Title: PCR and Gel Electrophoresis, Moving Beyond the Technique: Effects of Aligning
Learning Goals with Assessments
I. Developers: Allison Phillips and Amber Robertson
II. Learning goals
Broad Learning goals
1. Students will understand how scientists ask questions.
2. Students will be able to select and/or design quality reagents for experiments.
3. Students will understand the importance of each step of a reaction or experiment.
4. Students will be able to make conclusions about data and connect technical results
with biological and societal relevance.
5. Students will be able to use bioinformatics tools to gather information to aid in
experimental design.
6. Students will be able to present scientific information in formal and semi-formal
environments to their professors and peers.
Specific learning goals
1. Students will be able to accurately draw each step of PCR and label the temperature
of each step, the directionality of the primers, the proper intermediate products, and
the final products.
2. Students will be able to make troubleshooting inferences through reflection on the
theory of PCR and gel electrophoresis to determine possible problem areas.
3. Students will be able to explain how DNA molecules move through an agarose gel
matrix, that they are separated by size and weight, and why DNA moves towards the
positive pole.
4. Students will be able to determine the size of a band in an agarose gel by using a DNA
ladder.
5. Students will be able to correctly interpret positive and negative controls.
6. Students will be able to design quality PCR primers using bioinformatics databases.
7. Students will be able to analyze data and use the results to support a position for or
against GMOs in a case-based presentation.
III. Scientific teaching themes
The unit was designed to specifically meet and extend the learning goals for the Cell
Biology GMO lab. We felt there is a greater need to develop materials that address the
theories behind several techniques used in molecular experiments, in this case the
polymerase chain reaction (PCR) and gel electrophoresis. These topics are often taught as
protocol-based techniques without a direct tie to the theory making it more difficult to
analyze and understand results or troubleshoot problems that arise. With that in mind we
designed the exercises to target theory and analysis in a variety of contexts.
Our teachable unit design used the framework of scientific teaching. We first
established the learning goals that the teachable unit was to address and worked to create a
diverse group of active learning exercises to achieve these goals. Multiple methods of
assessment and evaluation were used and were based directly on the learning goals. The
learning goals were divided into broad and specific learning goals. The broad learning goals
addressed fundamental scientific abilities that have general applicability throughout all
science courses and labs. These include things like experimental design, gathering,
analyzing, and presentation of data, and troubleshooting experimental procedures. The
specific learning goals were more targeted to the techniques and theories behind PCR and
gel electrophoresis and were directly measured by the evaluative rubric.
By first establishing learning goals we were able to align all of the activities and
assessments to meet those goals. In doing so we were able to meet many of our learning
goals as demonstrated in the results of the assessments. We hope that in designing the
teachable unit with a focus on theory and broad applicability that these exercises can be
used outside of the context of this GMO lab. For example, small adaptations would allow for
the transfer to other contexts or educational settings such as another lab, larger classroom
setting, or mentoring an independent researcher.
Both formal and informal assessment tools were used throughout the GMO lab. Several
rubrics were implemented which identified the key components and levels of achievement
of the broad and specific learning goals. The theories and techniques of PCR and gel
electrophoresis were presented as mini-lectures to the entire class during which students
were expected to participate. In addition, we utilized breaks between activities to engage
students in discussions about misconceptions, trouble areas, and applicability of the
techniques they were learning. This often clarified and identified misconceptions. Group
work allowed students to identify their own levels of achievement relative to their peers.
Many students benefited from interacting with more knowledgeable peers and group work
often enhanced problem-solving skills.
Diversity
To address the importance of diversity we acknowledged differences in learning styles
and student population in the design of the teachable unit. To do this we incorporated
activities that allowed students to learn through visual, tactile, and audible exercises. In
addition to the mini-lectures, the students were asked to view animations about PCR and
gel electrophoresis and then draw out the cycles of PCR. Group work was used as a tool
to help students problem solve during multiple exercises and in using bioinformatics
tools. Our exercises used examples of both male and female scientists from diverse
backgrounds. Feedback from students revealed the inclusive language enhanced their
learning experience.
Active learning
We designed the active learning exercises which were guided by the 5E Instruction
Model. Below are examples of how our active learning unit fits with the 5E Instruction
Model. The students were encouraged to talk through the exercises and ask questions of
their peers and instructors.
Engage: The students viewed animations on PCR and gel electrophoresis to start
thinking about these processes. These animations elicited prior knowledge about DNA
structure, replication and polymerases as well as introduced other terminology.
Explore: The students were given a set of exercises that allowed them to analyze DNA
gel data and describe the process of PCR through drawing. The students worked on
these alone or with a group.
Explain: The exercises included questions about why gel electrophoresis works and
the importance of each step in a PCR cycle. Also, the students identified where and
why problems may have occurred during the course of PCR and gel electrophoresis
experiments. Students had the opportunity to discuss their answers with their peers
and the instructor. By doing this the students were able to identify their own
misconceptions as they compare their products/conclusions to those of their peers or
through interaction with the instructors. The exercises were designed to introduce
relevant topics for the final case-based presentation.
Elaborate: Students were exposed to how DNA gels can be used in applications such
as fingerprinting and detecting the presence of a gene in various organisms. They had
to extend their knowledge about DNA gel electrophoresis to determine the predicted
product and how the obtained data can be fit together. They were expected to
connect their prior knowledge about experimental design and positive and negative
controls to these worksheets. They elaborated on the reagents used in PCR by using
bioinformatics tools to design quality PCR primers. The students were required to
assimilate all of the knowledge, problem-solving skills, and data analysis skills into a
case-based presentation, which required them to use their data to support one
position in two-sided case about testing food products for the presence of GMOs.
Evaluate: The students were assessed based on their answers on the exercises. Many
misconceptions they had about PCR and DNA gel electrophoresis emerged. The
students were able to apply and evaluate their knowledge of PCR and DNA gel
electrophoresis when they analyzed their own PCR products from the concurrent lab.
We hoped that the previous 4 steps of the 5E model increased the level of
sophistication of the explanations of results in their GMO case-based presentations.
Assessment
Formative and summative assessments were used to evaluate student performance
and learning gains. Students were formally graded on the PCR Cycle Sketch, Primer
Design Exercise and Final GMO Case-Based Presentations. A rubric was specifically
designed to assess student performance on the presentations. Informal comments
were provided by instructors for the PCR and Gel Analysis exercises. In addition,
students frequently received feedback from instructors as they progressed through
the exercises and the unit as a whole.
Evaluative rubrics were designed to assess all exercises (see below) and
presentations for the purpose of determining the effectiveness of the new materials
in reaching the learning goals. These separate evaluations did not have any impact on
the students’ grades and were only used for evaluation of the unit. Concepts
evaluated by the rubrics were determined from the broad and specific learning goals
and aligned with the activities (Figure 1). The video-taped student presentations
were evaluated after completion of the unit for appropriate use of PCR theory,
correct analysis of data, and development of a logical scientific argument to support
their position. Each group presentation was evaluated by the authors and three other
unbiased scientists not involved in this project or related to Biocore, but familiar with
the techniques and theories being evaluated.
IV. Evaluation of Teachable Unit
Pre-, post-, and retention surveys were created as a means to gauge student perceptions,
learning gains, and knowledge retention. Questions focused on student perceptions of the
new materials, understanding of DNA amplification by PCR, primer design, and positive and
negative controls in experimental design.
V. Teaching Plan
Title: PCR and Gel Electrophoresis, Moving Beyond the Technique: Effects of Aligning
Learning Goals with Assessments
Developers: Allison Phillips and Amber Robertson
Time
Lab Activity*
Exercise
First
Discussion
Students begin
DNA extractions
from food
products
PCR Cycle Sketch
Goals
To help students visualize each step
of PCR and understand primer
annealing and directionality of DNA
replication.
Assessments: PCR key, written
feedback, evaluative rubric
Diversity: visual (animations),
kinesthetic (drawing), mathematical
(amplification animation)
First Lab
Students finish
DNA extractions
and set up PCR
reactions
PCR Exercise
To help students learn to analyze PCR
gels and troubleshoot problems within
an experiment.
Assessments: Answer key, written
feedback, evaluative rubric
Time
Lab Activity*
Exercise
Goals
Diversity: group work, critical
thinking, research (e.g. components
of a PCR reaction)
Second
Discussion
Class discussions Primer Design
and time to
Exercise
work on all
exercises
To help students learn how to design
quality PCR primers and understand
directionality and specificity.
Assessments: Answer key, written
feedback, evaluative rubric
Diversity: group work, visual
(drawing), computer experience
(bioinformatics)
Second
Lab
Students do gel
electrophoresis
and analyze
data for student
presentations
Gel Analysis
Exercise
To help students analyze a DNA
fingerprinting gel with a ladder and
controls and make conclusions about
the results.
Assessments: Answer key, written
feedback, evaluative rubric
Diversity: group work, critical
thinking, deductive reasoning (e.g.
eliminating suspects)
Third
Discussion
Student
Presentations
GMO
Presentations
To help students synthesize class data
and unexpected outcomes to present
a logical argument.
Assessments: Student grade rubric,
instructors’ evaluative rubric
Diversity: group work, critical
thinking, role playing, oral and visual
presentation of data
Note: * The lab activity is from Batzli and Bradner, 2005. The exercises were
developed to complement the wet lab activity.
VI.
Outline of Activities
PCR Cycle Sketch
The goal of the PCR Cycle Sketch was to help students visualize each step of PCR and
understand primer annealing and directionality of DNA replication. It contains a series of
questions about PCR that was incorporated into an existing pre-lab assignment. Students
were expected to complete this exercise before coming to class. The new exercise
consisted of (1) watching short virtual representations of the steps of PCR (Dolan Learning
Center, 2006, Polymerase Chain Reaction and Sumanas, 2006, The Polymerase Chain
Reaction) and gel electrophoresis (Dolan Learning Center, 2006, Gel Electrophoresis), (2)
hand-drawing the first three cycles of PCR, indicating the proper intermediate and final
products and appropriate directionality of the primers and (3) answering several questions
about the ratio of intermediate and target DNA products and how that relates to DNA
amplification during PCR. We took time in the subsequent class to discuss with students
many misconceptions about PCR which were revealed by their responses to the pre-lab
assignment.
PCR Exercise, Primer Design Exercise, and Gel Analysis Exercise
Worksheet exercises were designed to help students familiarize themselves with
primer design and provided several examples of DNA gels in different contexts. Students
worked in groups of two to four, as time allowed in the lab, to complete these exercises.
The worksheets were designed to give students (1) exposure to multiple problems that may
occur in the lab while carrying out PCR and gel electrophoresis and experience
troubleshooting these problems, (2) instructions for and experience with designing primers
for experimentation, and (3) experience with PCR data analysis in the context of DNA
fingerprinting. Students were given the opportunity to analyze results from an array of gels,
predict the results of an experiment and draw conclusions about these results. These
activities occurred in class before students analyzed their own results, to prepare them to
be more critical of the conclusions subsequently made from their own data.
Final GMO Case-Based Presentations
After the completion of the GMO lab and all associated exercises, students were
challenged to develop a logical, data-driven argument to support their assigned position in a
mock trial regarding the presence or absence of GMOs in a particular food product.
Students, in groups of four, analyzed lab results from the compiled class data to provide
evidence for their case. This data was in the form of PCR gel images. They presented their
positions in formal presentations for the class and were expected to integrate their data
analysis to support their position and answer questions. All student presentations were
video-taped for later evaluation.
VII. To Do List
1. Prepare pre- and post- surveys
2. Prepare handouts
3. Read through misconceptions
4. Prepare rubrics for evaluating exercises and presentations
Things to bring to class:
1. Handouts:
a. PCR Cycle Sketch
b. PCR Exercise
c. Primer Design Exercise
d. Gel Analysis Exercise
e. GMO Presentation Guidelines
2. Video recording equipment for presentations
Post to class website:
1. Pre- and post- surveys
2. Links to online animations
3. Class data set for analysis for presentations
VIII. References
Batzli, J. and Bradner, D. What kind of genes are in your Fritos?: Detecting Genetic
Modification in Food by Polymerase Chain Reaction. From Biocore 304 Cell Biology
Lab Manual. 2005.
Biological Sciences Curriculum Study. (2003). BSCS 5E Instruction Model. In: BSCS Biology: A
Human Approach. Dubuque, IA: Kendall-Hunt.
Dolan Learning Center. (2006). Gel Electrophoresis.
http://www.dnalc.org/ddnalc/rurces/electrophoresis.html. (accessed May 2006)
Dolan Learning Center. (2006). Polymerase Chain Reaction.
http://www.dnalc.org/ddnalc/rurces/pcr.html. (accessed May 2006)
Huba, M.E. and Freed, J. E. (2000). Using rubrics to provide feedback to students. In:
Learner-Centered Assessment on College Campuses, Boston, MA: Allyn and Bacon,
151-200.
Sumanas. (2006). The Polymerase Chain Reaction.
http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/pcr.html.
(accessed May 2006)
Wiggins, G. and McTighe, J. (1998). Understanding by design. Alexandria, VA: Association for
Supervision and Curriculum Development.
IX. EVALUATIVE RUBRIC FOR TEACHABLE UIT
Criteria
Level 3
Level 2
PCR Cycle Sketch
Does the student
understand the importance
of each temperature
change of one cycle of
PCR? (Broad Goal 3;
Specific Goal 1)
Does the student
Student can identify
temperature and effect
of temperature for
each step (including:
denature, anneal and
extend).
Student can properly
Student can identify
the temperature for
each cycle, but cannot
explain the effect of
the temperature
correctly.
Student can identify
Level 1
Student does not
indicate temperature
or effect of
temperature.
Student does not
understand how primers
initiate DNA replication?
(Broad Goal 3; Specific
Goal 1)
Does the student
understand how the first
extension occurs and how
that leads to target DNA in
later cycles? (Broad Goal
3; Specific Goal 1)
Does the student
understand the idea of
amplification of target
DNA? (Broad Goal 3;
Specific Goal 1)
PCR Exercise
Can the student state why
PCR is an appropriate
technique for
amplification? (Broad
Goal 1; Specific Goal 1)
identify the
directionality of
primers and the
extension steps.
Student shows proper
intermediates and
indicates final
products.
Student can correctly
identify the ratio of
target to intermediate
and predict the ratio
after 20 cycles and
how the DNA would
appear on the gel.
The student can state
why PCR is an
appropriate technique
for amplification of a
specific DNA
sequence.
Can the student identify
The student can
problems with components identify problems with
of a PCR reaction and
components of a
technically explain
reaction, and can
unexpected higher
technically explain
molecular weight bands.
unexpected higher
(Broad Goals 3,4; Specific molecular weight
Goals 1, 2, 3, 4, 5)
bands.
Does the student
The student can
understand how DNA
identify the problem
migrates in an agarose gel? with the buffer and
(Broad Goal 3; Specific
can identify fragments
Goal 3, 4)
that are larger than
expected.
Primer Design Exercise
Does the student
The primers are
understand the keys to a
designed to meet the
quality primer? (Broad
criteria and the PCR
Goal 2; Specific Goals 1,
reaction should work
6)
in theory.
Does the student
The 3’ primer is the
understand the proper
reverse complement of
the primer annealing
sites, but does not
indicate the direction.
identify primer
annealing sites.
Student shows
intermediate and final
products but either the
intermediate or final
products are incorrect.
Student shows
intermediate and final
products but both
products are incorrect.
Student can identify
the proper ratio in the
first few cycles, but
cannot extend to 20
cycles OR cannot
predict how the gel
would look.
Student cannot
differentiate between
target and
intermediate DNA.
The student
The student does not
understands
understand the idea of
amplification but not
amplification.
the specificity of PCR.
The student can
identify the
components but is not
able to reason through
higher level problems
such as explaining
higher molecular
weight bands.
The student
understands DNA
migration in light of
size OR charge but not
both.
The student can
identify problems but
cannot use PCR
theory to explain the
problems.
The reaction might
work, but there are
potential problems
with primer design or
structure.
The primer is the
reverse or the
The reaction would
not work due to poor
primer design.
The student does not
understand theory of
DNA migration based
on size and charge.
The primer is neither
the complement nor
orientation/design of the
reverse primer? (Broad
Goal 2, Specific Goal 1)
Can the student use
bioinformatics tools
including BLAST searches
to check primer quality
and specificity? (Broad
Goals 2, 5; Specific Goal
6)
Gel Analysis Exercise
Can the student properly
analyze the results of the
gel to identify crossreacting bands and make
appropriate conclusions?
(Broad Goal 4; Specific
Goals 1, 2, 5)
Can the student identify
and design the next
important experiment to
test? (Broad Goals 2, 3;
Specific Goals 2, 5)
Does the student
understand how DNA
migrates in a gel and how
to use the ladder to
determine fragments sizes?
(Broad Goal 4; Specific
Goals 3, 4)
Does the student
understand the importance
of positive and negative
controls? (Broad Goals 2,
3; Specific Goal 5)
the sequence and
should work in the
reaction.
The student has
developed primers
using bioinformatics
that meets the criteria
and the student clearly
understands
specificity of the
primer.
complement but not
both and therefore the
reaction will not work.
The student can
identify a problem
with the primers using
bioinformatics but
cannot analyze the
bioinformatics results
correctly or
completely.
the reverse and
therefore the reaction
will not work.
The student does not
use bioinformatics to
check the primers or
does not understand
how the results
elucidate specificity of
the primers to the
target DNA.
The student eliminated
all appropriate
suspects (and no
additional ones).
The student eliminated
all appropriate
suspects and
additional ones such
as suspect #6.
The student did not
analyze the results
properly and potential
suspects were
released.
The student knows the
importance of
retesting suspect #6
with the appropriate
controls.
The student can
identify the correctly
sized fragment and
determine the sizes of
all fragments.
The student knows
that suspect #6 should
be retested but does
not include
appropriate controls.
The student can
identify the sizes of
the band, but the sizes
don’t influence their
decision.
The student does not
know to retest suspect
#6.
The student eliminated
the appropriate
suspects and stated
how +/- controls
influenced their
decision including the
water control.
The student did not
eliminate the
appropriate suspects
OR did not state how
+/- controls influenced
their decision.
The students were not
able to eliminate
appropriate suspects
and state how +/controls influenced
their decision.
The student cannot
identify either band
OR can identify only
one band.
PCR Cycle Sketch
For this assignment you will be drawing several cycles of PCR and answering a few short questions. The
following animations will help you to understand the processes of PCR and gel electrophoresis.
The Polymerase Chain Reaction by Sumanas, Inc.:
http://www.sumanasinc.com/webcontent/anisamples/molecularbiology/pcr.html
Polymerase Chain Reaction by the Dolan DNA Learning Center:
http://www.dnalc.org/ddnalc/resources/pcr.html
Gel Electrophoresis by the Dolan DNA Learning Center:
http://www.dnalc.org/ddnalc/resources/electrophoresis.html
1) A thorough understanding of the process of PCR will help in the analysis of your DNA gel. The figure below
represents a segment of double-stranded DNA with 100 base pair segments denoted by each letter. The
primers are indicated by the arrows for both the sense and anti-sense DNA strands. In the following questions,
a “copy” of DNA refers to a double-stranded piece of DNA.
5’
A
B
C
D
E
F
G
H
I
5’_______________________________________________________3’
3’_______________________________________________________5’
A
B
C
D
E
F
G
H
I
5’
A. Draw the first three cycles of PCR indicating the intermediate products labeled with letter designations,
directionality (5’ 3’), and the size of the desired target double-stranded DNA product. Include the
temperatures and their significance for each step in the PCR reaction for the first cycle.
B. For each cycle, indicate how many copies of target double stranded-DNA and “intermediate DNA” (the
DNA includes target DNA region plus a bit of the flanking DNA and/or the original DNA strand) you
would have after each cycle assuming you began with one double strand DNA template.
2) Answer the following questions assuming there have been four cycles of PCR.
A. What is the total number of target DNA copies and the total number of intermediate DNA copies assuming
you began with one double strand DNA template? Note: Target DNA copies contain only the target DNA on
both strands.
Target DNA copies _____________
Intermediate DNA copies________
B. What is the ratio of intermediate to target DNA copies in the fourth cycle? How would this ratio change
after twenty cycles? How does this ratio affect what you see in the DNA gel?
PCR Exercise
Carlos and Emily, two novice scientists, were asked to test a local farmer’s
crops for the presence of the bar gene, which confers resistance to Roundup™,
a commercially available herbicide that the farmer would like to use in her
field. However they are having trouble with the lab procedures. Please help them figure out why
their experiments do not work.
First, Carlos isolated genomic DNA from several crops. He decided to separate the total
genomic DNA out on a gel after restriction enzyme digest and see which crops contained
the bar gene. Observe the gel to the right and explain to Carlos why his gel is inconclusive.
Why is PCR a more appropriate technique for testing for the presence of the bar gene?
2. Now that they have decided to use PCR to test for the presence of the resistance gene, Emily has
designed primers to amplify a 300-bp fragment of the bar gene and is ready to set up the reactions.
However, she does not have a protocol for PCR. Please list the reagents Emily should use in her
reactions (amounts not necessary) and explain the function of each reagent. Why are two primers
necessary for amplification?
3. When they were ready to run the PCR samples on an agarose gel, Carlos loaded the gel, added water
to the gel tank and connected the electricity. Afterwards, Emily examined Carlos’s gel on a UV light
box. Below is the gel she saw and she doesn’t understand why the samples did not separate on the gel.
Present a hypothesis to explain what happened and include your rationale.
H2O
4. Finally, Emily and Carlos decided to try the experiment one last time. They added all the right
components to the reaction, but added 10 µl of DNA instead of 1 µl. They finished the reaction anxious
to see the results. The gel to the left depicts their results. Explain why they have lots of higher
molecular weight bands other than the band corresponding to the bar gene. (Consider the first few
cycles of PCR.)
5. What can Carlos and Emily conclude about the farmer’s crops?
Primer Design Instructions
The advent of the Polymerase Chain Reaction (PCR) brought about the ability to rapidly make
many copies of a segment of DNA. The PCR reaction depends on short pieces of DNA, called primers,
to bind to the denatured DNA strands and act as a template for replication. Primers are usually 17-24
nucleotides in length and must be specific to the target DNA. Listed below are some rules and helpful
tools that scientists use in designing primers. Finally, there are instructions on how to perform a
nucleotide BLAST to check the specificity of each primer. Read through the information and then use
these instructions to complete the Primer Design Exercise.
Rules for primer sequence design (adapted from Sambrook and Russell, 20011)
1. To increase specificity, primers should range from 17-28 nucleotides in length and the forward
and reverse primers should not differ by more than 3 base pairs in length from each other. If you
consider that there is a ¼ (4-1) probability of finding an A, T, C, or G in any given DNA
sequence then there is a 1/16 or 4-2 chance of finding any two nucleotide sequence such as AC.
Therefore, a specific 16 base pair sequence will statistically occur once in every 416 or
approximately 4 billion bases. Thus complementary binding of a sequence that is greater than 16
base pairs is an extremely sequence-specific process.
2. The base composition should have 40-60% (G+C) content. GC content is used to determine the
annealing temperature of the reaction. A GC content of 40-60% will ensure that the melting
temperature is above 50ºC.
3. Melting temperatures (Tm) between 52-62º C are preferred and it is best that the Tm, of the two
primers, is within 5º. Melting temperature indicates the stability of the double helix. Tm above
65ºC may form secondary annealing structures and should therefore be avoided.
4. The 3’-ends of primers should not be complementary to any other part of the other primer,
otherwise the ends will pair and create a primer dimer preferentially to any other product. If
primer dimers are formed early in the PCR, they can reduce the amplification of the target DNA
by competing for the DNA polymerase, nucleotides, and primers.
i.e. 5’-ACGTCCAAGAGGAAGCG-3’
3’-ACTTACGACTTTCGAATGTAA-5’
5. Primer self-complementarity should be avoided so that secondary structures are not formed or
are very weak. The example below shows how the underlined portions of the primer could pair
with another primer molecule.
i.e. 5’-AGTCCTAGTCCGAATGTTCTGAC
Calculating Melting Temperatures of primers and target DNA
(adapted from Sambrook and Russell, 20011)
1. “The Wallace Rule”
Tm (in ºC) = 2(A+T) + 4(C+G)
(A+T) = sum of A and T residues in the primer
(C+G) = sum of C and G residues in the primer
1
Sambrook, S. and Russell, D. W. 2001. Molecular Cloning: A Laboratory Manual. New York: Cold Spring Harbor
Laboratory Press.
2. DNA calculator
This website will allow you to fill in your primer sequence to determine the length, Tm, and
molecular weight for your primers and if there will be any secondary structures or possibilities of
primer dimers.
http://www.sigma-genosys.com/calc/DNACalc.asp
Determining the uniqueness of the primer sequence:
Specificity to the target gene is one of the most important properties of a primer. One way to
determine the uniqueness of the primer sequence is to compare the primer to all other sequence data
using a bioinformatics tool that is a Basic Local Alignment Search Tool, otherwise known as BLAST.
The BLAST tool is maintained by the National Center for Biotechnology Information (NCBI) and can
be found at the following link: www.ncbi.nlm.nih.gov/BLAST/ . There are many types of BLASTs, but
we will only be dealing with the nucleotide BLAST (blastn) to determine the specificity of the primers.
1. Go to the above website. Under the heading “Basic BLAST” click on the link titled “nucleotide
BLAST”.
2. Enter the query sequence by typing the primer sequence into the text box.
3. In the “Choose Search Set” box select “nucleotide collection (nr/nt)” from the Database
category.
4. Next type in the organism of interest, in this case we are looking for Bacteria (P. putida) or
Viruses (Cauliflower Mosaic Virus).
5. In the next box, “Program Selection”, select “blastn” as the type of algorithm.
6. Click on the blue BLAST Icon near the bottom of the page.
7. A new page will appear entitled, “Job Title”. This page will update until the results are available.
8. The first figure on the results page provides an overview of the database sequences that are
aligned to the query sequence, which is your primer sequence in this case. Following the figure is
a list of sequences that are significantly similar to the query sequence. Each matched sequence
contains a link to view the entire sequence, the name of the sequence, a score and an E value.
The Expectation value (E) is a number that describes the number of matches a particular
sequence would get by random chance. The lower the E value, the less likely the match would
happen by chance and thus making the similarity of the query sequence to another sequence
more significant.
When working with short sequences, such as primers, the best way to determine how well
the sequences align is to look at the alignment and the length of homology between the primer
sequence and the hits from the genome database. As long as there are not any matches in the
species you are working in, the primers should amplify only your gene of interest.
9. Scroll down and see how the base pairs align with the sequence matches of the same species. If
more than 5 matches are found, the primer is not specific enough.
After designing the primers and checking the quality, the primer sequence is sent to a DNA synthesis
library such as Sigma-Genosys or Integrated DNA Technologies. Primers are synthesized, desiccated,
and returned to you. Once you have received the primers, you need to re-hydrate the primers in sterile
water or Tris- EDTA buffer.
Primer Design Exercise
Currently Monsanto owns the patent on glyphosate, which is commonly known as Roundup®. It is the
most popular herbicide used today because it kills a broad spectrum of weeds and is easily broken down
into non-toxic compounds. The catch is that Monsanto also owns the patent on the gene that confers
resistance to glyphosate, which they have transformed into several crops such as corn and soybean to
make them “Round-up Ready”, or resistant to glyphosate. Many researchers are trying to find novel
genes that will also confer resistance to glyphosate for both evolutionary and economic reasons.
Recently, a Chinese group found a bacterium, Pseudomonas putida strain 4G-1, which is naturally
resistant to glyphosate2. They have cloned the novel gene, aroA, that is significantly different in
sequence from the previous AroA gene, and are hopeful that it will be another source of glyphosate
resistance.
The AroA gene encodes the enzyme 3-phosphoshikimate 1-carboxyvinyltransferase, which plays a key
role in the biosynthesis of aromatic amino acids. Glyphosate works by disrupting this enzyme and thus
the biosynthesis of aromatic amino acids. Resistance is found by mutating the AroA gene such that
glyphosate cannot bind to the resulting protein.
You have just been hired to select strains of Pseudomonas putida with the new aroA gene to provide a
new glyphosate resistant cultivar. Your first challenge will be to create primer pairs (forward and
reverse) that will amplify a portion of the aroA gene that contains the underlined region (see sequence
below).
1. Given the sequence on the following page, choose forward and reverse primers that will amplify the
underlined portion of the aroA gene.
a. Underline the primer sequence on the following page. Then write out your primers below and indicate
the 5’ and 3’ ends. Remember that the 3’ or reverse primer is the reverse complement of the template
(think about which direction DNA extends).
b. What is the size of your target DNA? (Note: each line contains 70 nucleotide bases)
2
Sun, Y. et al. 2005. Novel AroA with high tolerance to glyphosate, encoded by a gene of Pseudomonas putida 4G-1 isolated
from an extremely polluted environment in China. Applied and Environmental Microbiology. 71 (8): 4771-4776
>gi|51587624|emb|AJ812018.1| Pseudomonas putida aroA gene for 3-phosphoshikimate 1carboxyvinyltransferase
5’-GATCATAAAACATGCTTGTATAAAGGATGCTGCCATGTTCCGTGAACTGGAAGCGAACAATCTTGCGGTA
TATCAGAAAAAGCCAAAGCTGATTGCAGTGCTTCTTCAGCGTAATGCTCAGTTAAAAGCGAAGGTTGTTC
AGGAGGATGAGTTCGAAAAGTCGGTAAGGCGTTTGTTGAACTTTGGTCATACATTGGGGCATGCCATCGA
AAATGAATATGCGTTGATGCATGGCCATGCGGTTGCTATAGGAATGACATACGCGTGTCATATTTCTGAG
CAATTGTCTGGATTCAAACAAACAAATCGCGTGGTAGAAGTGTTGGAACAATATGGGTTACCGACTTATA
TGGCATTCGATAGGGAAAAGGCTTTTAATCTGTTGAAAATGGACAAGAAGCGTGAAAAAAAGGAAATGAA
CTATGTGTTGCTGGAAAAAGTAGGGAAGGGAGTGGTGAAGAGTATTCCACTGGTTCAATTAGAAAAAATC
ATTCAAGCATTACCAAAGTGAAAGTAACAATACAGCCCGGAGATCTGACTGGAATTATCCAGTCACCCGC
TTCAAAAAGTTCGATGCAGCGAGCTTGTGCTGCTGCACTGGTTGCAAAAGGAATAAGTGAGATCATTAAT
CCCGGTCATAGCAATGATGATAAAGCTGCCAGGGATATTGTAAGCCGGCTTGGTGCCAGGCTTGAAGATC
AGCCTGATGGTTCTTTGCAGATAACAAGTGAAGGCGTAAAACCTGTCGCTCCTTTTATTGACTGCGGTGA
ATCTGGTTTAAGTATCCGGATGTTTACTCCGATTGTTGCGTTGAGTAAAGAAGAGGTGACGATCAAAGGA
TCTGGAAGCCTTGTTACAAGACCAATGGATTTCTTTGATGAAATTCTTCCGCATCTCGGTGTAAAAGTTA
AATCTAACCAGGGTAAATTGCCTCTCGTTATACAGGGGCCATTGAAACCAGCAGACGTTACGGTTGATGG
GTCCTTAAGCTCTCAGTTCCTTACAGGTTTGTTGCTTGCATATGCGGCCGCAGATGCAAGCGATGTTGCG
ATAAAAGTAACGAATCTCAAAAGCCGTCCGTATATCGATCTTACACTGGATGTGATGAAGCGGTTTGGTT
TGAAGACTCCCGAGAATCGAAACTATGAAGAGTTTTATTTCAAAGCCGGGAATGTATATGATGAAACGAA
AATGCAACGATACACCGTAGAAGGCGACTGGAGCGGTGGTGCTTTTTTACTGGTAGCGGGGGCTATTGCC
GGGCCGATCACGGTAAGAGGTTTGGATATAGCTTCGACGCAGGCTGATAAAGCGATCGTTCAGGCTTTGA
TGAGTGCGAACGCAGGTATTGCGATTGATGCAAAAGAGATCAAACTTCATCCTGCTGATCTCAATGCATT
TGAATTTGATGCTACTGATTGCCCGGATCTTTTTCCGCCATTGGTTGCTTTGGCGTCTTATTGCAAAGGA
GAAACAAAGATCAAAGGCGTAAGCAGGCTGGCGCATAAAGAAAGTGACAGAGGATTGACGCTGCAGGACG
AGTTCGGGAAAATGGGTGTTGAAATCCACCTTGAGGGAGATCTGATGCGCGTGATCGGAGGGAAAGGCGT
AAAAGGAGCTGAAGTTAGTTCAAGGCACGATCATCGCATTGCGATGGCTTGCGCGGTGGCTGCTTTAAAA
GCTGTGGGTGAAACAACCATCGAACATGCAGAAGCGGTGAATAAATCCTACCCGGATTTTTACAGCGATC
TTAAACAACTTGGCGGTGTTGTATCTTTAAACCATCAATTTAATTTCTCATGAATAGCTTCGGCCGCATC
TTCAGGGTGCATATTTTTGGCGAATCACATGGTGAATCAGTAGGCATCGTTATTGATGGTTGTCCTGCTG
GTCTGTCATTGTCCGAAGAAGATC-3’
2. For each primer you designed, use the website and the guidelines on the instruction sheet to determine
whether they meet the basic primer requirements. Record the Tm, length, molecular weight, and
possibility of secondary structures or primer dimers and use the statistics to qualify your decision to use
or not use the primers for a PCR reaction.
3. To determine the specificity of your primer pair to the aroA sequence, run a nucleotide BLAST by
following the directions on the instruction page.
a. What does the E-value indicate? What is another way to determine homology between
two sequences?
b. Write down the organism and E-value score from the two highest matches
for each primer sequence. Did you get back the sequence you put in?
c. How many nucleotides aligned between your sequences and the first
match for each?
4. Now that you have some experience designing primers and an idea about what makes a good primer,
check the CamV35S primers used to determine the presence of a transgene in your food products.
Sense (forward) primer: 5’GCT CCT ACA AAT GCC ATC A3’
Antisense (reverse) primer: 5’GAT AGT GGG ATT GTG GGT CA3’
a. Provide a short summary about the primer pairs including characteristics such as melting temperature,
secondary structures, and specificity using this worksheet as a guide.
b. Do you think these primers are a good choice to amplify the 35S promoter from your food product?
Consider the specificity of your primer pairs to transgenic ingredients as well as other ingredients that
may be in your products.
DA Gel Analysis Exercise: Report on Locus 8
You are a member of a team that is in charge of investigating a crime scene. Your task is to examine
one of the twelve loci that will be used to determine the source of an unknown hair at the scene that did
not belong to the victim as determined by hair color. You used PCR to amplify your assigned allele
(Locus #8: expected size of fragment = 1400 bp) from hair samples of the victim, nine potential suspects
and the unknown hair. You will determine whether each sample has this particular allele (presence or
absence is the polymorphism*). The results are below. The positive and negative controls are DNA
hair standards that are commonly used in the lab to verify presence and absence of this 1400 bp DNA
fragment, respectively. In addition there is a water control in which no DNA was used in the PCR
reaction. You must now analyze your results and submit a report to your boss. The main questions of
your experiment are:
1) What are the controls of this experiment?
2) What are the approximate sizes of the products of your PCR reactions? What is the importance of the
two bands based on their sizes?
3) How were the positive and negative controls important to your conclusions? What can you conclude
about the primers you used for these PCR reactions?
4) What follow-up action should be taken before submitting your report? (i.e. Is there a follow up
experiment necessary? If so, what should be retested? Remember the key components of good
experimental design.)
5) Which suspects can you eliminate from the suspect pool? Why?
6) Why do you think it is necessary to examine 12 different loci?
*Note that there are many ways to do genetic fingerprinting analysis. Whereas this case relies on the presence or absence of a PCR
fragment of an allele, other more common techniques, including RFLPs (restriction fragment length polymorphisms) or VNTRs (variable
number tandem repeats), rely on more specific polymorphisms or differences in DNA sequence between individuals. For more information,
the Dolan DNA Learning Center has a great website with animations that might be of interest: http://dnalc.bii.astar.edu.sg/resources/aboutdnafingerprinting.html
GMO Presentation Scenario: Organic Consumers Association vs. Clif Bar Inc®.
Clif Bar Inc®. is being sued for false advertisement for claiming their soy bar is free of Genetically
Modified Organisms (GMOs). The Organic Consumers Association is claiming that at least one
ingredient used in production was bought from a farmer not certified for organic production. Both the
prosecution and defense have hired multiple private labs to test the soy bar and other products for the
presence of GMOs. The learning objective of this project is to be able to analyze the data generated
from the GMO lab, draw appropriate conclusions that are relevant to the case and present the scientific
data to your peers as it relates to one of the following two platforms.
Platforms:
The Prosecution: The Organic Consumers Association is suing Clif Bar Inc®. for false advertisement for
labeling their product as organic and free of GMOs. They want to demonstrate that the lab tests
performed verify this with certainty.
The Defense: Clif Bar Inc®. claims that they produce a product free from GMOs. They have the task of
proving that their data demonstrate this fact and that the prosecution’s data is unreliable.
The Assignment:
Your research group is employed by one of the private labs that was hired to test for the presence of
GMOs in the Clif Bar soy product. Your group carried out the research and now has been called to
work with either the prosecution or defense as expert witnesses. During the trial, you are to present your
analysis of the scientific data set from the entire lab in a way that supports the position of your assigned
counsel team (prosecution or defense).
Several groups will coordinate to mount the defense for Clif Bar Inc®. while the other groups prepare for
the prosecution. As several groups will be representing each side, take a few minutes to coordinate your
arguments so that the same data is not presented. Within your group, work together to create a concise 5
minute representation of the scientific data (graph, chart, gel, etc.) your group collected. Each group for
the prosecution will present their case and then the defense will have 5-10 minutes to cross examine the
prosecution as a whole. Each group for the defense will have 5 minutes to present and then the
prosecution will have 5-10 minutes to cross examine. At the end of the trial you will be required to
submit as evidence a hard copy representation of your data with appropriate figure legends and the cross
examination question(s) that your team asked.
Listed below are some roles that a group might choose to establish to give you an idea of how to
coordinate your team: Counsel (1-2 people): Ask questions of the expert witnesses to help them present
the most salient points of the data they are representing. Expert Witnesses (1-2 people) Answer
questions asked by the lead counsel and present the data (1-2 pieces of evidence) with clarity. Entire
Team: Work together to coordinate a strong case that best represents the data in a concise and
convincing manner. Prepare the presentation (poster, Powerpoint, etc). Prepare the hard copy to be
submitted as evidence. Anticipate actions of opposing counsel to prepare for cross-examination. Ask
questions and answer questions of the opposing team during cross examination. Each group must ask at
least one question during cross examination.
Remember you only have five minutes to present the scientific data your group gathered so be
concise (1-2 figures) and make your point clearly. Feel free to use any practical presentation tools
(poster board, Powerpoint). You will be graded as a group on your figures with legends (data
representation), visual and oral presentation of your data, ability to ask and answer questions when
cross-examined, and participation during pre-trial and trial activities. Every member of the group should
have a chance to speak either during the presentation or during cross-examination. Refer to the GEA
forms and rubric specific for this presentation. Feel free to be creative in how you set up your team and
present your case but focus on the scientific evidence rather than legal evidence. Have fun!
PCR Exercise Key
Carlos and Emily, two novice scientists, were asked to test a local farmer’s
crops for the presence of the bar gene, which confers resistance to Roundup™,
a commercially available herbicide that the farmer would like to use in her
field. However they are having trouble with the lab procedures. Please help them figure out why
their experiments do not work.
1. First, Carlos isolated genomic DNA from several crops. He decided to separate the total
genomic DNA out on a gel after restriction enzyme digest to see which crops contained the bar
gene. Observe the gel to the right and explain to Carlos why his gel is inconclusive. Why is PCR
a more appropriate technique for testing for the presence of the bar gene? By observing genomic DA,
one cannot determine the presence or absence of a specific gene. PCR allows for the amplification of a gene, if present,
such that it can be detected on a gel.
2. Now that they have decided to use PCR to test for the presence of the resistance gene, Emily has
designed primers to amplify a 300-bp fragment of the bar gene and is ready to set up the reactions.
However, she does not have a protocol for PCR. Please list the reagents Emily should use in her reactions
(amounts not necessary) and explain the function of each reagent. Why are two primers necessary for
amplification?
Genomic DA – used as a template for DA replication
Buffer – create appropriate reaction conditions such as salt concentration and pH
dTPs – individual nucleotides fill in the gaps of the newly forming strand of DA
Taq polymerase – the heat stable enzyme acts at the primer annealing site to carry out the replication process
Primers, forward and reverse – compliment and anneal to a specific site on the genomic DA and directs the polymerase to this
site so that replication can begin. Both primers are needed to amplify one specific band of DA of a predicted size. If only one
primer is present, it would anneal and replication would continue in one direction until the temperature changed. This would
make products of varying sizes. The second primer anneals to these products of varying size and replication continues in the
opposite direction until the polymerase falls off the template (at the site of the first primer annealing). This makes a product of one
specific size you can predict.
3. When they were ready to run the PCR samples on an agarose gel, Carlos loaded the gel, added water to the gel
tank and connected the electricity. Afterwards, Emily examined Carlos’s gel on a UV light box. Below is the gel
she saw and she doesn’t understand why the samples did not separate on the gel. Present a hypothesis to explain
what happened and include your rationale.
Hypothesis: The gel did not run because water was added to the gel tank instead of
running buffer. The buffer is essential because it contains salt, which allows for the
conduction of a current across the gel. The current creates the charge differential
that causes the negatively charged DA to move toward the positive pole of the gel
tank. This is what causes the separation of DA.
H 2O
4. Finally, Emily and Carlos decided to try the
experiment one last time. They added all the right
components to the reaction, but added 10 µl of DNA
instead of 1 µl. They finished the reaction anxious to
see the results. The gel to the left depicts their results. Explain why they have lots of higher
molecular weight bands other than the band corresponding to the bar gene. (Consider the first
few cycles of PCR.)
The higher molecular weight bands are likely due to too much template DA in the reaction. During the first
several cycles of PCR, the primers anneal to their respective strands and replication continues until the
temperature changes and the polymerase falls off. Therefore, longer intermediate strands are formed first.
These are larger than the predicted size. As you increase the amount of template, more intermediate strands are formed initially
and if enough is present these can be seen on the gel.
5. What can Carlos and Emily conclude about their garden vegetables?
All their vegetables contain the bar gene as determined by the presence of a band corresponding to the bar fragment in the positive
control. All the vegetables should be resistant to Roundup.
Primer Design Exercise Key
Possible Primer Pairs for AroA
TGGCATTCGATAGGGAAAAGGCTTTTAATCTGTTGAAAATGGACAAGAAGCGTGAAAAAAAGGAAATGAA
CTATGTGTTGCTGGAAAAAGTAGGGAAGGGAGTGGTGAAGAGTATTCCACTGGTTCAATTAGAAAAAATC
ATTCAAGCATTACCAAAGTGAAAGTAACAATACAGCCCGGAGATCTGACTGGAATTATCCAGTCACCCGC
TTCAAAAAGTTCGATGCAGCGAGCTTGTGCTGCTGCACTGGTTGCAAAAGGAATAAGTGAGATCATTAAT
CCCGGTCATAGCAATGATGATAAAGCTGCCAGGGATATTGTAAGCCGGCTTGGTGCCAGGCTTGAAGATC
AGCCTGATGGTTCTTTGCAGATAACAAGTGAAGGCGTAAAACCTGTCGCTCCTTTTATTGACTGCGGTGA
ATCTGGTTTAAGTATCCGGATGTTTACTCCGATTGTTGCGTTGAGTAAAGAAGAGGTGACGATCAAAGGA
Forward: 5’-TAGGGAAGGGAGTGGTGAAGAG-3’
22 base pairs
~55% G/C content
Tm = 65.41ºC
Secondary Structure: None
Primer Dimers: No
No significant matches to other organisms found from the BLAST
Reverse: 5’-ACGCCTTCACTTGTTATCTGC-3’
21 base pairs
~47% G/C content
Tm= 63.05ºC
Secondary Structure: None
Primer Dimer: No
No significant matches to other organisms found from the BLAST
The primers are underlined in the sequence above and will amplify a 297 base pair fragment. From the
statistics listed above these are suitable primers to amplify this portion of the aroA gene.
35S Primer Statistics
Sense (forward) primer: 5’GCT CCT ACA AAT GCC ATC A3’
Length: 19 base pairs
Tm: 61.23C
G/C content: 47.37%
Secondary Structure: None
Primer Dimer: No
No significant matches to other organisms found from the BLAST
Antisense (reverse) primer: 5’GAT AGT GGG ATT GTG GGT CA3’
Length: 20 base pairs
Tm: 62.22C
G/C content: 50%
Secondary Structure: None
Primer Dimer: No
No significant matches to other organisms found from the BLAST
DA Gel Analysis Exercise: Report on Locus 8
You are a member of a team that is in charge of investigating a crime scene. Your task is to examine
one of the twelve loci that will be used to determine the source of an unknown hair at the scene that did
not belong to the victim as determined by hair color. You used PCR to amplify your assigned allele
(Locus #8: expected size of fragment = 1400 bp) from hair samples of the victim, nine potential suspects
and the unknown hair. You will determine whether each sample has this particular allele (presence or
absence is the polymorphism*). The results are below. The positive and negative controls are DNA
hair standards that are commonly used in the lab to verify presence and absence of this 1400 bp DNA
fragment, respectively. In addition there is a water control in which no DNA was used in the PCR
reaction. You must now analyze your results and submit a report to your boss. The main questions of
your experiment are:
1) What are the controls of this experiment?
Positive control: + DA hair standard; egative control: - DA hair standard; egative control: water in place of
DA
2) What are the approximate sizes of the products of your PCR reactions? What is the importance of the
two bands based on their sizes?
Locus 8 fragment = 1400 bp (as predicted)
Unknown band = 600 bp
We can disregard the 600 bp fragment when determining whether
the suspect contains the locus 8 fragment due to its smaller size
and because this fragment is present in the negative control.
However it is useful in this case because it can be used as an
internal positive control (i.e. can tell us that DA is present in the
sample and the reaction worked).
3) How were the positive and negative controls important to your conclusions? What can you conclude
about the primers you used for these PCR reactions?
The positive control indicates that the reactions worked and can be used for size comparison. The negative control indicates any
cross reacting bands or unpredicted non-specific binding. The water control verifies all bands are due to the presence of DA and
not contamination in the reagents.
The primers are not 100% specific to locus 8. A cross-reacting or non-specific band is present at approximately 600bp.
4) What follow-up action should be taken before submitting your report? (i.e. Is there a follow up
experiment necessary? If so, what should be retested? Remember the key components of good
experimental design.)
The reaction for suspect #6 should be repeated as well as all three controls. #6 lacks both the 1400bp band and the 600bp band
that is present even in the negative control. This is likely a cross-reacting or non-specific product but absence of this band indicates
that the reaction may not have worked. Therefore, no conclusion can be made about suspect #6. Repeating this reaction with all
the controls would be appropriate.
5) Which suspects can you eliminate from the suspect pool? Why?
Suspects #5 and #9 can be eliminated because they lack the 1400bp fragment of locus 8 that is present in the unknown hair sample
and the positive control.
6) Why do you think it is necessary to examine 12 different loci?
By examining only one locus we could eliminate a few suspects. As you increase the number of loci, you can not only eliminate
more suspects but also increase the probability that the particular combination of reactions at many loci is unique to one
individual.
*Note that there are many ways to do genetic fingerprinting analysis. Whereas this case relies on the presence or absence of a PCR
fragment of an allele, other more common techniques, including RFLPs (restriction fragment length polymorphisms) or VNTRs (variable
number tandem repeats), rely on more specific polymorphisms or differences in DNA sequence between individuals. For more information,
the Dolan DNA Learning Center has a great website with animations that might be of interest: http://dnalc.bii.astar.edu.sg/resources/aboutdnafingerprinting.html
GMO Presentation Rubric
Data
Representation
BIG PICTURE:
Was accurate data
represented in a
concise and
convincing way
that supported the
group’s position?
Presentation of
Data - visual
and oral BIG
PICTURE: Was
the visual
representation
clear and
appealing? Did the
group present the
most salient facts
clearly and
concisely?
CrossExamination –
answering and
asking BIG
PICTURE: Did the
group defend their
position during
cross? Did the
opposing groups
ask relevant
questions that
focused on
problems with the
0=
inadequate
(C, D, or F)
1= adequate
(BC)
2=good
(B)
3=very good
(AB)
4=excellent
(A)
The group
presents little or
no relevant data.
OR The
conclusions do
not support the
group’s position.
The data
analysis and/or
conclusions are
inaccurate and
but are used in
an effort to
support the
group’s position.
OR pertinent
data is omitted.
All pertinent
and accurate
data, including
controls were
present, but
could have
been presented
more clearly.
For example,
some irrelevant
information
present.
The group
presented a
sophisticated
analysis of all
pertinent and
accurate data,
including
controls that led
to appropriate
conclusions for
their position.
Information is
presented in
such a way that
the point cannot
be determined.
OR The team
does not submit
data with
legends as
evidence.
Counsel did not
ask relevant
questions or the
witnesses did not
answer clearly or
answered
incorrectly
making their
argument
unconvincing.
Evidence was
submitted
without legends
or appropriate
labels.
Some pertinent
and accurate
data was
present, but the
group could
have
represented the
data differently
to make a
stronger
argument. OR
appropriate
controls were
not included.
Counsel and
witnesses
worked
together to
present data,
but jumped to
conclusions
without
explanation.
Evidence was
submitted with
legends and
appropriate
labels but was
not clear or
appealing.
Counsel asked
relevant
questions that
allowed the
expert witnesses
to fully explain
the data that
convinced the
judge and jury of
the group’s
position.
Evidence
submitted (data)
is clear and
visually
appealing with
appropriate
legends.
The group asks
no questions
during crossexamination.
OR The group
does not answer
questions at all.
The group asked
irrelevant
questions or
minor questions
that did not
question the
validity of the
other team’s
argument. The
group answered
incorrectly.
Counsel asked
good questions
but left out a
major point of
the case.
Expert witness’
answer has
minor
omissions or
relatively small
problems such
as omitting
axes or key
details of the
evidence.
Evidence
submitted has
brief legend or
labels aren’t
clear.
The group
asked relevant
questions, but
did not
highlight one
of the potential
weaknesses in
the methods,
data analysis,
or conclusions.
The group was
able to answer
most questions
clearly.
The group
asked some
relevant
questions but
missed
multiple
weaknesses in
data analysis.
The group
answered
questions but
were not clear
and/or concise.
The group asked
relevant
questions of the
opposing team
that focused on
potential
weaknesses in
the methods,
data analysis or
conclusions.
The group was
able to answer
the questions
factually and
methods, results
and/or
conclusions?
Participation
BIG PICTURE:
Did all members of
the group
contribute
effectively and
equally to the effort
of the entire
project?
The team was
disrespectful to
each other and
did not work
together to
complete the
project.
The group did
not work
together as a
cohesive unit.
OR Members
did not
contribute
equally to all
parts of the
project.
All members
contributed to
data collection
and analysis
but did not
work as a team
to present a
cohesive
argument or
vice versa.
All members
contributed
equally to data
collection and
analysis but
could have
worked better
as a team.
attempted to
defend their
position in the
case.
All members of
the group
contributed
equally to data
collection and
analysis. All
members
contributed
equally to the
group’s effort to
support their
platform.
Rubric for PCR and DA Gel Materials
Criteria
PCR Cycle Sketch
Does the student
understand the importance
of each temperature
change of one cycle of
PCR? (PLG1, OLG1)
Does the student
understand how primers
initiate DNA replication?
(PLG1)
Does the student
understand how the first
extension occurs and how
that leads to target DNA in
later cycles? (PLG1)
Does the student
understand the idea of
amplification of target
DNA? (PLG1, OLG1)
PCR Exercise
Can the student state why
PCR is an appropriate
technique for
amplification? (OLG1)
Level 3
Level 2
Student can identify
temperature and effect
of temperature for
each step (including:
denature, anneal and
extend).
Student can properly
identify the
directionality of
primers and the
extension steps.
Student shows proper
intermediates and
indicates final
products.
Student can identify
the temperature for
each cycle, but cannot
explain the effect of
the temperature
correctly.
Student can identify
the primer annealing
sites, but does not
indicate the direction.
Student can correctly
identify the ratio of
target to intermediate
and predict the ratio
after 20 cycles and
how the DNA would
appear on the gel.
The student can state
why PCR is an
appropriate technique
for amplification of a
specific DNA
sequence.
Can the student identify
The student can
problems with components identify problems with
of a PCR reaction and
components of a
technically explain
reaction, and can
unexpected higher
technically explain
molecular weight bands.
unexpected higher
(PLG2, OLG1, OLG2)
molecular weight
bands.
Does the student
The student can
understand how DNA
identify the problem
migrates in an agarose gel? with the buffer and
(PLG3, OLG1)
can identify fragments
that are larger than
Student shows
intermediate and final
products but either the
intermediate or final
products are incorrect.
Student can identify
the proper ratio in the
first few cycles, but
cannot extend to 20
cycles OR cannot
predict how the gel
would look.
Level 1
Student does not
indicate temperature
or effect of
temperature.
Student does not
identify primer
annealing sites.
Student shows
intermediate and final
products but both
products are incorrect.
Student cannot
differentiate between
target and
intermediate DNA.
The student
The student does not
understands
understand the idea of
amplification but not
amplification.
the specificity of PCR.
The student can
identify the
components but is not
able to reason through
higher level problems
such as explaining
higher molecular
weight bands.
The student
understands DNA
migration in light of
size OR charge but not
both.
The student can
identify problems but
cannot use PCR
theory to explain the
problems.
The student does not
understand theory of
DNA migration based
on size and charge.
expected.
Primer Design Exercise
Does the student
understand the keys to a
quality primer? (PLG6,
OLG1)
Does the student
understand the proper
orientation/design of the
reverse primer? (PLG1,
OLG1)
Can the student use
bioinformatics tools
including BLAST searches
to check primer quality?
(OLG1, OLG3, PLG6)
Gel Analysis Exercise
Can the student properly
analyze the results of the
gel to identify crossreacting bands and make
appropriate conclusions?
(OLG2, PLG2, PLG4,
PLG5)
Can the student identify
and design the next
important experiment to
test? (OLG1, OLG2,
PLG2, PLG5)
Does the student
understand how DNA
migrates in a gel and how
to use the ladder to
determine fragments sizes?
(OLG1, PLG3, PLG4,)
Does the student
understand the importance
of positive and negative
controls? (OLG2, PLG5)
The primers are
designed to meet the
criteria and the PCR
reaction should work
in theory.
The 3’ primer is the
reverse complement of
the sequence and
should work in the
reaction.
The student has
developed primers
using bioinformatics
that meets the criteria
and the student clearly
understands
specificity of the
primer.
The reaction might
work, but there are
potential problems
with primer design or
structure.
The primer is the
reverse or the
complement but not
both and therefore the
reaction will not work.
The student can
identify a problem
with the primers using
bioinformatics but
cannot analyze the
bioinformatics results
correctly or
completely.
The reaction would
not work due to poor
primer design.
The student eliminated
all appropriate
suspects (and no
additional ones).
The student eliminated
all appropriate
suspects and
additional ones such
as suspect #6.
The student did not
analyze the results
properly and potential
suspects were
released.
The student knows the
importance of
retesting suspect #6
with the appropriate
controls.
The student can
identify the correctly
sized fragment and
determine the sizes of
all fragments.
The student knows
that suspect #6 should
be retested but does
not include
appropriate controls.
The student can
identify the sizes of
the band, but the sizes
don’t influence their
decision.
The student does not
know to retest suspect
#6.
The student eliminated
the appropriate
suspects and stated
how +/- controls
influenced their
decision including the
water control.
The student did not
eliminate the
appropriate suspects
OR did not state how
+/- controls influenced
their decision.
The students were not
able to eliminate
appropriate suspects
and state how +/controls influenced
their decision.
The primer is neither
the complement nor
the reverse and
therefore the reaction
will not work.
The student does not
use bioinformatics to
check the primers or
does not understand
how the results
elucidate specificity of
the primers to the
target DNA.
The student cannot
identify either band
OR can identify only
one band.
Lab # ____ Evaluator_______________________ GMO Presentation and Paper Assessment
Group
# or
Paper
ID
Did the group/student use topics covered in the
worksheets to validate/refute results? (i.e. steps
of PCR, theory of PCR/gel electrophoresis in
identifying and explaining problem areas,
appropriate use of controls)
Did the group/student analyze their PCR/gel
electrophoresis data correctly?
Were they able to draw the appropriate
conclusions about the data? i.e. for the
presentations, did the analysis of data support
their position in the case?
Did the group/student use a logical argument
that followed scientific thought to progress
through the presentation of results?
If yes, how well was this done?
1. poorly; barely mentioned it
2. okay; explained it somewhat but was
missing several key details
3. well; explanation is only missing a few
details
4. excellently; clear, logical & complete
explanation
If yes, how well was this done?
1. poorly; analyzed only the most obvious
parts of the data
2. okay; analyzed most of the data, but left
out key details such as controls
3. well; analysis is only missing a few
details
4. excellently; clear, logical & complete
analysis
If yes, how well was this done?
1. poorly; drew unrealistic conclusions
2. okay; drew appropriate conclusions, but
did not integrate the conclusions with their
hypothesis/biological rationale
3. well; drew appropriate conclusions, but
extrapolated beyond the scope of the
experiment
4. excellently; drew clear and logical
conclusions that tied to the hypothesis and
rationale
If yes, how well was this done?
1. poorly; tried to make argument, but could
not follow
2. okay; somewhat logical but still hard to
follow
3. well; logical explanation, but missing
some important aspect of scientific thought
4. excellently; clear, logical & complete
explanation that followed scientific thought
Y / N
Y / N
1
2
3
4
1
2
Y / N
1
2
3
2
4
1
2
3
2
4
1
2
1
2
4
1
4
1
4
1
4
1
2
1
2
4
1
2
4
1
3
2
4
1
2
4
1
2
3
4
3
4
3
4
3
4
Y / N
3
4
1
2
Y / N
3
4
Y / N
Y / N
3
3
Y / N
3
2
Y / N
3
4
Y / N
3
2
3
2
Y / N
3
Y / N
Y / N
3
2
Y / N
1
4
Y / N
Y / N
1
3
Y / N
Y / N
1
Y / N
Y / N
3
4
1
2
Pre- Survey
The following questions are designed to determine your knowledge of DNA, PCR, gel
electrophoresis, and genetically modified organisms prior to the GMO lab. Please answer
honestly. These will be evaluated only for completeness.
1. Rate your ability to accomplish the following tasks:
1 = I am not confident in my ability to complete this task.
2 = I am somewhat confident in my ability to complete this task.
3 = I am very confident in my ability to complete this task.
1.
2.
3.
4.
5.
Read and understand scientific literature.
Explain the steps involved in scientific techniques we use in Biocore 304.
Interpret data from techniques and draw logical conclusions.
Troubleshoot problems during scientific experiments.
Use resources (books, internet, databases, colleagues/peers) to gather information about
new scientific techniques and concepts.
6. Work effectively as a member of a group.
7. Presenting data orally to a group of peers.
8. Presenting data in written form.
2. Rate your understanding of these topics:
1= I have never heard of this topic.
2= I have heard of this topic, but I am unsure what it is or how it relates to the GMO lab.
3= I understand this topic, but I am unsure how it relates to the GMO lab.
4= I understand this topic and how it applies to the GMO lab.
5= I understand this topic, how it applies to the GMO lab, and I am able to apply knowledge of
this topic to other contexts. *If you chose #5, please explain how you would apply your
knowledge to other contexts.
1.
2.
3.
4.
5.
6.
7.
8.
DNA structure (nucleotide bases and base pairing, bonds, double helix structure)
DNA directionality (5’3’)
The steps in the polymerase chain reaction (PCR)
Sequence alignment programs such as BLAST
Gel electrophoresis
DNA transformation
DNA primers
Genetically Modified Organisms
3. Choose the statement that best reflects your confidence in using online Bioinformatics tools
(e.g., BLAST, Jmol imaging, NCBI database searches).
1= I have only used these during the enzyme library lab.
2= I do not have a lot of experience with Bioinformatics tools, but can follow directions to learn
a new tool.
3= I understand Bioinformatics tools well and am comfortable learning new tools.
4. Choose the statement that best reflects your understanding of experimental design.
1= I do not know the components of experimental design or how they are used in creating an
experiment.
2= I understand the components of experimental design, but not how to use them to create an
experiment.
3= I understand the components of experimental design and I am beginning to understand how to
use them to create an experiment.
4= I understand the components of experimental design, their importance in experimental design,
and know how to use them in creating an experiment.
5.Choose the statement that best reflects your experience troubleshooting unexpected data
from an experiment.
1= I have no experience in recognizing unexpected data or suggesting ways of fixing the
problems (troubleshooting).
2= I am able to recognize unexpected data, but I am not able to troubleshoot the problem.
3= I am able to recognize unexpected data and I am able to troubleshoot the problem.
7. What is wrong with this statement? When using gel electrophoresis to separate D<A, R<A, or
proteins by size, the largest molecules migrate faster in the agarose gel in response to the
electric charge differential in the buffer.
The largest molecules will migrate slower in the agarose gel.
8. Please answer True or False to the following questions and explain your answer.
A. Positive controls, when available, are essential to scientific experiments
True. Positive controls provide confidence that the experiment was successful,
therefore validating the other results obtained in the experiment.
B. Negative controls are not necessary because they will not show any results.
False. Negative controls can provide evidence that something in the experimental
design is not correct. If the negative control is “negative” you can be confident the
experiment was performed correctly thus providing confidence for the other results
obtained.
9. What type of bonds hold the DNA double helix together?
a. Covalent bonds
b. Hydrogen bonds
c. Ionic bonds
d. Bail bonds
10. Below is a short sequence of DNA written in the 5’ to 3’ direction. Please write the
reverse complementary sequence and indicate the directionality of both strands.
5’ ATCGTAACGTCGTGAATGCCGTAC 3’
5’ GTACGGCATTCACGACGTTACGAT 3’
11. The stability of a fragment of DNA can be dependent on many factors. Please choose all
of the factors that would affect the stability of DNA.
a. Length of fragment
b. Temperature
c. GC content
d. Secondary structure
e. Please explain how the factors you chose affect DNA stability (open ended)
DNA containing a high GC content is more stable as each G-C pair is bound by 3
hydrogen bonds. Longer pieces of DNA are more stable than shorter pieces as
there are more hydrogen bonds holding the helix together in longer fragments.
DNA double helices will denature or fall apart at high temperatures thus at low
temperatures DNA is more stable. The secondary structure of DNA provides more
stability in that the fragment is further bonded together providing more structure
and strength.
12. What is unique about the Taq polymerase used in PCR?
The Taq polymerase used in PCR was found in thermal vents, therefore the
enzyme is able to withstand high temperatures. This is important in PCR as the
temperature is raised to 94 C to denature the DNA double helix prior to synthesis.
Post- Survey
The following questions are designed to determine your knowledge of DNA, PCR, gel
electrophoresis, and genetically modified organisms prior to the GMO lab. Please answer
honestly. These will be evaluated only for completeness.
1. Rate your ability to accomplish the following tasks:
1 = I am not confident in my ability to complete this task.
2 = I am somewhat confident in my ability to complete this task.
3 = I am very confident in my ability to complete this task.
9. Read and understand scientific literature.
10. Explain the steps involved in scientific techniques we use in Biocore 304.
11. Interpret data from techniques and draw logical conclusions.
12. Troubleshoot problems during scientific experiments.
13. Use resources (books, internet, databases, colleagues/peers) to gather information about
new scientific techniques and concepts.
14. Work effectively as a member of a group.
15. Presenting data orally to a group of peers.
16. Presenting data in written form.
2. Rate your understanding of these topics:
1= I have never heard of this topic.
2= I have heard of this topic, but I am unsure what it is or how it relates to the GMO lab.
3= I understand this topic, but I am unsure how it relates to the GMO lab.
4= I understand this topic and how it applies to the GMO lab.
5= I understand this topic, how it applies to the GMO lab, and I am able to apply knowledge of
this topic to other contexts. *If you chose #5, please explain how you would apply your
knowledge to other contexts.
13. DNA structure (nucleotide bases and base pairing, bonds, double helix structure)
14. DNA directionality (5’3’)
15. The steps in the polymerase chain reaction (PCR)
16. Sequence alignment programs such as BLAST
17. Gel electrophoresis
18. DNA transformation
19. DNA primers
20. Genetically Modified Organisms
3. Choose the statement that best reflects your confidence in using online Bioinformatics tools
(e.g., BLAST, Jmol imaging, NCBI database searches).
1= I have only used these during the enzyme library lab.
2= I do not have a lot of experience with Bioinformatics tools, but can follow directions to learn
a new tool.
3= I understand Bioinformatics tools well and am comfortable learning new tools.
4. Choose the statement that best reflects your understanding of experimental design.
1= I do not know the components of experimental design or how they are used in creating an
experiment.
2= I understand the components of experimental design, but not how to use them to create an
experiment.
3= I understand the components of experimental design and I am beginning to understand how to
use them to create an experiment.
4= I understand the components of experimental design, their importance in experimental design,
and know how to use them in creating an experiment.
5.Choose the statement that best reflects your experience troubleshooting unexpected data
from an experiment.
1= I have no experience in recognizing unexpected data or suggesting ways of fixing the
problems (troubleshooting).
2= I am able to recognize unexpected data, but I am not able to troubleshoot the problem.
3= I am able to recognize unexpected data and I am able to troubleshoot the problem.
7. How do you feel about the use of genetically modified organisms (GMOs) in plants for human
use?
1= GMOs should never be used
2= GMOs should not be used in most contexts, but they may be considered in extenuating
circumstances.
3= I am undecided about the use of GMOs.
4= GMOs should be used under regulation and research should be continued on GMOs.
5= GMOs should be used whenever possible
Please elaborate on your choice:
8. What aspects of the group presentations and research were influential in your decision
about GMOs?
21. Choose one answer that describes the usefulness of the following assignments:
1= The assignment did not contribute to my understanding of the technique.
2= The assignment contributed somewhat to my understanding of the technique.
3= The assignment clarified my misconception about the technique.
4= The assignment greatly contributed to my understanding of the technique.
1. Animations detailing PCR and gel electrophoresis.
2. The pre-lab question asking you to draw the first three cycles of PCR and determine
the ratio of intermediates to target copies.
3. Designing primers to amplify the aroA gene by PCR.
4. BLASTing the primers used to amplify the CaMV35S.
5. Helping Carlos and Emily determine their problems with PCR and gel
electrophoresis.
6. Analyzing a DNA gel used to “fingerprint” DNA of the victim and suspects.
7. Presenting your data in the GMO case-based scenario.
22. Do you have any additional comments about the assignments you completed during the
GMO unit?