well-known injurious host response to even minute
amounts of endotoxin, lipopolysaccharide has no intrinsic
toxic properties by itself.13 The toxicity of lipopolysaccharide is related to the host response to this microbial
mediator. Similar pathogen-associated molecular pattern
mediators exist in Gram-positive bacteria and fungi that
induce a potentially harmful host response during severe
sepsis.
Superantigens produced by Streptococcus spp and
S aureus have a prominent role in the pathogenesis of
toxic shock syndromes. These unusual type I toxins are
known as superantigenic because they activate CD4 T-cell
populations at a level that is least five orders of magnitude
greater than conventional antigens.10 Superantigens are
not processed for clonotypic presentation by antigenpresenting cells. They bind directly to MHC class II
molecules expressed on antigen-presenting cells and
cross link with a large number of T cells that bear common
Vβ chains and their T-cell receptor. High concentrations
of lymphokines and monokines result and induce toxic
http://infection.thelancet.com Vol 8 January 2008
shock syndrome. Immune activation induced by
superantigens potentiates the host response to other
microbial mediators, including bacterial endotoxin.14
Genomic islands, integrons, and the packaging of
virulence genes
Complete genomic analyses of various microbial
pathogens show that many virulence factors are packaged
together in specific sequences of chromosomal DNA from
which they act in concert to cause disease. Pathogenicity
islands (now known simply as genomic islands) are
unique sequences of DNA found in both Gram-positive
and Gram-negative bacteria,15,16 and probably evolved from
temperate bacteriophages. They often reside adjacent to
homologous regions of DNA near the genes for transfer
RNA or ribosomal RNA, and are flanked by inverted or
direct repeat sequences of DNA reminiscent of insertion
sites for bacteriophages. Additionally, the guanine–cytosine
(G–C) ratio of pathogenicity islands differs from the G–C
ratio found in other regions of the bacterial chromosome.
This indicates that these sequences have been horizontally
transferred, and they are derived from a different genetic
origin from the rest of the genome.17
Essentially, all known streptococcal and staphylococcal
superantigens are associated with pathogenicity islands.
Gram-negative bacteria are replete with pathogenicity
islands and their presence distinguishes pathogens from
avirulent strains within the same species.18 Most bacterial
toxins and their delivery systems (ie, type III secretion
systems) are found either within lysogenic bacteriophage
DNA sequences or pathogenicity islands encoded by the
bacterial pathogen. Other genes found within these
islands mediate inhibition of host-defence mechanisms,
invasion genes, and adhesive molecules. Strong selection
pressures promote the clustering of virulence genes into
tightly linked sequences so they can be co-regulated and
function in concert to cause disease.
Low population density
Quorum-sensing
threshold population
level or host stress
High densities;
full virulence
gene expression
Virulome turned off:
quiescent, avoid
host detection
Virulome turned on:
replication and early
vir genes activated
Virulome turned on:
late vir genes
activated
Figure 1: The central role of quorum sensing in microbial pathogenesis and virulence
Regulation of the bacterial virulome by quorum sensing. Early virulence (vir) genes include adhesins, invasion
genes, and expression of anticomplement and antiphagocytic measures. Late vir genes include exotoxins,
superantigens, cytotoxins, replication activation, genetic exchange, and antibiotic resistance expression.
33
Review
The adverse clinical consequences of evolutionary
changes within pathogenicity islands have recently been
shown by an outbreak of severe antibiotic-related colitis.19
The current epidemic of severe Clostridium difficile-related
colitis now spreading across North America and Europe
is attributable to a deletion mutation within the coding
sequence of a regulatory gene found in the C difficile
pathogenicity island responsible for enterotoxin (toxin A)
and cytotoxin (toxin B) expression. This deletion mutation
derepresses toxin A and toxin B synthesis by this
epidemic strain and increases production of these very
potent toxins 16–23 times.19 This epidemic is particularly
severe in elderly patients and is now recognised as a
cause of abdominal sepsis and death in hospital
inpatients.20
Some pathogenicity islands possess integrons, which
are specialised sequences of DNA that allow the exchange
of virulence genes or antibiotic-resistance genes into
discrete cassettes inserted between short spacer
sequences. Integrons provide a mechanism to rapidly
acquire favourable genes, thereby increasing the fitness
Pathogen
Muscarinic
receptors
Bacterial cooperation and coordinated attack patterns
PAMPs
Afferent vagus
nerve
TLRs
DAMPs
Balanced response
Pathogen elimination
Tissue recovery
Full recovery
Spleen
Host cells
Innate immmune
response
Efferent vagus
nerve
Inhibition of cytokine
release via α7 cholinergic
receptors on immune cells
Unbalanced response
Hyperinflammation
Cytokine-mediated pathology
Coagulation activation
Complement activation
Immune suppression
Inhibition of TLR signalling
Apoptosis of immune cells
Early mortality with acute
organ dysfunction
Late mortality and/or
development of
secondary infections
Figure 2: Host response to sepsis
The interaction between pathogens and the host is mediated initially via an interaction between
pathogen-associated molecular patterns (PAMPs) and Toll-like receptors (TLRs). This interaction can result in the
release of alarmins or danger-associated molecular patterns (DAMPs), which have the ability to further amplify the
inflammatory response, at least in part, via TLRs. The initial inflammation activates afferent signals that are relayed
to the nucleus tractus solitarius; subsequent activation of vagus efferent activity, mediated by central muscarinic
receptors in the brain, inhibits cytokine synthesis via pathways dependent on the α7 subunit of acetylcholine
receptors on macrophages and other cells through the cholinergic anti-inflammatory pathway (the inflammatory
reflex). The resulting innate response of immune cells can result in a balanced reaction leading to pathogen
elimination and tissue recovery, or an unbalanced reaction that on the one hand can lead to exaggerated
inflammation and tissue injury, and on the other hand to immune suppression caused by immune-cell apoptosis
and enhanced expression of negative regulators of TLR signalling.
34
of the organism as a human pathogen.21 The recent
epidemic of community-acquired meticillin-resistant
S aureus is an excellent example of the continuing
evolution of microbial pathogens. A recent clone (USA
clone 300) and related isolates have adapted to the
widespread use of beta-lactam antibiotics in the
community by acquisition of a new genomic island
(staphylococcal cassette chromosome type IV). This
genetic element contains the mecA gene, which mediates
the synthesis of low-affinity penicillin-binding proteins
(ie, PBP2a) responsible for meticillin resistance. This
bacterium has also acquired the genes for the expression
of a Panton-Valentine leukocidin toxin, along with many
other toxins and virulence factors. This clone is now
capable of invasive infections in normal hosts, along with
resistance to standard antimicrobial agents,22 and is
recognised as a cause of sepsis from necrotising
soft-tissue infections and a highly destructive form of
community-acquired pneumonia. Staying ahead of the
pathogens responsible for sepsis will remain a major
challenge for clinicians because pathogens are quite
capable of rapid adaptation to antibiotic selection
pressures and various other environmental changes
imposed on them with new developments in modern
health-care systems.23
Quorum sensing (the ability of bacteria to assess their
population density) is now recognised as a major virulence
property (figure 1). Originally described in the bioluminescent, marine bacterium Vibrio fischeri, homologues
of the quorum-sensing systems (QSSs) are now
widespread among common bacterial pathogens capable
of inducing severe sepsis in human beings.9,24–26 Quorum
sensing is crucially important in regulating population
density and growth rates within biofilms. Biofilm
formation is omnipresent in patients who have
bacteria-colonised mucosal surfaces or medical devices
(eg, vascular catheters, urinary catheters). These biofilms
exist as complex and well-regulated bacterial communities,
fixed to the underlying surfaces, and are relatively immune
to host clearance mechanisms, at least in part by their
interference with bacterial opsonisation.27 Regrettably,
biofilms provide a safe haven against antibiotics, because
sessile bacteria within biofilms are not susceptible to the
lytic effects of many classes of antimicrobial agents.
Recently, the QSS has been found to have a crucial role in
regulating tissue invasion by bacterial pathogens, and
inhibitors of quorum sensing provide new avenues for
intervention against invasive pathogens. The level of
sophistication in communication between these unicellular organisms is truly remarkable. Evidence now
exists that QSSs can even open up bidirectional lines of
communication between bacteria and the human host.28
Many Gram-negative bacteria use a QSS similar to
V fischeri. The QSS mediates the synthesis of an unusual
acyl-homoserine lactone (AHSL) moiety that functions as
http://infection.thelancet.com Vol 8 January 2008
Review
the indicator molecule. This molecule freely diffuses
across bacterial and human cell membranes. When
bacterial population densities are low, limited amounts
of AHSL are available and the genes under QSS control
are turned off. When population densities increase
beyond a threshold level, enough AHSL is generated to
bind to a cytoplasmic corepressor molecule known as
LuxR. This binary complex is a transcriptional activator
that binds to promoter sites of gene loci under QSS
regulatory control. Up to 15% of open reading frames of
bacterial pathogens are under QSS control. Many
phenotypic traits in several species of bacteria are under
QSS control, including biofilm formation, sporulation,
replication, virulence expression, genetic exchange, and
antibiotic synthesis and resistance expression.29
Gram-positive pathogens also possess a functionally
similar system of global regulation of genes based on cell
densities.9,25 Gram-positive pathogens rely on short
cyclical peptides known as autoinducer indicator
molecules. Cell surface receptors sense these peptides
and activate a kinase that generates transcriptional
activators for multiple gene loci. A third hybrid system
exists and is used by Gram-negative and Gram-positive
bacteria with complex, multiple-ringed, cyclical molecules
as cell-density indicator molecules. This system also
regulates global and coordinated transcriptional
responses.
Direct evidence for an essential role of quorum sensing
in microbial pathogenesis comes from site-specific
quorum-sensing gene deletion experiments. P aeruginosa
strains with excision of the quorum-sensing gene
complex lose virulence in animal models of invasive
infections (eg, burns, pneumonia, bacteraemia). Full
virulence is restored by inserting plasmids that carry the
genes for quorum sensing back into the pathogen.25,29
QSSs provide an opportunity for pathogens to minimise
early losses and maximise the chances for ultimate
success in causing widespread infection and sepsis.
Virulence genes under QSS control are turned off when
population densities are low. This limits the risk of early
detection and avoids the generation of antibodies against
these virulence factors in the early phases of colonisation
of the host when microbial numbers are low. Once the
population density expands to critical threshold levels,
QSSs activate replication programmes and the full
expression of virulence genes proceeds with tissue
invasion.
QSS-mediated virulence gene regulation is fine tuned
in some strains of S aureus in which the specific sets of
virulence gene transcriptional programmes are phased
in and phased out in preset patterns over the course of an
invasive infection. Once the QSS apparatus is activated,
sequential gene activation proceeds with initial
production of surface adherence molecules and tissue
invasion genes. This is later followed by activation of
replication systems, exotoxin synthesis, and the
expression of antiphagocytic capsular components.9
http://infection.thelancet.com Vol 8 January 2008
A
B
Candida spp
Beta-glucans
(dectin 1/TLR2)
Budding
yeast
O-linked
mannosides
(TLR4)
N-linked
mannosides
(mannose receptor)
Gram-negative
bacteria
Lipoproteins
(TLR2)
Gram-positive
bacteria
Bacterial DNA
(TLR9)
Lipoteichoic acid
(TLR2)
Lipopolysaccharide
(TLR4)
Peptidoglycan
(TLR2)
Flagellin (TLR5)
Figure 3: Innate recognition of pathogens by Toll-like (and related) receptors (TLRs)
(A) The complexity of the interaction between innate immune receptors and fungi. Three distinct components of
the cell wall of Candida albicans are recognised by four different host receptors: N-linked mannosyl residues are
detected by the mannose receptor, O-linked mannosyl residues are sensed by TLR4, and β-glucans are recognised
by the dectin 1–TLR2 complex.40 (B) Gram-positive and Gram-negative bacteria are recognised by partly
overlapping and partly distinct repertoire of TLRs. Gram-positive pathogens exclusively express lipoteichoic acid,
Gram-negative pathogens exclusively express lipopolysaccharide; common pathogen-associated molecular
patterns include peptidoglycan, lipoproteins, flagellin, and bacterial DNA.
QSSs provide further selective advantages for those
pathogens that possess these systems. The AHSL-sensing
molecules of Gram-negative bacteria inhibit the growth
and survival potential of some strains of S aureus,30 and
even the eukaryotic fungal pathogen Candida albicans.
This would be a clear survival advantage for the bacterial
strain possessing the QSS apparatus in tissue sites with
complex and competing microbial communities such as
mucosal surfaces. Eliminating microbial competition
allows QSS-bearing bacteria to occupy favoured niches
with the human host as a staging area for microbial
invasion.28,30
More complex pathways of communication exist,
including two-way signalling between human beings and
QSS expression among bacterial populations. That such
a system exists is shown by recent experiments that
identify QSS-dependent alterations of multiple genetic
programmes in patients.28 AHSL molecules bind to
intracellular signalling proteins that transcriptionally
regulate the human genes that mediate the host response
to bacterial invasion, such as chemokines and cytokines.
This ability of some bacterial pathogens to directly
regulate human immune-response genes is a clear
advantage for the microorganism in this host–pathogen
interaction.
Perhaps one of the most surprising findings is the
capacity of human stress molecules to be recognised by
the QSSs of enteric bacteria and P aeruginosa.31,32 A
specific receptor for human interferon γ exists on the
outer membrane (OmpF) of some pseudomonas strains
that activate a series of QSS-regulated virulence genes.
Excess concentrations of interferon γ signify a
compromised and possibly vulnerable host. Activation of
virulence genes and invasive phenotypes at times of host
stress tips the balance between septic host and pathogen
in favour of the infecting microorganism. Thus, quorum
35
Review
Species
TLR
PAMPs in bacteria
Lipopolysaccharide
Gram-negative bacteria
TLR4
Lipoteichoic acid
Gram-positive bacteria
TLR2*
Peptidoglycan
Most bacteria
TLR2
Triacyl lipopeptides
Most bacteria
TLR1 or TLR2
Diacyl lipopeptides
Mycoplasma spp
TLR2 or TLR6
Porins
Neisseria
TLR2
Flagellin
Flagellated bacteria
TLR5
CpG DNA
All bacteria
TLR9
Unknown
Uropathogenic bacteria
TLR11†
Zymosan
Saccharomyces cerevisiae
TLR2 or TLR6
Phospholipomannan
Candida albicans
TLR2
Mannan
Candida albicans
TLR4
Pathogen recognition systems
O-linked mannosyl residues
Candida albicans
TLR4
β-glucans
Candida albicans
TLR2‡
Heat shock proteins
Host
TLR4
Fibrinogen, fibronectin
Host
TLR4
Hyaluronan
Host
TLR4
The innate immune system is able to detect pathogens
via a limited number of pattern-recognition receptors
(PRRs).39 PRRs recognise conserved motifs that are
expressed by pathogens but are absent in higher
eukaryotes; these microbial components are known as
pathogen-associated molecular patterns (PAMPs;
figure 3). Additionally, PRRs may warn the host of danger
in general by their ability to recognise endogenous
mediators released during injurious processes, such as
trauma, ischaemia, or necrosis.41 Such endogenous
danger signals have been termed “alarmins” or
danger-associated molecular patterns (DAMPs).42
The Toll family of receptors have a central role as PRRs
in the initiation of cellular innate immune responses.39,43
These receptors were first discovered in the fruit fly, and
13 mammalian homologues of drosophila Toll-like
receptors (TLRs 1 to 13) have been identified to date. Of
these, human beings (but not mice) express TLR10,
whereas mice (but not human beings) express TLR11,
TLR12, and TLR13. All TLRs are single-spanning
transmembrane proteins with leucine-rich repeat
extracellular domains and with a cytoplasmic part largely
composed of the Toll interleukin-1 receptor resistance
(TIR) domain. TLRs can be expressed on the cell surface
(TLRs 1, 2, 4, 5, 6, and 10) or in intracellular compartments, in particular within the endosomes (TLRs 3, 7, 8,
and 9). The entire TLR family signals via four adaptor
proteins: myeloid differentiation primary-response
protein 88 (MyD88); TIR-domain-containing adaptor
protein (TIRAP); TIR-domain-containing adaptor-proteininducing interferon β (TRIF); and TRIF-related adaptor
molecule (TRAM). Working in concert with several
intracellular protein kinases, these TLRs recognise and
respond to a myriad of highly conserved microbial
molecules. Importantly, TLR signalling is tightly
regulated to avoid detrimental inflammatory responses;
as such, several negative regulators of TLRs have been
identified including MyD88 short, interleukin-1
receptor-associated kinase (IRAK) M, ST2, singleimmunoglobulin interleukin-1-receptor-related molecule
(SIGIRR), and Toll-interacting protein (TOLLIP).44 Given
PAMPs in fungi
DAMPs§
Biglycans
Host
TLR4
HMGB1
Host
TLR4, TLR2
Pathogen-associated molecular patterns (PAMPs) and danger-associated
molecular patterns (DAMPs) with likely relevance for sepsis (PAMPs expressed by
viruses and parasites are not shown). *For detection of lipoteichoic acid from
some pathogens, TLR6 functions as a co-receptor for TLR2. †Not functional in
human beings. ‡In collaboration with dectin 1. §Recent studies describe a role for
TLRs in acute injury by use of rodent models of haemorrhagic shock, ischaemia
and reperfusion, tissue trauma and wound repair, and various toxic exposures;
these studies have implicated TLR4 as a major factor in the initial injury
response.41 Endogenous mediators are identified as TLR4 ligands. HMGB1=highmobility group box 1 protein.
Table 1: Pathogen-associated and danger-associated molecular patterns
and their recognition by Toll-like receptors (TLRs)
sensing serves many functions for bacterial pathogens,
and provides a system to coordinate the expression of
virulence on the basis of cell densities in many common
and medically important bacteria. Understanding these
signalling pathways might provide new treatment options
to disarm potential pathogens and improve the outcome
in septic patients.33
The host: new mediators implicated in the
pathogenesis of sepsis
Historical perspective
The assumption that sepsis is the consequence of an
overwhelming inflammatory reaction of the patient to
microorganisms was widely accepted for many years.
This theory was based on studies in animals infused with
large doses of bacteria or bacterial products. Such
infusions result in a brisk systemic release of an array of
inflammatory mediators, many of which have been found
to be directly responsible for the death of the host,
including the prototypic proinflammatory cytokines
tumour necrosis factor (TNF) α and interleukin 1.34–37 We
36
now know that virtually all clinical sepsis trials with
anti-inflammatory therapies failed to alter the outcome of
patients with sepsis. A recurring theme in animal models
of sepsis and in large clinical trials is that the incremental
benefits (if any) of experimental agents accrue as the
severity of the septic process increases.38 Less severely ill
patients with sepsis either fail to benefit or may be
worsened by interventions with anti-inflammatory agents.
Clearly, the hypothesis that excessive inflammation is the
main underlying cause of an adverse outcome in a septic
patient requires reconsideration: the host response to
sepsis involves many subsequent and concurrent
processes that involve both exaggerated inflammation
and immune suppression (figure 2).
http://infection.thelancet.com Vol 8 January 2008
Review
their central role in the recognition of microbes, TLRs
are likely to have a crucial role in sepsis: TLRs are on the
one hand essential for the early detection of pathogens,
but on the other hand cause excessive inflammation after
uncontrolled stimulation. TLRs may further contribute
to the pathogenesis of sepsis by amplifying inflammatory
responses by interaction with DAMPs released after
tissue injury; in this respect TLR4 seems to be of
particular importance.41 Table 1 summarises PAMPs and
DAMPs with (likely) relevance for the pathogenesis of
sepsis and their interaction with TLRs.
TLRs detect pathogens at either the cell surface or in
lysosomes or endosomes. Pathogens that invade the
cytosol are recognised by various cytoplasmic PRRs.
Nucleotide-binding oligodimerisation domain (NOD)
proteins NOD1 and NOD2 contribute to the detection
of common fragments of peptidoglycan (ie,
diamino-pimelate for NOD1, and muramyl dipeptide for
NOD2) in the cytosol.39 Additionally, bacterial infection
leads to activation of caspase 1 in a protein complex
termed the NOD-like receptor (NLR) family
pyrin-domain-containing 3 (NLRP3) inflammasome.45,46
NLRP3 (also known as cryopyrin) regulates the activity of
caspase 1, an enzyme responsible for the secretion of
three interleukin-1 family members implicated in host
defence against infection: interleukin 1β, interleukin 18,
and interleukin 33. Caspase 1 and its proinflammatory
cytokine products are likely to contribute to the
pathogenesis of sepsis in overwhelming inflammation,
such as induced by bolus injection of high-dose
lipopolysaccharide,47–49 although it has a positive impact
on host defence against several infections.49,50 The
potential deleterious or advantageous role of caspase 1
resembles the bimodal roles of TLR2 and TLR4 as a part
of the early warning system against microbial invasion,
even though they also contribute to the initiation of
sepsis. A vigorous innate immune response is now
recognised as a double-edged sword, with a crucial role
in defending the host through activation of antimicrobial
defences, and yet, if left unchecked, the same system
contributes to systemic inflammation, intravascular
coagulation, tissue injury, and death caused by severe
sepsis.
Coagulation and anticoagulation
Patients with sepsis almost invariably show evidence of
activation of the coagulation system. Several clinical
studies have suggested that sepsis-related disseminated
intravascular coagulation is associated with not only high
mortality but also organ dysfunction, and that attenuation
of coagulation may ameliorate organ failure in this
condition.51–53
Tissue factor is regarded as the primary initiator of
coagulation in sepsis.54,55 Tissue factor is constitutively
expressed in the extravascular compartment to initiate
clotting if blood leaves the confines of the endothelial
surface. During severe sepsis, activated monocytes and
http://infection.thelancet.com Vol 8 January 2008
endothelial cells, along with circulating microvesicles,
become sources of tissue factor. Human beings
intravenously injected with lipopolysaccharide rapidly
increase tissue factor mRNA concentrations in circulating
blood cells and release tissue-factor-containing
microparticles.56,57 Inhibitors of the factor VIIa–tissue
factor pathway in experimental studies in human beings
and primates abrogate the activation of the common
pathway of coagulation.58–61
Blood clotting is controlled by three major anticoagulant
proteins: tissue-factor-pathway inhibitor (TFPI), antithrombin, and activated protein C (APC).54,55 TFPI is
an endothelial-cell-derived protease inhibitor that
blocks the activity of factor Xa when bound
to factor-VIIa–tissue-factor complex. Antithrombin
inhibits factor Xa, thrombin, and factor IXa, as
well as factor-VIIa–tissue-factor complex. The proteinC–protein-S system attenuates coagulation by the capacity
of APC to proteolytically inactivate factors Va and VIIIa.
Haemostasis is further controlled by the fibrinolytic
system, in which plasminogen activator inhibitor type 1
(PAI-1) functions as a major inhibitor. Notably, during
severe sepsis, the activities of TFPI, antithrombin, the
protein-C–APC system, and fibrinolysis are impaired,
resulting in a net procoagulant state.62 In septic primates,
the administration of either TFPI, antithrombin, or APC
attenuated consumptive coagulopathy,60,63,64 and large
clinical trials in patients with sepsis have been
completed.65–68 Only APC was found to reduce 28-day
mortality significantly in patients with severe sepsis;65
importantly, APC was not effective in those patients with
severe sepsis who had a low risk of death.68 Furthermore,
in a recent placebo-controlled trial in 477 children with
sepsis-induced cardiovascular and respiratory failure,
recombinant human APC did not influence the composite
time to complete organ failure resolution or 28-day
mortality.69 Of note, the European licensing authorities
have recently asked Eli Lilly to do another
placebo-controlled trial with APC in adult patients with
severe sepsis.
PAI-1 has been implicated in the pathogenesis of sepsis
because elevated circulating PAI-1 concentrations are
highly predictive for an unfavourable outcome in sepsis
patients.70 Additionally, a sequence variation in the gene
encoding PAI-1 influences the development of septic
shock in patients with meningococcal infection.71
Recently, studies using PAI-1-deficient mice and mice
with transiently enhanced expression of PAI-1 have
pointed to a protective rather than a harmful role of this
mediator in severe Gram-negative pneumonia and
sepsis.72 Further studies are warranted to confirm such a
role for PAI-1 in other models of sepsis.
Immune suppression and apoptosis
Patients who have survived the initial phase of sepsis
show features consistent with immunosuppression.73–75
The timing of the first occurrence of immunosuppression
37
Review
in sepsis is a matter of debate: some investigators favour
the subsequent initiation of an hyperinflammatory and
anti-inflammatory response, whereas others have
suggested that immunosuppression is a primary rather
than a compensatory response of sepsis.73–76 Many studies
have reported the reduced capacity of circulating
leucocytes obtained from sepsis patients to release
proinflammatory cytokines. Although the mechanisms
that underlie this phenomenon have not been fully
elucidated, anti-inflammatory cytokines, particularly
interleukin 10 and transforming growth factor β, are
probably involved. Additionally, negative regulators of
TLR signalling may play a part.
Deregulated apoptotic immune-cell death has been
implicated to play a major part in immune dysfunction
and mortality in sepsis.74,75,77 Apoptosis is a physiological
process by which cells are eliminated in a controlled
manner (programmed suicide) to limit damage of
surrounding
tissue.
Apoptotic
cells
produce
anti-inflammatory cytokines and elicit anergy, which
impairs the response to pathogens; necrotic cells cause
immune stimulation and enhance defence against
microbial pathogens.78,79 Most cells that undergo enhanced
apoptosis in sepsis are of lymphoid origin. Necropsies
done on patients within 30–90 min after death caused by
sepsis have disclosed a profound apoptosis-induced loss
of B cells, CD4 T cells, and follicular dendritic cells, along
with gastrointestinal epithelial cells.80,81 The pathogenetic
significance of these findings has been shown in animal
models of sepsis, in which prevention of apoptosis of
lymphocytes or the intestinal epithelium improved
survival.82–84 In a novel approach to inhibit apoptosis,
Target
Sponsor or institution
Phase
Comments
Lipid emulsion (GR-270773)
TLR4
GlaxoSmithKline
II
Completed, showed no differences between treatment groups with respect to 28-day
mortality
E5564 (Eritoran)
TLR4
Eisai
III
..
TAK-242
TLR4
Takeda
II
Study was stopped after a planned stopping point. No results are available. Takeda is planning
a new phase II or III study
Unfractionated heparin
Coagulation
Universidad de Antioquia,
Colombia
III
..
Recombinant antithrombin
Coagulation
LeoPharma
II
..
Recombinant activated protein C Coagulation
Eli Lilly
III/IV
Recombinant activated protein C (drotrecogin alfa activated) is an approved drug for sepsis,
but recently the European regulatory agency have requested another placebo-controlled trial
in high-risk patients with severe sepsis
Recombinant tissue-factor
pathway inhibitor
Coagulation
Novartis
III
Tissue factor pathway inhibitor is currently in clinical trial for severe community-acquired
pneumonia; most of these patients would meet sepsis criteria
Intensive insulin therapy
Hyperglycaemia
German Competence
Network Sepsis, Germany
III
This trial (VISEP trial) compared both two strategies of volume substitution (colloid vs
crystalloid) and intensive versus conventional insulin treatment. Intensive insulin therapy was
reported to reduce mortality in patients admitted to a primarily surgical ICU118 and in patients
admitted to a medical ICU who remained there for at least 3 days.119 Whereas these studies did
not focus on sepsis patients, this recent German study (unpublished) was stopped because of
no apparent benefit and a high incidence of hypoglycaemia
Corticosteroids
Adrenal
suppression
Hadassah Medical
Organization, Israel
III
Steroid therapy for severe sepsis has been the subject of debate for decades. The recent
CORTICUS trial (not yet published) with stress-dose glucocorticoids will not end the debate
Hydrocortisone vs
hydrocortisone+fludrocortisone
Adrenal
suppression
Charleston Area Medical
Centre Health System, WV,
USA
IV
..
Intensive insulin therapy and
hydrocortisone vs
hydrocortisone+fludrocortisone
Hyperglycaemia
and adrenal
suppression
University of Versailles,
France
III
..
Granulocyte–macrophage
colony-stimulating factor
Immunoparalysis
Charité University, Berlin,
Germany
II
..
Albumin
Shock
Laboratoire Français de
IV
Fractionnement et de
Biotechnologies, Paris, France
..
Rosuvastatin
Unknown
Universidad Autonoma de
San Luis Potosi, Mexico
II
Human data hint at reduced mortality rates in bacteraemic patients, and a reduced risk of
sepsis in patients with bacterial infections concurrently taking statins.120 These lines of
evidence resulted in phase II trials to assess the statins rosuvastatin, atorvastatin, and
simvastatin in patients with sepsis
Atorvastatin
Unknown
Hospital de Clinical de Porto
Alegre, Brazil
II
As above
Simvastatin
Unknown
Medical University of Vienna, IV
Austria
As above. This trial is not yet open for recruitment of patients
Data were obtained from http://www.clinicaltrials.gov (as of June 4, 2007). ICU=intensive care unit; TLR=Toll-like receptor.
Table 2: Novel anti-sepsis strategies currently investigated in clinical trials
38
http://infection.thelancet.com Vol 8 January 2008
Review
hydrodynamic administration of small-interfering RNA
against the death receptor Fas or caspase 8 decreased
apoptosis in tissues and improved the survival of mice
after caecal ligation and puncture.85
Apoptosis inhibitors have not been tested in patients
with sepsis. Potential problems include the selectivity of
such inhibitors and the risk of uncontrolled cell growth.
Moreover, apoptosis is an important mechanism for
eliminating activated neutrophils from inflamed tissues;
because continuing accumulation of neutrophils in
tissues may be linked to development of organ injury,
caution is warranted before the use of apoptosis inhibitors
in clinical sepsis. Other strategies to restore immune
function include the administration of immunestimulating cytokines. In a small uncontrolled study in
nine patients, daily subcutaneous injection of interferon γ
restored the TNFα production capacity of monocytes;
although the efficacy of interferon γ could not be
determined, eight patients recovered from sepsis shortly
after treatment.86
High-mobility group box 1 protein
High-mobility group box 1 protein (HMGB1) is a nuclear
protein present in almost all eukaryotic cells, where it
functions to stabilise nucleosome formation. HMGB1 is
released from necrotic cells, as well as from macrophages,
dendritic cells, and natural killer cells, on activation by
infectious agents.87 HMGB1 is a late-acting proinflammatory cytokine in the pathogenesis of sepsis, as
shown by serial measurements in experimental settings
in which HMGB1 is detected only after more than 8 h.88,89
An anti-HMGB1 antibody protected against lipopolysaccharide-induced death in mice even after the peak
concentrations of TNFα and interleukin 1 had been
reached.88 Anti-HMGB1 treatment increased survival in
mice with caecal ligation and puncture when given 24 h
after the surgical procedure.89 Increased HMGB1
concentrations are readily detected in patients with
sepsis.88,90 Of note, HMGB1 acts downstream of cell
apoptosis during severe sepsis.91 Indeed, during sepsis
induced by caecal ligation and puncture, macrophages
released HMGB1 on exposure to apoptotic cells, and a
monoclonal anti-HMGB1 antibody conferred protection
without influencing the accumulation of apoptotic cells
in the spleen.91 Considering that the therapeutic window
for anti-HMGB1 therapies should be much wider than
for TNF-neutralising strategies, inhibitors of HMGB1
may be valuable adjunct for established severe sepsis.
Whether highly purified HMGB1 can directly activate
cells is not certain.92 HMGB1 may function as a carrier
protein that brings other mediators to target cells. Several
receptors have been identified as possible receptors for
the cellular effects of HMGB1, including TLR2 and TLR4,
and the receptor for advanced glycation end-products
(RAGE).87 RAGE is a ubiquitous receptor that recognises
diverse endogenous ligands, such as advanced glycation
end-products, S100/calgranulins, amyloid A, leucocyte
http://infection.thelancet.com Vol 8 January 2008
adhesion receptors, E coli curli operons, and HMGB1.
RAGE ligation can activate nuclear factor κB and
mitogen-activated protein kinase pathways.93 The
potential role of RAGE signalling in sepsis pathophysiology has been reported in mice exposed to caecal
ligation and puncture: RAGE-deficient mice and wild-type
mice treated with soluble RAGE were partly protected
against death from severe sepsis.94 Further research is
warranted to address the therapeutic potential of RAGE
(ligand) inhibitors in sepsis.
Cholinergic anti-inflammatory pathway
The cholinergic nervous system, and in particular the
vagus nerve, plays an important part in limiting
inflammatory responses.95,96 In the cholinergic
anti-inflammatory pathway, enhanced efferent activity
of parasympathetic nerve endings results in the release
of acetylcholine, which suppresses proinflammatory
cytokine production by a specific action on α7 cholinergic
receptors on macrophages.97 Disruption of this
neural-based system by vagotomy renders animals more
vulnerable to the toxic effects of lipopolysaccharide: in
rats, surgical dissection of the vagus nerve led to
exaggerated release of TNFα and accelerated hypotensive
shock after intravenous injection of lipopolysaccharide;98
vagotomy also enhanced the local and systemic
inflammation accompanying bacterial peritonitis.99
Conversely, electrical stimulation of the efferent vagus
nerve prevented the development of shock and
attenuated the release of TNFα and the activation of the
coagulation system in endotoxaemic rats,98,100 whereas
stimulation of α7 cholinergic receptors by specific
agonists, such as nicotine, attenuated systemic
inflammation and improved the outcome of mice with
polymicrobial abdominal sepsis.101 Recent evidence
indicates that, within the brain, central muscarinic
receptors play a part in activating the cholinergic
anti-inflammatory pathway,102 and that the spleen is an
essential peripheral part of the cholinergic
anti-inflammatory reflex.103 Together, these preclinical
data suggest that stimulation of the vagus nerve or
pharmacological α7 cholinergic receptor agonists, or
both, may be useful strategies in the treatment of the
severe inflammation that accompanies sepsis.
Search strategy and selection criteria
Data for this Review were identified by searches of PubMed
and references from relevant articles. Articles were also
identified through searches of the extensive files of the
authors. Search terms used were “bacterial virulence”,
“quorum sensing”, “pathogenicity islands”, “pathogenesis of
sepsis”, “bacterial toxins”, “endotoxin”, “superantigens”,
“Toll-like receptors”, “sepsis AND coagulation”, “sepsis AND
apoptosis”, and “sepsis AND complement”. Only English
language articles were reviewed. No date restrictions were set
in these searches.
39
Review
Macrophage migration inhibitory factor
Conclusions
Macrophage migratory inhibitory factor (MIF) is a
cytokine produced by many different cell types.
Glucocorticoids act as inducers of MIF production by
macrophages,104 and serum MIF concentrations are
increased in patients with sepsis.105 Evidence in support
of MIF as a contributor to the pathogenesis of sepsis
includes the following: (1) inhibition or elimination of
MIF protected mice from death from lipopolysaccharide
or abdominal sepsis;105,106 (2) administration of MIF
increased risk of death after lipopolysaccharide
challenge;105,106 and (3) genetic deletion of MIF in mice
resulted in a decrease in the production of
proinflammatory mediators, including TNFα and
interleukin 1β.106 MIF might participate in the resolution
of inflammation by its unique ability to regulate
activation-induced apoptosis.107 In the presence of high
concentrations of MIF, the timely removal of activated
monocytes/macrophages by apoptosis is suppressed,
allowing enhanced monocyte/macrophage survival,
increased cytokine production, and a sustained
proinflammatory response. MIF enhances macrophage
expression of TLR4, thereby further influencing innate
immunity.108 These data suggest that MIF could be an
interesting target for therapeutic intervention in patients
with sepsis. Of note, a recent study suggested that highly
purified recombinant MIF does not exert conventional
cytokine-like activity, but rather acts to modulate and
amplify responses to lipopolysaccharide.109
Sepsis remains a major challenge for clinicians. Microbial
pathogens have proven to be more ingenious in avoiding
and altering host defences than we originally anticipated.
The capacity to subvert host defences, communicate with
each other, and cooperate during the invasive phase of
infection reveals a level of sophistication in microbial
pathogenesis that is only beginning to be fully appreciated.
Recent insights into the early interactions between
pathogens and the host may pave the way for novel
therapeutic interventions. Several interventions based on
these new insights are currently being assessed in clinical
trials in patients with sepsis, including inhibitors of TLR4
signalling and the immune stimulant granulocyte–
macrophage colony stimulating factor (table 2). We
anticipate that more novel anti-sepsis strategies will be
clinically assessed in the near future.
C5a and C5a receptor
The complement system is composed of more than
30 plasma proteins and receptors, and acts as an
enzymatic cascade through various protein–protein
interactions. Three pathways of complement activation
have been recognised: classic, alternative, and
lectin-binding pathways.110 Clinical and experimental
sepsis is associated with increased plasma concentrations
of complement constituents C3a, C4a, and C5a. The
importance of C5a for the outcome of sepsis has been
underscored by several experimental investigations.
Infusion of anti-C5a antibodies improved haemodynamic
variables in pigs infused with lipopolysaccharide or live
E coli,111 reduced mortality in primates with E coli sepsis,112
and improved survival in rats subjected to caecal ligation
and puncture.113 Additionally, the receptor for C5a is
upregulated in many organs from septic animals, and
anti-C5a treatment attenuated the coagulopathy of sepsis
and improved organ function.114,115 C5a may further harm
the septic host by inhibiting neutrophil apoptosis and
concurrently enhancing apoptosis of thymocytes.116,117
Interventions that block C5a signalling represent
promising targets for sepsis treatment. The principal
therapeutic goal of complement inhibition in patients
with severe infection would be to retain complement’s
role in host defences, while preventing the pathological
activities of complement activation products.
40
Conflicts of interest
TvdP is a member of the Sepsis Steering Committee of the phase III
sepsis trial with E5564 (TLR4 antagonist; Eisai) and has received research
support for preclinical research on activated protein C from Eli Lilly.
SMO has received research support from Genetics Institute-Wyeth, is the
principal investigator for the phase III sepsis trial with E5564 (TLR4
antagonist, Eisai), and a member of the Ocean State Clinical
Coordinating Centre, which receives grant money to oversee the Novartis
Tifacogin CAP study. Both authors are members of the Steering
Committee of the International Sepsis Forum (ISF; http://www.
sepsisforum.org), a non-profit organisation of academic physicians and
industry sponsors whose principal goal is to facilitate a greater awareness
of sepsis as an important clinical problem and to promote the research
and development of new agents for the treatment of sepsis. The ISF
receives unrestricted educational grants to achieve these goals from
BRAHMS, BioMerieux, Biosite Inc, Exponential Biotherapies Inc, Eisai
Inc, Eli Lilly, GlaxoSmithKline, Novo Nordisk, Roche Diagnostic GmbH,
Spectral Diagnostics Inc, Takeda Pharmaceuticals North America, and
Toray Medical Co.
Acknowledgments
This Review was inspired by a 2-day meeting on the host–pathogen
response in sepsis (9th Annual Colloquium of the ISF; June 17–18, 2006, in
Toledo, Spain), organised by the authors on behalf of ISF. We therefore
thank the participants of this round-table meeting: Edward Abraham
(University of Alabama at Birmingham School of Medicine, Birmingham,
AL, USA), Derek Angus (University of Pittsburgh, Pittsburgh, PA, USA),
Thierry Calandra (Centre Hospitalier Universitaire Vaudois, Lausanne,
Switzerland), Jean-Francois Dhainaut (Cochin Hospital, Paris, France),
John Marshall (University of Toronto, Toronto, Canada), Konrad Reinhart
(Clinic for Anesthesiology and Intensive Care, Jena, Germany),
Jean-Louis Vincent (Erasme University Hospital, Brussels, Belgium),
Eugen Faist (Klinikum Grosshadern, Munich, Germany), Thomas Hartung
(University of Konstanz, Konstanz, Germany), Michael Levin (Imperial
College, London, UK), Douglas Golenbock (University of Massachusetts
Medical School, Worcester, MA, USA), Richard Hotchkiss (Washington
University School of Medicine, St Louis, MI, USA), Marcel Levi (Academic
Medical Center, Amsterdam, Netherlands), Mihai Netea (Radboud
Hospital, Nijmegen, Netherlands), Jordan Orange (Children’s Hospital of
Philadelphia, Philadelphia, PA, USA), Ernst Rietschel (Research Center
Borstel, Borstel, Germany), Shiranee Sriskandan (Imperial College,
London, UK), Catharina Svanborg (Lund University, Lund, Sweden), and
Hans-Dieter Volk (Charité-University Medicine Berlin, Berlin, Germany).
References
1
Wheeler AP, Bernard GR. Treating patients with severe sepsis.
N Engl J Med 1999; 340: 207–14.
2
Angus DC, Linde-Zwirble WT, Lidicker J, Clermont G, Carcillo J,
Pinsky MR. Epidemiology of severe sepsis in the United States:
analysis of incidence, outcome, and associated costs of care.
Crit Care Med 2001; 29: 1303–10.
http://infection.thelancet.com Vol 8 January 2008
Review
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
21
22
23
24
25
26
27
28
Martin GS, Mannino DM, Eaton S, Moss M. The epidemiology of
sepsis in the United States from 1979 through 2000. N Engl J Med
2003; 348: 1546–54.
Opal SM, Garber GE, LaRosa SP, et al. Systemic host responses in
severe sepsis analyzed by causative microorganism and treatment
effects of drotrecogin alfa (activated). Clin Infect Dis 2003; 37: 50–58.
Jenner RG, Young RA. Insights into host responses against
pathogens from transcriptional profiling. Nat Rev Microbiol 2005;
3: 281–94.
Merrell DS, Falkow S. Frontal and stealth attack strategies in
microbial pathogenesis. Nature 2004; 430: 250–56.
Bergsten G, Samuelsson M, Wullt B, Leijonhufvud I, Fischer H,
Svanborg C. PapG-dependent adherence breaks mucosal inertia
and triggers the innate host response. J Infect Dis 2004;
189: 1734–42.
Moine P, Abraham E. Immunomodulation and sepsis: impact of
the pathogen. Shock 2004; 22: 297–308.
Novick RP. Autoinduction and signal transduction in the regulation
of staphylococcal virulence. Mol Microbiol 2003; 48: 1429–49.
Proft T, Sriskandan S, Yang L, Fraser JD. Superantigens and
streptococcal toxic shock syndrome. Emerg Infect Dis 2003; 9: 1211–18.
Galan JE, Collmer A. Type III secretion machines: bacterial devices
for protein delivery into host cells. Science 1999; 284: 1322–28.
Opal SM, Gluck T. Endotoxin as a drug target. Crit Care Med 2003;
31 (suppl 1): S57–64.
Beutler B, Rietschel ET. Innate immune sensing and its roots: the
story of endotoxin. Nat Rev Immunol 2003; 3: 169–76.
Sriskandan S, Ferguson M, Elliot V, Faulkner L, Cohen J. Human
intravenous immunoglobulin for experimental streptococcal toxic
shock: bacterial clearance and modulation of inflammation.
J Antimicrob Chemother 2006; 58: 117–24.
Hacker J, Kaper JB. Pathogenicity islands and the evolution of
microbes. Annu Rev Microbiol 2000; 54: 641–79.
Marcus SL, Brumell JH, Pfeifer CG, Finlay BB. Salmonella
pathogenicity islands: big virulence in small packages.
Microbes Infect 2000; 2: 145–56.
Schmidt H, Hensel M. Pathogenicity islands in bacterial
pathogenesis. Clin Microbiol Rev 2004; 17: 14–56.
Bingen-Bidois M, Clermont O, Bonacorsi S, et al. Phylogenetic
analysis and prevalence of urosepsis strains of Escherichia coli
bearing pathogenicity island-like domains. Infect Immun 2002;
70: 3216–26.
Warny M, Pepin J, Fang A, et al. Toxin production by an emerging
strain of Clostridium difficile associated with outbreaks of severe
disease in North America and Europe. Lancet 2005; 366: 1079–84.
McDonald LC, Owings M, Jernigan DB. Clostridium difficile
infection in patients discharged from US short-stay hospitals,
1996–2003. Emerg Infect Dis 2006; 12: 409–15.
MacDonald D, Demarre G, Bouvier M, Mazel D, Gopaul DN.
Structural basis for broad DNA-specificity in integron
recombination. Nature 2006; 440: 1157–62.
Moran GJ, Krishnadasan A, Gorwitz RJ, et al. Methicillin-resistant
S aureus infections among patients in the emergency department.
N Engl J Med 2006; 355: 666–74.
Llewelyn MJ, Cohen J. Tracking the microbes in sepsis:
advancements in treatment bring challenges for microbial
epidemiology. Clin Infect Dis 2007; 44: 1343–48.
Pearson JP, Feldman M, Iglewski BH, Prince A. Pseudomonas
aeruginosa cell-to-cell signaling is required for virulence in a model
of acute pulmonary infection. Infect Immun 2000; 68: 4331–34.
Bassler BL. Small talk. Cell-to-cell communication in bacteria.
Cell 2002; 109: 421–24.
Parsek MR, Greenberg EP. Acyl-homoserine lactone quorum
sensing in Gram-negative bacteria: a signaling mechanism involved
in associations with higher organisms. Proc Natl Acad Sci USA
2000; 97: 8789–93.
Cerca N, Jefferson KK, Oliveira R, Pier GB, Azeredo J. Comparative
antibody-mediated phagocytosis of Staphylococcus epidermidis cells
grown in a biofilm or in the planktonic state. Infect Immun 2006;
74: 4849–55.
Shiner EK, Rumbaugh KP, Williams SC. Inter-kingdom signaling:
deciphering the language of acyl homoserine lactones.
FEMS Microbiol Rev 2005; 29: 935–47.
http://infection.thelancet.com Vol 8 January 2008
29
30
31
32
33
34
35
36
37
38
39
40
41
42
43
44
45
46
47
48
49
50
51
52
53
54
Miller MB, Bassler BL. Quorum sensing in bacteria.
Annu Rev Microbiol 2001; 55: 165–99.
Qazi S, Middleton B, Muharram SH, et al. N-acylhomoserine
lactones antagonize virulence gene expression and quorum sensing
in Staphylococcus aureus. Infect Immun 2006; 74: 910–19.
Alverdy J, Zaborina O, Wu L. The impact of stress and nutrition on
bacterial-host interactions at the intestinal epithelial surface.
Curr Opin Clin Nutr Metab Care 2005; 8: 205–09.
Wu L, Estrada O, Zaborina O, et al. Recognition of host immune
activation by Pseudomonas aeruginosa. Science 2005; 309: 774–77.
Sekirov I, Finlay BB. Human and microbe: united we stand.
Nat Med 2006; 12: 736–37.
Beutler B, Milsark IW, Cerami AC. Passive immunization against
cachectin/tumor necrosis factor protects mice from lethal effect of
endotoxin. Science 1985; 229: 869–71.
Tracey KJ, Fong Y, Hesse DG, et al. Anti-cachectin/TNF monoclonal
antibodies prevent septic shock during lethal bacteraemia. Nature
1987; 330: 662–64.
Ohlsson K, Bjork P, Bergenfeldt M, Hageman R, Thompson RC.
Interleukin-1 receptor antagonist reduces mortality from endotoxin
shock. Nature 1990; 348: 550–52.
Fischer E, Marano MA, Van Zee KJ, et al. Interleukin-1 receptor
blockade improves survival and hemodynamic performance in
Escherichia coli septic shock, but fails to alter host responses to
sublethal endotoxemia. J Clin Invest 1992; 89: 1551–57.
Eichacker PQ, Parent C, Kalil A, et al. Risk and the efficacy of
antiinflammatory agents: retrospective and confirmatory studies of
sepsis. Am J Respir Crit Care Med 2002; 166: 1197–205.
Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate
immunity. Cell 2006; 124: 783–801.
Netea MG, Gow NA, Munro CA, et al. Immune sensing of Candida
albicans requires cooperative recognition of mannans and glucans
by lectin and Toll-like receptors. J Clin Invest 2006; 116: 1642–50.
Mollen KP, Anand RJ, Tsung A, Prince JM, Levy RM, Billiar TR.
Emerging paradigm: Toll-like receptor 4-sentinel for the detection of
tissue damage. Shock 2006; 26: 430–37.
Bianchi ME. DAMPs, PAMPs and alarmins: all we need to know
about danger. J Leukoc Biol 2007; 81: 1–5.
Beutler B, Jiang Z, Georgel P, et al. Genetic analysis of host
resistance: Toll-like receptor signaling and immunity at large.
Annu Rev Immunol 2006; 24: 353–89.
Liew FY, Xu D, Brint EK, O’Neill LA. Negative regulation of Toll-like
receptor-mediated immune responses. Nat Rev Immunol 2005;
5: 446–58.
Ogura Y, Sutterwala FS, Flavell RA. The inflammasome: first line of
the immune response to cell stress. Cell 2006; 126: 659–62.
Drenth JP, van der Meer JW. The inflammasome—a linebacker of
innate defense. N Engl J Med 2006; 355: 730–32.
Kuida K, Lippke JA, Ku G, et al. Altered cytokine export and
apoptosis in mice deficient in interleukin-1 beta converting enzyme.
Science 1995; 267: 2000–03.
Li P, Allen H, Banerjee S, et al. Mice deficient in IL-1
beta-converting enzyme are defective in production of mature IL-1
beta and resistant to endotoxic shock. Cell 1995; 80: 401–11.
Joshi VD, Kalvakolanu DV, Hebel JR, Hasday JD, Cross AS. Role of
caspase 1 in murine antibacterial host defenses and lethal
endotoxemia. Infect Immun 2002; 70: 6896–903.
Lara-Tejero M, Sutterwala FS, Ogura Y, et al. Role of the caspase-1
inflammasome in Salmonella typhimurium pathogenesis.
J Exp Med 2006; 203: 1407–12.
Dhainaut JF, Yan SB, Joyce DE, et al. Treatment effects of
drotrecogin alfa (activated) in patients with severe sepsis with or
without overt disseminated intravascular coagulation.
J Thromb Haemost 2004; 2: 1924–33.
Kienast J, Juers M, Wiedermann CJ, et al. Treatment effects of
high-dose antithrombin without concomitant heparin in patients
with severe sepsis with or without disseminated intravascular
coagulation. J Thromb Haemost 2006; 4: 90–97.
Dhainaut JF, Shorr AF, Macias WL, et al. Dynamic evolution of
coagulopathy in the first day of severe sepsis: relationship with
mortality and organ failure. Crit Care Med 2005; 33: 341–48.
Levi M, van der Poll T. Two-way interactions between inflammation
and coagulation. Trends Cardiovasc Med 2005; 15: 254–59.
41
Review
55
56
57
58
59
60
61
62
63
64
65
66
67
68
69
70
71
72
73
74
75
76
77
78
42
Esmon CT. The interactions between inflammation and
coagulation. Br J Haematol 2005; 131: 417–30.
Franco RF, de Jonge E, Dekkers PE, et al. The in vivo kinetics of
tissue factor messenger RNA expression during human
endotoxemia: relationship with activation of coagulation.
Blood 2000; 96: 554–59.
Aras O, Shet A, Bach RR, et al. Induction of microparticle- and
cell-associated intravascular tissue factor in human endotoxemia.
Blood 2004; 103: 4545–53.
de Jonge E, Dekkers PE, Creasey AA, et al. Tissue factor pathway
inhibitor dose-dependently inhibits coagulation activation without
influencing the fibrinolytic and cytokine response during human
endotoxemia. Blood 2000; 95: 1124–29.
Taylor FB Jr, Chang A, Ruf W, et al. Lethal E coli septic shock is
prevented by blocking tissue factor with monoclonal antibody.
Circ Shock 1991; 33: 127–34.
Creasey AA, Chang AC, Feigen L, Wun TC, Taylor FB Jr,
Hinshaw LB. Tissue factor pathway inhibitor reduces mortality
from Escherichia coli septic shock. J Clin Invest 1993; 91: 2850–56.
Levi M, ten Cate H, Bauer KA, et al. Inhibition of
endotoxin-induced activation of coagulation and fibrinolysis by
pentoxifylline or by a monoclonal anti-tissue factor antibody in
chimpanzees. J Clin Invest 1994; 93: 114–20.
Levi M, Ten Cate H. Disseminated intravascular coagulation.
N Engl J Med 1999; 341: 586–92.
Taylor FB Jr, Emerson TE Jr, Jordan R, Chang AK, Blick KE.
Antithrombin-III prevents the lethal effects of Escherichia coli
infusion in baboons. Circ Shock 1988; 26: 227–35.
Taylor FB Jr, Chang A, Esmon CT, D’Angelo A, Vigano-D’Angelo S,
Blick KE. Protein C prevents the coagulopathic and lethal effects of
Escherichia coli infusion in the baboon. J Clin Invest 1987; 79: 918–25.
Bernard GR, Vincent JL, Laterre PF, et al. Efficacy and safety of
recombinant human activated protein C for severe sepsis.
N Engl J Med 2001; 344: 699–709.
Warren BL, Eid A, Singer P, et al. Caring for the critically ill patient.
High-dose antithrombin III in severe sepsis: a randomized
controlled trial. JAMA 2001; 286: 1869–78.
Abraham E, Reinhart K, Opal S, et al. Efficacy and safety of tifacogin
(recombinant tissue factor pathway inhibitor) in severe sepsis: a
randomized controlled trial. JAMA 2003; 290: 238–47.
Abraham E, Laterre PF, Garg R, et al. Drotrecogin alfa (activated)
for adults with severe sepsis and a low risk of death. N Engl J Med
2005; 353: 1332–41.
Nadel S, Goldstein B, Williams MD, et al. Drotrecogin alfa
(activated) in children with severe sepsis: a multicentre phase III
randomised controlled trial. Lancet 2007; 369: 836–43.
Raaphorst J, Johan Groeneveld AB, Bossink AW, Erik Hack C. Early
inhibition of activated fibrinolysis predicts microbial infection,
shock and mortality in febrile medical patients. Thromb Haemost
2001; 86: 543–49.
Hermans PW, Hazelzet JA. Plasminogen activator inhibitor type 1
gene polymorphism and sepsis. Clin Infect Dis 2005; 41 (suppl 7):
S453–58.
Renckens R, Roelofs JJ, Bonta PI, et al. Plasminogen activator
inhibitor type 1 is protective during severe Gram-negative
pneumonia. Blood 2007; 109: 1593–601.
Volk HD, Reinke P, Docke WD. Clinical aspects: from systemic
inflammation to ‘immunoparalysis’. Chem Immunol 2000;
74: 162–77.
Hotchkiss RS, Karl IE. The pathophysiology and treatment of
sepsis. N Engl J Med 2003; 348: 138–50.
Hotchkiss RS, Nicholson DW. Apoptosis and caspases regulate
death and inflammation in sepsis. Nat Rev Immunol 2006;
6: 813–22.
Munford RS, Pugin J. Normal responses to injury prevent systemic
inflammation and can be immunosuppressive.
Am J Respir Crit Care Med 2001; 163: 316–21.
Wesche DE, Lomas-Neira JL, Perl M, Chung CS, Ayala A. Leukocyte
apoptosis and its significance in sepsis and shock. J Leukoc Biol
2005; 78: 325–37.
Voll RE, Herrmann M, Roth EA, Stach C, Kalden JR, Girkontaite I.
Immunosuppressive effects of apoptotic cells. Nature 1997;
390: 350–51.
79
80
81
82
83
84
85
86
87
88
89
90
91
92
93
94
95
96
97
98
99
100
101
102
103
Green DR, Beere HM. Apoptosis. Gone but not forgotten. Nature
2000; 405: 28–29.
Hotchkiss RS, Tinsley KW, Swanson PE, et al. Sepsis-induced
apoptosis causes progressive profound depletion of B and
CD4+ T lymphocytes in humans. J Immunol 2001; 166: 6952–63.
Hotchkiss RS, Tinsley KW, Swanson PE, et al. Depletion of
dendritic cells, but not macrophages, in patients with sepsis.
J Immunol 2002; 168: 2493–500.
Hotchkiss RS, Chang KC, Swanson PE, et al. Caspase inhibitors
improve survival in sepsis: a critical role of the lymphocyte.
Nat Immunol 2000; 1: 496–501.
Oberholzer C, Oberholzer A, Bahjat FR, et al. Targeted
adenovirus-induced expression of IL-10 decreases thymic apoptosis
and improves survival in murine sepsis. Proc Natl Acad Sci USA
2001; 98: 11503–08.
Coopersmith CM, Stromberg PE, Dunne WM, et al. Inhibition of
intestinal epithelial apoptosis and survival in a murine model of
pneumonia-induced sepsis. JAMA 2002; 287: 1716–21.
Wesche-Soldato DE, Chung CS, Lomas-Neira J, Doughty LA,
Gregory SH, Ayala A. In vivo delivery of caspase-8 or Fas siRNA
improves the survival of septic mice. Blood 2005; 106: 2295–301.
Docke WD, Randow F, Syrbe U, et al. Monocyte deactivation in
septic patients: restoration by IFN-gamma treatment. Nat Med 1997;
3: 678–81.
Lotze MT, Tracey KJ. High-mobility group box 1 protein (HMGB1):
nuclear weapon in the immune arsenal. Nat Rev Immunol 2005;
5: 331–42.
Wang H, Bloom O, Zhang M, et al. HMG-1 as a late mediator of
endotoxin lethality in mice. Science 1999; 285: 248–51.
Yang H, Ochani M, Li J, et al. Reversing established sepsis with
antagonists of endogenous high-mobility group box 1.
Proc Natl Acad Sci USA 2004; 101: 296–301.
Sunden-Cullberg J, Norrby-Teglund A, Rouhiainen A, et al.
Persistent elevation of high mobility group box-1 protein (HMGB1)
in patients with severe sepsis and septic shock. Crit Care Med 2005;
33: 564–73.
Qin S, Wang H, Yuan R, et al. Role of HMGB1 in
apoptosis-mediated sepsis lethality. J Exp Med 2006; 203: 1637–42.
Rouhiainen A, Tumova S, Valmu L, Kalkkinen N, Rauvala H. Pivotal
advance: analysis of proinflammatory activity of highly purified
eukaryotic recombinant HMGB1 (amphoterin). J Leukoc Biol 2007;
81: 49–58.
Chavakis T, Bierhaus A, Nawroth PP. RAGE (receptor for advanced
glycation end products): a central player in the inflammatory
response. Microbes Infect 2004; 6: 1219–25.
Liliensiek B, Weigand MA, Bierhaus A, et al. Receptor for advanced
glycation end products (RAGE) regulates sepsis but not the adaptive
immune response. J Clin Invest 2004; 113: 1641–50.
Tracey KJ. The inflammatory reflex. Nature 2002; 420: 853–59.
Tracey KJ. Physiology and immunology of the cholinergic
antiinflammatory pathway. J Clin Invest 2007; 117: 289–96.
Wang H, Yu M, Ochani M, et al. Nicotinic acetylcholine receptor
alpha7 subunit is an essential regulator of inflammation. Nature
2003; 421: 384–88.
Borovikova LV, Ivanova S, Zhang M, et al. Vagus nerve stimulation
attenuates the systemic inflammatory response to endotoxin.
Nature 2000; 405: 458–62.
van Westerloo DJ, Giebelen IA, Florquin S, et al. The cholinergic
anti-inflammatory pathway regulates the host response during
septic peritonitis. J Infect Dis 2005; 191: 2138–48.
van Westerloo DJ, Giebelen IA, Meijers JC, et al. Vagus nerve
stimulation inhibits activation of coagulation and fibrinolysis
during endotoxemia in rats. J Thromb Haemost 2006; 4: 1997–2002.
Wang H, Liao H, Ochani M, et al. Cholinergic agonists inhibit
HMGB1 release and improve survival in experimental sepsis.
Nat Med 2004; 10: 1216–21.
Pavlov VA, Ochani M, Gallowitsch-Puerta M, et al. Central
muscarinic cholinergic regulation of the systemic inflammatory
response during endotoxemia. Proc Natl Acad Sci USA 2006;
103: 5219–23.
Huston JM, Ochani M, Rosas-Ballina M, et al. Splenectomy
inactivates the cholinergic antiinflammatory pathway during lethal
endotoxemia and polymicrobial sepsis. J Exp Med 2006; 203: 1623–28.
http://infection.thelancet.com Vol 8 January 2008
Review
104 Calandra T, Bernhagen J, Metz CN, et al. MIF as a
glucocorticoid-induced modulator of cytokine production. Nature
1995; 377: 68–71.
105 Calandra T, Echtenacher B, Roy DL, et al. Protection from septic
shock by neutralization of macrophage migration inhibitory factor.
Nat Med 2000; 6: 164–70.
106 Bozza M, Satoskar AR, Lin G, et al. Targeted disruption of
migration inhibitory factor gene reveals its critical role in sepsis.
J Exp Med 1999; 189: 341–46.
107 Mitchell RA, Liao H, Chesney J, et al. Macrophage migration
inhibitory factor (MIF) sustains macrophage proinflammatory
function by inhibiting p53: regulatory role in the innate immune
response. Proc Natl Acad Sci USA 2002; 99: 345–50.
108 Roger T, David J, Glauser MP, Calandra T. MIF regulates innate
immune responses through modulation of Toll-like receptor 4.
Nature 2001; 414: 920–24.
109 Kudrin A, Scott M, Martin S, et al. Human macrophage migration
inhibitory factor: a proven immunomodulatory cytokine?
J Biol Chem 2006; 281: 29641–51.
110 Guo RF, Ward PA. Role of C5a in inflammatory responses.
Annu Rev Immunol 2005; 23: 821–52.
111 Mohr M, Hopken U, Oppermann M, et al. Effects of anti-C5a
monoclonal antibodies on oxygen use in a porcine model of severe
sepsis. Eur J Clin Invest 1998; 28: 227–34.
http://infection.thelancet.com Vol 8 January 2008
112 Stevens JH, O’Hanley P, Shapiro JM, et al. Effects of anti-C5a
antibodies on the adult respiratory distress syndrome in septic
primates. J Clin Invest 1986; 77: 1812–16.
113 Czermak BJ, Sarma V, Pierson CL, et al. Protective effects of C5a
blockade in sepsis. Nat Med 1999; 5: 788–92.
114 Riedemann NC, Guo RF, Neff TA, et al. Increased C5a receptor
expression in sepsis. J Clin Invest 2002; 110: 101–08.
115 Laudes IJ, Chu JC, Sikranth S, et al. Anti-c5a ameliorates
coagulation/fibrinolytic protein changes in a rat model of sepsis.
Am J Pathol 2002; 160: 1867–75.
116 Simon HU. Neutrophil apoptosis pathways and their modifications
in inflammation. Immunol Rev 2003; 193: 101–10.
117 Guo RF, Huber-Lang M, Wang X, et al. Protective effects of anti-C5a
in sepsis-induced thymocyte apoptosis. J Clin Invest 2000;
106: 1271–80.
118 van den Berghe G, Wouters P, Weekers F, et al. Intensive insulin
therapy in the critically ill patients. N Engl J Med 2001; 345: 1359–67.
119 Van den Berghe G, Wilmer A, Hermans G, et al. Intensive insulin
therapy in the medical ICU. N Engl J Med 2006; 354: 449–61.
120 Terblanche M, Almog Y, Rosenson RS, Smith TS, Hackam DG.
Statins: panacea for sepsis? Lancet Infect Dis 2006; 6: 242–48.
43
The
n e w e ng l a n d j o u r na l
of
m e dic i n e
edi t or i a l s
Corticosteroids in Septic Shock
Simon Finfer, F.R.C.P., F.J.F.I.C.M.
As the balance of evidence regarding corticosteroid treatment for septic shock shifts once again
toward the negative, the study by Sprung et al.1
in this issue of the Journal elicits a strong feeling
of déjà vu. Will the historical fate of high-dose
corticosteroids, which were largely abandoned
when the benefit observed in early studies could
not be replicated in larger trials,2,3 now befall
“physiologic-dose” corticosteroids?
The rationale for therapy with corticosteroids
at a physiologic dose (i.e., 200 to 300 mg of hydro­
cortisone per day) originated in the observations
that patients with septic shock who had a reduced
response to corticotropin (increase in total plasma cortisol, <9 μg per deciliter [248 nmol per
liter]) were more likely to die4 and that the pressor response to norepinephrine may be improved
by the administration of hydrocortisone.5 Although the validity of these observations appears
to be increasingly doubtful as evidence accumulates that the standard corticotropin stimulation
test is unreliable in critically ill patients,6,7 the
findings have led to interest in treating such patients with corticosteroids. Encouraging results in
small trials8,9 and then in a larger trial10 led to
current recommendations to treat patients with
septic shock with physiologic doses of hydrocortisone.11,12 The recommendations are based
on five trials involving a total of 464 patients, of
whom 265 (57.1%) died.13 Even though various
treatment regimens were used, all five trials reported fewer deaths in patients who received corticosteroids. A meta-analysis of these trials suggested that the use of corticosteroids reduced
mortality.13
In the face of such evidence, why did Sprung
et al. conduct the Corticosteroid Therapy of Septic Shock (CORTICUS) study? As noted by the au188
thors, the current recommendations are heavily
dependent on one trial conducted by Annane et
al.10 In that trial, patients were divided into “responders” and “nonresponders” on the basis of
a corticotropin stimulation test; 229 of 299 patients (76.6%) did not have a response to corticotropin, a percentage that was much larger than
the 40% the investigators expected. After statistical adjustment for baseline covariates, a significant reduction in the likelihood of death was
observed in patients with no response to corticotropin who received corticosteroids. In contrast,
crude estimates of in-hospital mortality were
higher in patients who had a response to corticotropin.
Two additional features of this trial bear mentioning. First, patients who were assigned to receive hydrocortisone also received fludrocortisone, although the importance of this factor is
unknown. Second, 24% of the patients received
etomidate, a short-acting intravenous anesthetic
agent that selectively inhibits adrenal corticosteroid synthesis. Its use may have contributed to
the unexpectedly high number of patients who
did not have a response to corticotropin, and
whether the trial results apply in health care systems in which etomidate is rarely used is unclear.
Thus, the borderline result that was achieved only
after statistical adjustment (combined with the
unexpectedly high number of patients who did
not have a response to corticotropin and the high­
er estimated mortality in those who did have a
response to corticotropin) provide ample justification for the CORTICUS study.
Patients who were enrolled in the CORTICUS
study had septic shock and remained hypotensive
or required treatment with vasopressors for at
least 1 hour after adequate fluid resuscitation.
n engl j med 358;2 www.nejm.org january 10, 2008
editorials
Initially, patients were required to undergo randomization within 24 hours after the onset of
septic shock; this time window was subsequently increased to 72 hours. Patients received either
200 mg of hydrocortisone per day or placebo for
5 days; they then received a tapered dose of hydro­
cortisone during the next 6 days, after which
time the drug was stopped. The primary end
point was death from any cause at 28 days in
patients who did not have a response to corticotropin. Because of slow recruitment and expiry of
the supply of study drug, the trial was stopped
after only 500 of the planned 800 patients had
been recruited. Before treatment, patients underwent a corticotropin stimulation test, in which
46.7% did not have a response.
The two study groups were well matched at
baseline. Of 499 patients, 384 (77.0%) started
study treatment within 12 hours after the onset
of septic shock, and all but 6 patients were receiving inotropic agents or vasopressors at the
time of enrollment; 87% of patients in each study
group received at least 90% of their assigned
study drug. The use of open-label corticosteroids
and other reported concomitant treatments was
similar in the two groups, and 19.2% of the patients received etomidate before enrollment.
The rate of death in the control group was
lower than expected, and this factor, combined
with early stopping of the study, meant that the
study had a power of less than 35% to detect a
20% reduction in the relative risk of death. With
this caveat, the primary conclusion of the study
was that treatment with corticosteroids had no
effect on the rate of death at 28 days, a finding
that was consistent in the overall population (rela­
tive risk, 1.09; 95% confidence interval [CI], 0.84
to 1.41), in patients who had a response to corticotropin (relative risk, 1.00; 95% CI, 0.68 to 1.49),
and in those who did not have a response to
corticotropin (relative risk, 1.09; 95% CI, 0.77 to
1.52). The lack of treatment effect was also consistent regardless of the duration of septic shock
before recruitment. Also notable is that shock
was reversed more rapidly in patients receiving
hydrocortisone but that this factor did not result
in reduced mortality.
What, then, are the take-home messages for
clinicians, researchers, and policymakers? To
date, the CORTICUS study is the largest trial of
corticosteroids in patients with septic shock but
was still inadequately powered to detect a clini-
cally important treatment effect. The 95% confidence interval for the relative risk of death (0.84
to 1.41) includes the overall point estimate from
the study by Annane (0.89); therefore, the results
of the two studies are not inconsistent. A metaanalysis that includes data from the CORTICUS
trial is not likely to support the use of corticosteroids, and it seems clear that the corticotropin
stimulation test does not identify patients who
would benefit from corticosteroids. Clinicians
who treat their patients with corticosteroids because they have observed a rapid reduction in the
need for vasopressors should be aware that more
rapid weaning from vasopressors is an unreliable
surrogate outcome since it does not predict improved survival.
To researchers it should be clear that substantial uncertainty over the role of corticosteroids
persists. Reliable treatment recommendations will
be possible only if a much larger trial is conducted. To avoid generating further uncertainty, the
minimum sample size should substantially exceed the total number of patients who have been
studied so far. The detection of a 15% reduction
in relative risk from a rate of death of 35% will
require a study of at least 2600 patients. Although
such a number is daunting, the advent of trials
consortia for critical care may make such a study
possible.14
Promulgation of evidence-based guidelines
is an advance welcomed by many clinicians, although treatment recommendations are inevitably constrained by the quality of the available
evidence. Those writing or promoting treatment
guidelines should recognize that firm recommen­
dations based on small trials or meta-analyses
may be misleading because of random error, and
the inclusion of older trials with methodologic
limitations may introduce systematic error.15 Furthermore, the CORTICUS investigators stated that
it was likely that current guidelines inhibited recruitment to their trial; in some situations, apparently authoritative guidelines may make the
conduct of important confirmatory trials more
difficult.
Although the CORTICUS study was unable to
define the role of corticosteroids in septic shock,
the investigators performed a valuable service.
They reminded us that few critical care practices
or treatment recommendations are based on unequivocal evidence and that, in some instances,
critical appraisal and an open mind may be more
n engl j med 358;2 www.nejm.org january 10, 2008
189
The
n e w e ng l a n d j o u r na l
appropriate than unquestioning adherence to
guidelines. Perhaps the greatest service we can
do our patients is to conduct the large, highquality trials needed to base our clinical practice
on truly robust evidence.
No potential conflict of interest relevant to this article was reported.
From the George Institute for International Health, the Uni­
versity of Sydney, and the Royal North Shore Hospital — all in
Sydney.
1. Sprung CL, Annane D, Keh D, et al. Hydrocortisone therapy
for patients with septic shock. N Engl J Med 2008;358:111-24.
2. The Veterans Administration Systemic Sepsis Cooperative
Study Group. Effect of high-dose glucocorticoid therapy on mortality in patients with clinical signs of systemic sepsis. N Engl J
Med 1987;317:659-65.
3. Bone RC, Fisher CJ Jr, Clemmer TP, et al. A controlled clinical
trial of high-dose methylprednisolone in the treatment of severe
sepsis and septic shock. N Engl J Med 1987;317:653-8.
4. Rothwell PM, Udwadia ZF, Lawler PG. Cortisol response to
corticotropin and survival in septic shock. Lancet 1991;337:582-3.
5. Annane D, Bellissant E, Sebille V, et al. Impaired pressor sensitivity to noradrenaline in septic shock patients with and without impaired adrenal function reserve. Br J Clin Pharmacol 1998;
46:589-97.
6. Rai R, Cohen J, Venkatesh B. Assessment of adrenocortical
function in the critically ill. Crit Care Resusc 2004;6:123-9.
of
m e dic i n e
7. Hamrahian AH, Oseni TS, Arafah BM. Measurements of se-
rum free cortisol in critically ill patients. N Engl J Med 2004;350:
1629-38.
8. Bollaert PE, Charpentier C, Levy B, Debouverie M, Audibert G,
Larcan A. Reversal of late septic shock with supraphysiologic
doses of hydrocortisone. Crit Care Med 1998;26:645-50.
9. Briegel J, Forst H, Haller M, et al. Stress doses of hydrocortisone reverse hyperdynamic septic shock: a prospective, randomized, double-blind, single-center study. Crit Care Med 1999;
27:723-32.
10. Annane D, Sébille V, Charpentier C, et al. Effect of treatment
with low doses of hydrocortisone and fludrocortisone on mortality in patients with septic shock. JAMA 2002;288:862-71.
11. Dellinger RP, Carlet JM, Masur H, et al. Surviving Sepsis Campaign guidelines for management of severe sepsis and septic
shock. Crit Care Med 2004;32:858-73. [Errata, Crit Care Med
2004;32:1448, 2169-70.]
12. Minneci PC, Deans KJ, Banks SM, Eichacker PQ, Natanson C.
Meta-analysis: the effect of steroids on survival and shock during
sepsis depends on the dose. Ann Intern Med 2004;141:47-56.
13. Annane D, Bellissant E, Bollaert PE, Briegel J, Keh D, Kupfer Y.
Corticosteroids for severe sepsis and septic shock: a systematic
review and meta-analysis. BMJ 2004;329:480.
14. Cook DJ, Brower R, Cooper J, Brochard L, Vincent JL. Multicenter clinical research in adult critical care. Crit Care Med 2002;
30:1636-43.
15. Graf J, Doig GS, Cook DJ, Vincent JL, Sibbald WJ. Randomized, controlled clinical trials in sepsis: has methodological
quality improved over time? Crit Care Med 2002;30:461-72.
Copyright © 2008 Massachusetts Medical Society.
Efficacy of Sirolimus in Treating Tuberous Sclerosis
and Lymphangioleiomyomatosis
Elahna Paul, M.D., Ph.D., and Elizabeth Thiele, M.D., Ph.D.
Owing to their immunosuppressive and antiproliferative effects, sirolimus (also called rapamycin)
and related drugs are being evaluated as part of
many transplant immunosuppresion regimens, as
well as for a plethora of medical conditions such
as type 1 diabetes, macular degeneration, coronary artery disease, and metastatic or refractory
cancers of the breast, prostate, lung, and liver, to
name but a few.
The effects of sirolimus are mediated by its
inhibition of the curiously named cytoplasmic
protein mammalian target of rapamycin (mTOR),
a ubiquitous serine–threonine kinase that is intimately involved in the regulation of protein synthesis, cell growth, cytoskeletal organization,
and other features of cellular homeostasis. Insulin, growth factors, and amino acids are a few
of the extracellular stimuli that increase mTOR
activity, whereas hypoxia, dehydration, and depletion of ATP or amino acids seem to inhibit its
function (for reviews, see Corradetti and Guan1
and Wang and Proud2).
190
In this issue of the Journal, Bissler et al. report
on their prospective clinical trial of sirolimus
therapy in patients with the tuberous sclerosis
complex, lymphangioleiomyomatosis, or both.3
The tuberous sclerosis complex is a genetic syndrome characterized, in part, by sporadic tumori­
genesis in multiorgan systems. The tuberous
sclerosis complex is caused by inactivating genetic mutations of the TSC1 or TSC2 tumor-suppressor genes. Normally, the cytoplasmic TSC1
and TSC2 proteins (also called hamartin and tuberin, respectively) interact and inhibit mTOR activity. In the absence of a normally functioning
TSC1–TSC2 complex, mTOR activity increases,
and tumors grow in various organ systems including the kidney, lung, brain, and skin (for a
review, see Crino et al.4). The recent explosion of
molecular-genetic discoveries and elucidation of
signaling pathways involved in cell growth suggest that a drug that inhibits mTOR might be
therapeutic in patients with the tuberous sclerosis complex.
n engl j med 358;2 www.nejm.org january 10, 2008
EDITORIALS
strup et al,5 to demonstrate the causal role of lipoprotein
(a). Given the unique contributions of mendelian randomization to the understanding of biology, this approach will
continue to provide one avenue for the evaluation of causal
associations. Such studies will continue to demand careful
interpretation, particularly when findings are negative, and
any positive results will need to be placed in the appropriate biological and clinical context. Although nature’s randomized trials may provide a window to evaluate causality, confirmatory evidence from human-made RCTs will
continue to be required to inform clinical practice.
Financial Disclosures: None reported.
Funding/Support: Dr Thanassoulis holds a research fellowship from the Canadian
Institute of Health Research and the Fonds de Recherche en Santé Québec.
Role of the Sponsor: The funding agencies had no role in the conception or preparation of the manuscript.
Additional Contributions: Jacques Genest, MD, McGill University Health Center,
and Sekar Kathiresan, MD, Massachusetts General Hospital and Harvard Medical
School, provided helpful comments during the preparation of this article.
REFERENCES
1. Danesh J, Collins R, Peto R. Lipoprotein(a) and coronary heart disease: metaanalysis of prospective studies. Circulation. 2000;102(10):1082-1085.
2. Bennet A, Di Angelantonio E, Erqou S, et al. Lipoprotein(a) levels and risk of
future coronary heart disease: large-scale prospective data. Arch Intern Med. 2008;
168(6):598-608.
3. Downs JR, Clearfield M, Weis S, et al. Primary prevention of acute coronary
events with lovastatin in men and women with average cholesterol levels: results
of AFCAPS/TexCAPS: Air Force/Texas Coronary Atherosclerosis Prevention Study.
JAMA. 1998;279(20):1615-1622.
4. Shepherd J, Cobbe SM, Ford I, et al; West of Scotland Coronary Prevention
Study Group. Prevention of coronary heart disease with pravastatin in men with
hypercholesterolemia. N Engl J Med. 1995;333(20):1301-1307.
5. Kamstrup PR, Tybjærg-Hansen A, Steffensen R, Nordestgaard BG. Genetically
elevated lipoprotein(a) and increased risk of myocardial infarction. JAMA. 2009;
301(22):2331-2339.
6. Boerwinkle E, Leffert CC, Lin J, Lackner C, Chiesa G, Hobbs HH. Apolipoprotein
(a) gene accounts for greater than 90% of the variation in plasma lipoprotein(a)
concentrations. J Clin Invest. 1992;90(1):52-60.
7. Chasman DI, Shiffman D, Zee RYL, et al. Polymorphism in the apolipoprotein(a) gene, plasma lipoprotein(a), cardiovascular disease, and low-dose aspirin
therapy. Atherosclerosis. 2009;203(2):371-376.
8. Kathiresan S, Willer CJ, Peloso GM, et al. Common variants at 30 loci contribute to polygenic dyslipidemia. Nat Genet. 2009;41(1):56-65.
9. Kronenberg F, Kronenberg MF, Kiechl S, et al. Role of lipoprotein(a) and apolipoprotein(a) phenotype in atherogenesis: prospective results from the Bruneck
study. Circulation. 1999;100(11):1154-1160.
10. Luke MM, Kane JP, Liu DM, et al. A polymorphism in the protease-like domain of apolipoprotein(a) is associated with severe coronary artery disease. Arterioscler Thromb Vasc Biol. 2007;27(9):2030-2036.
11. Shiffman D, O’Meara ES, Bare LA, et al. Association of gene variants with incident myocardial infarction in the Cardiovascular Health Study. Arterioscler Thromb
Vasc Biol. 2008;28(1):173-179.
12. Tregouet DA, Konig IR, Erdmann J, et al; Wellcome Trust Case Control
Consortium; Cardiogenics Consortium. Genome-wide haplotype association study
identifies the SLC22A3-LPAL2-LPA gene cluster as a risk locus for coronary artery
disease. Nat Genet. 2009;41(3):283-285.
13. Ebrahim S, Davey Smith G. Mendelian randomization: can genetic epidemiology help redress the failures of observational epidemiology? Hum Genet. 2008;
123(1):15-33.
14. Wu HD, Berglund L, Dimayuga C, et al. High lipoprotein(a) levels and small
apolipoprotein(a) sizes are associated with endothelial dysfunction in a multiethnic cohort. J Am Coll Cardiol. 2004;43(10):1828-1833.
15. Cohen JC, Boerwinkle E, Mosley TH Jr, Hobbs HH. Sequence variations in PCSK9,
low LDL, and protection against coronary heart disease. N Engl J Med. 2006;
354(12):1264-1272.
16. Hindorff L, Junkins H, Mehta J, Manolio T. A catalog of published genomewide association studies. http://www.genome.gov/26525384. Accessed May 5,
2009.
17. Zacho J, Tybjærg-Hansen A, Jensen JS, Grande P, Sillesen H, Nordestgaard
BG. Genetically elevated C-reactive protein and ischemic vascular disease. N Engl
J Med. 2008;359(18):1897-1908.
Living With Uncertainty
in the Intensive Care Unit
Should Patients With Sepsis Be Treated With Steroids?
Roman Jaeschke, MD, MSc
Derek C. Angus, MD, MPH
P
HYSICIANS WHO PRACTICED MEDICINE 25 YEARS AGO
likely remember the use of high-dose intravenous
steroids, such as 1-g boluses of methylprednisolone, for septic shock. The practice was fueled by
anecdotes of miraculous recoveries, but large randomized
trials failed to demonstrate benefit and raised the specter of
possible harm. Steroids were abandoned and lay dormant
for years, until recent studies suggested that septic shock
may be exacerbated by relative adrenal insufficiency and that
smaller dose of steroids for longer periods of time may be
beneficial. In 2002, in a multicenter French study, Annane
See also p 2362.
2388 JAMA, June 10, 2009—Vol 301, No. 22 (Reprinted)
et al1 reported lower mortality among patients in septic shock
who were randomized to a 1-week course of low-dose steroids. This study ignited such rapid interest in steroids that
the United States temporarily ran out of hydrocortisone. For
those who lament the usually slow adoption of evidence into
clinical practice, this event was a marked departure from
the norm. Subsequent meta-analyses, systematic reviews, and
professional society guidelines all echoed the notion that
vasopressor-dependent septic shock should be treated with
corticosteroids.
Author Affiliations: Department of Medicine, McMaster University, Hamilton, Ontario, Canada (Dr Jaeschke); CRISMA Laboratory, Department of Critical Care Medicine, School of Medicine, University of Pittsburgh, Pittsburgh, Pennsylvania (Dr
Angus). Dr Angus is also Contributing Editor, JAMA.
Corresponding Author: Roman Jaeschke, MD, MSc, Department of Medicine,
McMaster University, 301 James St S, Room F506, Hamilton, Ontario, L8P 3B6,
Canada (jaeschke@mcmaster.ca).
©2009 American Medical Association. All rights reserved.
Downloaded from www.jama.com by guest on November 6, 2009
EDITORIALS
However, the story was not over. In an attempt to validate the findings from the French study, Sprung et al2 and
a European consortium conducted a second large multicenter trial, the Corticosteroid Therapy of Septic Shock
(CORTICUS) study, which failed to demonstrate an effect
of steroids in reducing mortality in patients with septic shock.
These findings dampened enthusiasm for steroids, as exemplified in the 2008 clinical practice guidelines from the
Surviving Sepsis Campaign (SSC).3 Although the 2004 guidelines from the same group had advocated strongly for steroids, the latest guidelines (to which both authors of this
editorial contributed) made only a weak recommendation
for steroids and suggested that use of steroids be restricted
to patients with shock that is least responsive to supportive
measures.3
In this issue of JAMA, Annane and colleagues4 report a
meta-analysis of the entire set of trials studying steroids for
sepsis. This study, conducted under the auspices of the Cochrane Collaboration, was performed and written with the full
cooperation of the authors of the primary studies and with
access to unpublished information. The authors report that
there have now been 12 randomized trials testing the more
recent strategy of low-dose steroids for a week or more and
suggest an impressive overall reduction in mortality (risk
ratio, 0.84; 95% confidence interval, 0.72-0.97; P=.02), even
when accounting for the CORTICUS study. They conclude
that steroids are indicated for all patients in septic shock,
despite the findings of this trial, and in contrast with the
position articulated in the SSC guidelines.
So it seems that clinicians treating patients with sepsis
have 3 choices regarding steroids: no use, limited use, or
broad use. Steroid use could be abandoned if the largest and
latest trial, CORTICUS, is thought to effectively trump all
prior studies. Steroids could be used in a limited set of patients and initiated only after it has been demonstrated that
these patients are not responding to conventional measures, based on the SSC guidelines. Or steroids could be used
broadly in septic shock, and possibly even in all severe sepsis (ie, any infection complicated by acute organ dysfunction), based on the results of the meta-analysis by Annane
et al.4
Putting it mildly, this is a messy situation. Corticosteroids are inexpensive and widely available. Severe sepsis and
septic shock are substantial public health problems worldwide, accounting for hundreds of thousands of deaths every year. A short, inexpensive course of steroids, if it reduces mortality, would seem to be a wonderful and prudent
treatment option. But corticosteroids are no panacea, and
the list of potential harmful effects is long. While there are
concerns about whether corticosteroids actually could help
these patients, there are also concerns about whether they
actually could be harmful. Thus, it seems important to have
the story right, which is why there is a rich body of clinical
trials. Yet despite the large number of trials, the answer certainly is not clear. Further trials are under way, which may
©2009 American Medical Association. All rights reserved.
help tease out subsets of patients who should or should not
receive steroids. But while awaiting those results, how can
clinicians make sense of the available literature and of the
diverging expert opinions and determine what to do now?
First, there are some technical considerations regarding
the report by Annane et al.4 Their current meta-analysis includes information from some trials relevant to the study
question that was not available to the SSC guidelines committee.3 Although the updated information had only a small
effect on the risk ratio point estimate, the confidence intervals around this risk ratio narrowed such that the upper
bound fell below 1 and the P value nudged below the conventional threshold of .05. Faced with such data, it is conceivable that the SSC guidelines committee may have offered a stronger recommendation for steroids.
Second, septic shock is a syndrome consisting of different clinical presentations, and differences in entry criteria
among previous trials may explain discrepant results. For
example, the French trial1 may have targeted a sicker population of patients than that recruited in CORTICUS,2 as evidenced by entry criteria that differ in determining how responsive blood pressure was to supportive measures and
differences in control group mortality rates. Thus, it is possible that benefit is restricted to the more severely ill. When
postulating that a drug works differently in a particular subgroup, there are some methodological principles to apply.5
The proposed difference in effect should be an a priori hypothesis with a specified direction, a credible biological rationale, and little likelihood that the difference in effect occurred by chance. That steroids should work better in patients
with more severe shock was 1 of only 3 a priori hypotheses
in the meta-analysis4 and does appear to satisfy these other
conditions. However, confidence in this finding is lessened
because this observation is based on between-study differences; an individual patient data meta-analysis would be required to more definitively establish or refute the hypothesis.6
But will further examination of the existing data reveal
some convincing truth to settle the debate? No. There is residual uncertainty, and the question therefore becomes one
of how to embrace that uncertainty, both in developing overarching practice guidelines and in making individual patient management decisions.
Practice guidelines are least controversial when based on
high-quality evidence showing consistent and large beneficial treatment effects with minimal undesirable consequences. However, recommendations must often rely either
on lower-quality evidence (due, for example, to deficiencies of methods or inconsistencies in results) or on evidence that, even though robust, suggests a close balance between the desirable and undesirable consequences of
alternative management options. These 2 different types of
uncertainty are crucial to distinguish: in the latter case, there
is some reassurance that alternative treatment options will
likely yield similar outcomes, whereas, in the former, there
(Reprinted) JAMA, June 10, 2009—Vol 301, No. 22
Downloaded from www.jama.com by guest on November 6, 2009
2389
EDITORIALS
are concerns that favoring one option over another could
have important consequences, and yet the evidence is insufficient to strongly favor either direction.
The authors of the current meta-analysis and the authors of the SSC guidelines3 used the Grading of Recommendations Assessment, Development, and Evaluation
(GRADE) framework to assess the evidence, which considers these 2 sources of uncertainty separately,7 and both sets
of authors acknowledge that the evidence is an important
source of uncertainty. Presumably because of this uncertainty, both groups shy from declarative statements: Annane et al4 use the term “should be considered” and the SSC
guidelines committee3 categorized their steroid recommendations as “weak,” using the wording “we suggest,” rather
than “we recommend.” In other words, the major difference between the SSC guidelines and the current metaanalysis seems to be a difference of judgment and opinion
in the face of inconclusive evidence. That means that the
final decision rests squarely on those at the bedside.
It is difficult for physicians to admit to patients, families,
colleagues, and, sometimes, themselves that there is uncertainty surrounding some decisions. In some working environments and specific clinical encounters, uncertainty may
undermine confidence, question competence, and provoke anxiety in otherwise already emotionally charged situations. At the same time, it is easy and sometimes seductive to become emotionally invested in ideas, despite the
potential for polarization and potentially acrimonious debates. And yet uncertainty is prominent in medical decision making, such as current debates regarding longacting ␤-agonists in asthma8 or proton pump inhibitors in
patients taking aspirin and clopidogrel.9
When physicians can embrace uncertainty, conflicts diminish and shared decision making (at least on guideline
panels if not at the bedside) becomes easier.10 Embracing
uncertainty helps defeat unwarranted dogma, makes the environment receptive to the conduct of clinical trials designed to diminish uncertainty, and facilitates acceptance
of the results of more definitive trials that contradict existing guidelines.3,11 Embracing uncertainty also facilitates explicit communication with colleagues and students and, more
importantly, with those most interested—patients and their
families. Based on current evidence, physicians can and
2390 JAMA, June 10, 2009—Vol 301, No. 22 (Reprinted)
should counsel the family of a patient with septic shock that
the decision to use corticosteroids (or, for that matter, to
use activated protein C or right heart catheter) is not black
and white and that reasonable people may reach different
conclusions about exactly what is the correct decision. Admitting this uncertainty does not necessarily burden patients and families with the final decision, but they deserve
to know that their physicians are not sure.
Financial Disclosures: Drs Jaeschke and Angus participate in development of clinical practice guidelines considering use of steroid in sepsis, and both took part in
the preparation of the SSC guidelines. Dr Angus reported that he has served previously on the advisory boards for several companies involved in the evaluation of
potential novel therapies and biomarkers for sepsis; has participated in the last 2
years on advisory boards for Wyeth-Ayerst, Roche Diagnostics, Biomerieux, Brahms
Diagnostica, Eisai, Takeda, Novartis, and Bayer; is currently a member of the data
safety and monitoring board monitoring a trial sponsored by Eli Lilly; and has research funding support from Eisai.
Additional Contributions: We thank Gordon Guyatt, MD, MSc, McMaster University, for reviewing and commenting on an earlier version of the manuscript. He
did not receive any compensation.
REFERENCES
1. Annane D, Sebille V, Charpentier C, et al. Effect of treatment with low doses
of hydrocortisone and fludrocortisone on mortality in patients with septic shock.
JAMA. 2002;288(7):862-871.
2. Sprung CL, Annane D, Keh D, et al; CORTICUS Study Group. Hydrocortisone
therapy for patients with septic shock. N Engl J Med. 2008;358(2):111-124.
3. Dellinger RP, Levy MM, Carlet JM, et al; International Surviving Sepsis Campaign Guidelines Committee. Surviving Sepsis Campaign: international guidelines
for management of severe sepsis and septic shock: 2008. Crit Care Med. 2008;
36(1):296-327.
4. Annane D, Bellissant E, Bollaert P-E, et al. Corticosteroids in the treatment of
severe sepsis and septic shock in adults: a systematic review. JAMA. 2009;
301(22):2362-2375.
5. Guyatt G, Jaeschke R, Prasad K, Cook DJ. Summarizing the evidence. In: Guyatt G, Rennie D, Meade M, Cook D, eds. Users’ Guides to the Medical Literature:
A Manual for Evidence-Based Clinical Practice. New York, NY: McGraw-Hill; 2008:
523-542.
6. Reade MC, Delaney A, Bailey MJ, Angus DC. Bench-to-bedside review: avoiding pitfalls in critical care meta-analysis—funnel plots, risk estimates, types of heterogeneity, baseline risk and the ecologic fallacy. Crit Care. 2008;12(4):220.
7. Guyatt GH, Oxman AD, Vist GE, et al; GRADE Working Group. GRADE: an
emerging consensus on rating quality of evidence and strength of recommendations.
BMJ. 2008;336(7650):924-926.
8. Drazen JM, O’Byrne PM. Risks of long-acting ␤-agonists in achieving asthma
control. N Engl J Med. 2009;360(16):1671-1672.
9. Juurlink DN, Gomes T, Ko DT, et al. A population-based study of the drug interaction between proton pump inhibitors and clopidogrel. CMAJ. 2009;180
(7):713-718.
10. Jaeschke R, Guyatt GH, Dellinger P, et al. Use of GRADE grid to reach decisions on clinical practice guidelines when consensus is elusive. BMJ. 2008;337:
327-330.
11. Sackett DL. The arrogance of preventive medicine. CMAJ. 2002;167(4):
363-364.
©2009 American Medical Association. All rights reserved.
Downloaded from www.jama.com by guest on November 6, 2009
CMEducation Resources, LLC
The Multifaceted Frontiers of
SEPSIS RESEARCH and MANAGEMENT
Interactive Question and Answer Session
Faculty: Faculty Panel
Notes:
Time: 8:35 – 8:50 p.m.