Eukaryotes
The Eukaryotic Cell
Classwork
1. Identify two characteristics that are shared by all cells.
2. Suppose you are investigating a cell that contains a nucleus. Would you
categorize this cell as a prokaryote or eukaryote? Explain your answer.
3. Is it more efficient for cells to have a high or low surface area to volume ratio?
Explain.
4. Explain, in terms of cell function, why it is more advantageous for cells to be
small.
5. Organelles are to cells as organs are to the human body. Explain why this
analogy is true.
Homework
6. What are two differences between prokaryotic and eukaryotic cells?
7. Would you be more likely to observe a prokaryotic cell or eukaryotic cell
under the lowest magnification available on your microscope? Explain your
answer.
8. Explain, in terms of surface area to volume ratio, why cells are small.
9. Identify the four major categories of eukaryotic cells.
The Nucleus and Gene Expression
Classwork
10. Explain how the meaning of the terms prokaryote and eukaryote help explain
the structure of the cell.
11. Why is it important that the nucleus of a cell contains nuclear pores?
12. How is it possible that even though all the cells of a multicellular organism
contain the same DNA, there are many different types of cells that differ in
structure and function?
13. How are chromosomes related to chromatin?
14. How does the ‘packing’ of DNA impact the process of gene expression in
cells?
15. How does the presence of transcription factors influence the process of gene
expression?
16. How is the presence of transcription factors related to external stimuli in an
environment?
17. Explain the observable differences that would exist between a molecule of
pre-mRNA and a finished molecule of mRNA?
18. In what way does the splicing of a molecule of mRNA alter the contents of the
molecule? Be sure to use appropriate terminology.
19. How does alternative splicing affect the ability of a molecule of mRNA to
produce multiple proteins?
20. Explain how nuclear pores are like the ‘gatekeepers’ of the nuclear
membrane.
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
21. How does the length of a poly-A tail on mRNA impact the amount of protein
can be produced from the mRNA?
22. Given the sequence of eukaryotic DNA below, transcribe the gene and
complete all three steps of RNA processing. (Exons are bold)
Non-template strand:5’ATTATGGGCATATATCCGGCGCCTTAATTATTC3’
Template strand:
3’TAATACCCGTATATAGGCCGCGGAATTAATAAG5’
23. How is the process of transcription related to the process of translation in
the cell?
Homework
24. Why is the nucleus often referred to as the ‘control center’ of the cell.
25. Is the process of gene expression the same in prokaryotes as it is in
eukaryotes? Explain your answer.
26. What is the difference between prokaryotic and eukaryotic DNA?
27. What role do histones play in the packing of DNA?
28. How is the presence of transcription factors related to the characteristics
that define living organisms?
29. Identify the purpose of the modification of pre-mRNA by adding the
nucleotide cap and poly-A tail.
30. Why are coding segments of mRNA referred to as ‘exons?’
31. Explain how alternative splicing allows a cell to produce different proteins
from the same segment of mRNA.
32. Given the sequence of eukaryotic DNA below, transcribe the gene and
complete all three steps of RNA processing. (Exons are bold)
Non-template strand:3’GGCCGGCTATAATCGATACTTACGAATGTAAAA5’
Template strand:
5’CCGGCCGATATTAGCTATGAATGCTTACATTTT3’
33. What role do hydrolytic enzymes play in the production of protein in a cell?
Endomembrane System
Classwork
34. What are the components of the ‘endomembrane system?’
35. How does the role of the smooth endoplasmic reticulum relate to the amount
of smooth E.R. found within different types of cells?
36. Explain the progression of a protein through the endomembrane system of a
cell.
37. Compare the Golgi apparatus to a component of a city or town, based on the
function of the organelle.
38. How is the creation of lysosomes related to the Golgi apparatus?
39. How is a peroxisome related to a lysosome?
40. Why are cell membranes often referred to as semipermeable?
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
41. Identify and explain the process by which large proteins created in the cell
are transported to the extracellular environment?
42. What is a ‘secretory protein?’
Homework
43. Identify the relationship between ribosomes and the rough endoplasmic
reticulum.
44. How does a glycoprotein help determine the role of a protein within a cell?
45. What is the function of the Golgi apparatus in the process of protein
production within a cell?
46. Identify three different cellular functions accomplished by the smooth E.R.
47. What is the purpose of lysosomes for the cell?
48. What function do peroxisomes perform for the cell?
49. What role might a protein play that is created within the cell and becomes
embedded in the cell membrane?
50. Why is endocytosis important for efficient cellular function?
Energy-Converting Organelles
Classwork
51. Explain the structure of a chloroplast, identifying the areas where the light
reactions and Calvin cycle occur.
52. What is the function of the mitochondria for the cell?
53. Do prokaryotic cells contain mitochondria? Explain your answer.
54. Both mitochondria and chloroplasts contain highly folded internal
membranes. Explain the importance of these membranes for the organelle,
including the importance of the folded nature.
55. Briefly summarize the endosymbiotic theory as proposed by Lynn Margulis.
56. According to the endosymbiotic theory, before they were eukaryotic
organelles, the chloroplast and mitochondria more closely resembled what
type of organism?
57. Why is mitochondrial DNA utilized to trace maternal heritage?
Homework
58. Identify the role of the chloroplast for a plant cell.
59. Do plant cells contain mitochondria even though they are photosynthetic?
Explain your answer.
60. Explain the meaning of the term endosymbiosis.
61. What is the evidence used to support the endosymbiotic theory?
62. What is the ‘mitochondrial eve?’
63. Why do organisms receive all of their mitochondrial DNA from their mother?
Other Organelles and Cellular Structures
Classwork
64. How is the central vacuole of a plant cell related to wilting?
65. How do a food vacuole and lysosome help to digest particles within a cell?
66. What is the role of a contractile vacuole in a cell?
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
67. How are sugars related to the cell wall of plant cells?
68. Why is it important that adjacent plant and animal cells contain cell
junctions?
69. Suppose you are investigating a cell that contains plasmodesmata. Would
you label this cell as a plant or animal cell? Explain your answer.
70. Which sort of cell junction would you most likely observe between adjacent
cells that cannot experience leakage? What type of cells may you be
observing?
71. If animal cells need to transport ions and sugars, what sort of cell junction
would you predict they would utilize? Support your response.
Homework
72. What is a vacuole?
73. How is a central vacuole related to turgor pressure in a cell?
74. What is a cytoskeleton and what does it do for the cell?
75. Compare and contrast the external structure of plant cells and fungi.
76. What role does the extracellular matrix provide for a group of cells?
77. Do plant and animal cells contain the same type of cell junctions? Why or
why not?
78. Finish the following analogy. Plasmodesmata: plant cells:: __________________:
animal cells.
79. Identify three differences between the structure of plant and animal cells.
Free Response
1. Most eukaryotes are multicellular organisms. Explain why a large organism must
consist of many cells, by responding to the prompts below:
a. The amount of chemical activity in a cell is determined by which
characteristic, and why?
b. The amount of substances that can enter and leave a cell are determined
by which characteristic and why?
c. As a cell grows in size, explain how its surface area to volume ratio is
affected.
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
2. Below is an illustration of transcription. Respond to the prompts below based
upon this illustration.
http://ajplung.physiology.org/content/277/4/L667
a. In this illustration we can see that an external signal (1) activates a
membrane bound protein called a receptor. In step 2, what is the
molecule that is produced?
b. How do the molecules produced in step 2 interact with DNA?
c. What is the role of the molecules produced in step 2, in the process of
transcription?
3. The illustration below represents the steps of mRNA processing. Use this
illustration to respond to the prompts below.
1
2
3
a. Identify and describe the alteration of the mRNA end labeled “1”.
b. Identify and describe the alteration of the mRNA end labeled “2”.
c. Describe what has occurred during the step labeled “3”. How and why
has the mRNA been changed?
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
4. The theory of endosymbiosis states that the mitochondria and chloroplast were
once free-living prokaryotes that were taken up by another prokaryote.
a. Explain the four pieces of evidence that support this theory.
5. Mitochondrial Eve is the first human female that gave rise to all humans.
a. From whom do eukaryotic organisms inherit their mitochondria and
therefore their mitochondrial DNA?
b. Explain why the mitochondrial DNA can only be inherited from one
parent.
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
Eukaryotes Answer Key
1. Plasma membrane, chromosomes, cytoplasm, ribosomes
2. Eukaryote, prokaryotic cells do not have a nucleus
3. High. A higher ratio keeps cells small, and allows for more efficiency in
moving substances in and out of the cell, and an overall more efficient cell
4. Cells need to be small because they need to be able to move substances in
and out of the cell at a fast enough rate to sustain life and conduct the
chemical processes necessary to support life
5. Organelles are structures within a cell that perform a certain task for the cell,
just as an organ is a structure within the body that performs a certain task for
the body
6. Prokaryotes lack a nucleus, lack all membrane bound organelles, are smaller
than eukaryotes, evolved earlier than eukaryotes, have a single, circular
chromosome
7. A eukaryotic cell. Because eukaryotes are much larger than prokaryotes, you
would be more likely to see a eukaryotic cell under the lowest power on your
microscope
8. The smaller the cell, the higher the surface area to volume ratio. Smaller cells
are more efficient because substances can be transported in and out of the
cell at a much higher rate in a small cell than a large cell
9. Animal, plant, fungi, protist
10. Prokaryote means ‘before nucleus’ and eukaryotes means ‘true nucleus’
11. Ribosomes are produced in the nucleus, as is mRNA, the nuclear pores allow
for these molecules to leave the nucleus
12. Different segments of DNA can be activated or deactivated, leading to
specialization and differentiation of cells, depending on what segment of
DNA is activated, the cell will develop and perform differently
13. Chromatin is chromosomes tightly packed and condensed, wound around
histone proteins
14. DNA packed in chromatin cannot be accessed by RNA polymerase and thus
cannot be transcribed
15. Transcription factors have the ability to determine which segments of DNA
are transcribed and which are not
16. Transcription factors can be produced according to environmental cues,
allowing an organism to respond to environmental stimuli
17. Finished mRNA would have a 5’ G cap and a poly-A tail, the pre-mRNA does
not have these features
18. Splicing removes segments called introns and joins together segments called
exons
19. Alternative splicing allows one molecule of mRNA to change which segments
are treated as exons, so it can produce multiple proteins depending on which
exons are used
20. Nuclear pores keep the interior of the nucleus separate from the rest of the
cell, but also allow necessary molecules to leave the cell.
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
21. The longer the poly-A tail, the longer an mRNA molecule can produce
protein. When the poly-A tail degrades, the mRNA can no longer be used for
translation
22. 5’AUUAUGGGCAUAUAUCCGGCGCCUUAAUUAUUC3’
5’GAUGGGCAUGCGCCUAUUCAAAAA3’
23. Transcription produces the mRNA that will be used for the process of
translation
24. The nucleus contains the DNA, which contains the instructions for creating
proteins and regulating cell development and function
25. Not entirely, because prokaryotes do not have a nucleus, the transcription
process occurs in within the cytoplasm of the cell
26. Prokaryotic DNA is circular in nature while eukaryotic DNA is linear
27. Histones are proteins around which the DNA is wound, allowing it to pack
more tightly
28. Transcription factors allow an organism to respond to environmental stimuli,
which is one of the characteristics of life
29. The cap and tail help the mRNA to leave the nucleus, protect the coding
segments from deterioration by enzymes and make it easier for ribosomes to
bind to the mRNA
30. ‘Exons’ receive their name because they are the segments of RNA that are
‘expressed’
31. Alternative splicing allows the mRNA to rotate the segments that will be
expressed into proteins, so the same segment may produce multiple proteins
through multiple exon combinations
32. 3’GGCCGGCUAUAAUCGAUACUUACGAAUGUAAAA5’
3’AAAAGGCCUAAUCACGAAUGUAG5’
33. Hydrolytic enzymes break down the mRNA in the cytoplasm, so each
molecule will only have time to produce a certain amount of protein before it
is degraded
34. Nucleus, rough endoplasmic reticulum, smooth endoplasmic reticulum, golgi
apparatus, plasma membrane, lysosomes
35. The smooth E.R. detoxifies substances for the cell, therefore cells in the body
that are exposed to toxic substances, such as the liver, have a higher
proportion of smooth E.R. than other cells
36. A protein is made on a ribosome on the rough E.R., enters the E.R., is
modified and then packaged into a vesicle where it is transported to the
Golgi, modified and repackaged, and then either stays in the cell or exits the
cell through the cell membrane
37. The Golgi is like a UPS store, in that it accepts proteins, modifies and
repackages them, and then redistributes them throughout the cell
38. The Golgi produces vesicles containing powerful digestive enzymes called
lysosomes.
39. A peroxisome is a lysosome that is specialized to break down hydrogen
peroxide for the cell.
40. Semipermeable means that they allow some things to pass while keeping
others out.
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
41. Exocytosis- the vesicle containing the proteins binds with the cell membrane
and in doing so releases its proteins to the extracellular environment
42. A secretory protein is a protein that is secreted out of the cell
43. Ribosomes are attached to the surface of the rough E.R.
44. They work like a label to identify where the protein will function in or out of
the cell.
45. The Golgi modifies and repackages proteins for the cell
46. Calcium storage, detoxification, produce lipids
47. Lysosomes help to break down and recycle old organelles, help digest food
and can be used to protect the cell from infection.
48. They break down hydrogen peroxide for the cell
49. It is likely to be used in transporting substances in and out of the cell
50. Endocytosis allows the cell to absorb necessary substances that are too large
to move across the membrane
51. A chloroplast is a disk-shaped organelle contained within a double
membrane, which is filled with a jellylike substance called stroma and
contains stacks of smaller disks called thylakoids. The light reactions occur
within the thylakoid membranes, the Calvin Cycle occurs in the stroma
52. Produces ATP for the cell
53. No, mitochondria are membrane bound organelles, and prokaryotes do not
contain any membrane bound organelles
54. The membranes allow for a concentration gradient to be created which is
used by both of these organelles to accomplish their task. The folded nature
of the membranes increases surface area, allowing for more efficiency in
production
55. Mitochondria and chloroplasts were once prokaryotic cells, over time they
were engulfed by other prokaryotic cells, which would eventually become
eukaryotes, and they continued to produce ATP and conduct photosynthesis
within their host cell, developing into the organelles that they are today
56. Prokaryotes
57. Mitochondria produce other mitochondria, since mtDNA is found only in the
mitochondria, and we receive all of our mitochondria from our mother, the
mtDNA remains relatively unchanged for generations
58. Conduct photosynthesis and produce sugar for the cell
59. Yes, even though they can produce their own sugar, they still need
mitochondria to convert the sugar to usable ATP
60. Endosymbiosis is one organism living within another organism
61. Mitochondria and chloroplasts have their own DNA and ribosomes, they
reproduce on their own and they are approximately the same size as a
prokaryotic cell
62. The first female human on Earth
63. The egg cell contains mitochondria, the sperm cell that fertilizes the egg does
not contribute any mitochondria. All mitochondria in the body are derived
from these mitochondria
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
64. The central vacuole provides turgor pressure for the plant cell, increasing
rigidity and preventing wilting. If the vacuole does not have enough water, it
will lose turgor pressure and the plant will wilt
65. A lysosome can bind to a food vacuole and release its enzymes into the
vacuole to aid in digestion
66. The contractile vacuole is used to pump water out of the cell
67. Cellulose, a sugar, is the primary component of the cell wall
68. Cell junctions allow adjacent cells to communicate and transport substances
back and forth
69. Plant cell. Animal cells do not contain plasmodesmata
70. Tight junctions, animal cells that cannot allow leakage utilize tight junctionsstomach and epithelial lining use these
71. Gap junctions- these work almost like pores that can open and close to allow
substances to pass.
72. Membranous sacks found in plant and animal cells that perform a variety of
functions
73. The central vacuole is the organelle that creates turgor pressure for the plant
cell based on the amount of water it contains
74. A cytoskeleton is a system of tubules and filaments that is used for structure,
support and movement
75. Both have cell walls, plant cell walls are composed of cellulose, fungi of chitin
76. Structural support, healing, communication, tissue separation
77. No. plant cells use plasmodesmata, because they have a cell wall, animal cells
have tight junctions, gap junctions and adhering junctions
78. Gap junctions
79. Plant cells have cell walls, chloroplasts, central vacuole. Animal cells lack
each of these features but do contain centrioles, which plants do not
1. Cell Size
a. The amount of chemical activity in a cell is determined by its volume.
If the volume is too large, then interactions are fewer, distances
molecules must travel are farther. Therefore the cell must have
enough volume to contain cell organelles, nutrients, water, and for
materials to move, but not so large that materials cannot reach their
destination.
b. The amount of substances that can enter and leave a cell are
determined by the cell’s surface area. The surface area must be large
enough that transfer into and out of the cell provides the nutrients
and molecules required to maintain equilibrium. Too small a sruafce
area would not apply enough movement to support the volume of the
cell.
c. As a cell grows in size, the relationship between its surface area and
volume changes. This ratio changes such that the surface area
becomes smaller relative to the volume of the cell (or stated
differently, the volume increases more rapidly than the surface area).
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression
2.
3.
4.
5.
At some point the materials needs to move into and out of the cell
can’t do so effectively enough to support the processes within the cell.
Gene Expression
a. the molecule produced is a transcription factor
b. transcription factors can bind with DNA near the promoter region of a
gene. The combination of the transcription factor and RNA
polymerase initiates the transcription of that gene.
c. The transcription factors allow an external signal or stimulus to
initiate the transcription of a particular gene, whose protein is needed
by the cell.
RNA Processing
a. the mRNA end labeled 1 is the 5’ end of the pre-mRNA molecule. A
nucleotide cap is attached to this 5’ end. This helps the ribosomes
attach to the mRNA so that translation can begin and it protects the
mRNA from hydrolytic enzymes.
b. The 3’ end of the pre-mRNA receives a “poly A tail”. This is the
addition of a series of adenosine nucleotides.
c. The pre-mRNA is altered by the removal of introns (intervening
nonecoding regions) leaving the exons (the expressed coding
regions). Essentially the non-coding is removed to leave a continuous
coding sequence in the mature mRNA.
Mitochondria and chloroplasts can only arise from existing mitochondria and
chloroplasts. A cell without these structures cannot produce them.
Mitochondria and chloroplasts have their own DNA, that resembles bacterial
DNA. Mitochondria and chloroplasts have a single circular DNA strand,
identical to the DNA found in prokaryotes. Mitochondria and chloroplasts
synthesize their own proteins utilizing their own mechanisms. These
mechanisms are similar to those found in bacteria.
Mitochondria
a. eukaryotic cells and therefore eukaryotic organisms inherit their
mitochondria from the female contribution.
b. mitochondria are carried within the female egg contribution to
offspring. The male sperm cell contains a portion of the DNA from the
nucleus. The sperm cells are small and do not carry any organelles
however, the much larger egg contributes a portion of the DNA from
the nucleus as well as the mitochondria, containing the mitochondrial
DNA
www.njctl.org
PSI Biology
Eukaryotes & Gene Expression