A72
by
DNA_Broschure_engl_US1u4.indd 1-2 www.
Take the Pink Link!
.com
16.06.2008 11:54:31 Uhr

a b o u t u s
Vision
We have to start developing products today that you may need tomorrow. This, of course, is a quite demanding task. A task we can successfully tackle thanks to the highly educated people employed at AppliChem. All of them also strive to extend and to maintain an international network. Only by staying in close contact with colleagues in the various fields in many countries all over the world will it be possible to manage these current tasks.
Today, AppliChem has subsidiaries in Scandinavia, Asia and the US; all of them play an
essential role in the further development of our product portfolio. We intensively and
continuously strive to become better and better – as partners of our customers, as chemists and biologists supporting chemists, biologists and other scientists.
We are convinced that your work will benefit from this.
Quality Management
We will provide nothing but the best to our customers – this is the motto of our quality management. Every single AppliChem employee knows: a product features the extraordinary and uniform quality demanded by us, once it meets the exacting requirements of our customers. This excellent quality of each individual product is – above all – the result of an optimum collaboration of all members in the overall process.
Every employee bears a maximum of responsibility.
We are well aware of the fact that our customer requirements and the market are subject to a continuous process of change. Our quality management works daily on the improvement and further development of all process flows.
The certification in accordance with DIN EN ISO 9001 : 2000 guarantees the highest possible quality standard in all process phases.
Quality control
The high demands on the quality of all our products are a challenge that we are ready to face on a daily basis. Each and every employee gets involved at every stage of the order processing with his knowledge and experience – from the receipt of goods to the production laboratory to storage. Our quality assurance is applied in the production of our AppliChem products and, of course, in the custom synthesis at an identical level.
AppliChem stands for a continuous control of the product quality during production, always in view of the customer requirements. We permanently test in accordance with the legal requirements and the high standards of our own AppliChem test specifications. Of course, we realize additional, customer-specific tests at any time. Part of this process is the permanent supervision of the testing equipment, among other things.

c o n t e n t s
Introduction
2
Chapter 1
Chapter 2
Chapter 3
Chapter 4
Chapter 5
Literature
3
6
7
18
28
30
34
35
42
44
55
61
64
© 2008 AppliChem • Nucleic acid decontamination

Nucleic acid molecules, DNA and RNA carry the genetic information of living cells (Alberts et al. 2002). By the spread of living organisms on earth, nucleic acids today are omnipresent in our environment, caused by living organisms, as well as by the release of nucleic acids from dead cells (Pääbo et al. 2004, Mulligan 2005). By desiccation and mineralization, encapsulated nucleic acid molecules of dead organisms were conserved in the environment for millennia or even millions of years (Green et al. 2006, Noonan et al. 2006).
Researching this fossil genetic information (“ancient
DNA“) opens a completely new view at evolution, but also at archeology (Bollongion et al.
2006, Haak et al.
2004, Noonan et al . 2006). Such new fields of research are based on new methods for the treatment of nucleic acids. Good examples are methods for the purification, analysis and amplification of nucleic acids (Sambrook
& Russel 2001). A fast and reproducible isolation and cleaning of nucleic acids was not possible until the development of the silica matrix. This also established the automation of these processes for high throughput.
This again, was a prerequisite for the optimization of
DNA sequencing to such a level, as to permit the
sequencing of complete genomes to become standard.
One milestone of this work is the decoding of the
entire human genome (Collins et al.
2003). Finally, for a quick amplification of DNA and RNA molecules, the
Polymerase Chain Reaction (PCR) technology proved to be decisive. Today, this method has been refined to detect even individual molecules (Innis et al . 1990).
All these methods have been the driving force for the fast development in genetic engineering over the last 30 years (Demain 2001). Recombinant techniques in genetic engineering laboratories now produce more and more artificial nucleic acid molecules (Bensasson et al . 2004). These recombinant nucleic acid molecules are important tools for research and development while making completely new demands to biological safety, since an uncontrolled release or widespread distri­ bution has to be prevented (Kaiser 2005a, 2005b).
Keeping the distribution of nucleic acids in check by employing efficient decontamination products is there­ fore a current topic. On the one hand, an efficient de­ contamination is necessary to appropriately use highly sensitive processes for analysis, as incorrect results due to contaminating nucleic acid molecules can be
observed with increasing frequency. Such incorrectly positive test results can have serious consequences for medical diagnostics, for criminology or for scientific analyses. On the other hand, the unrestricted distri­ bution of problematic nucleic acid molecules, such as multi­resistance cassettes, oncogenes, recombinant infectious, viral genomes, etc. must be prevented
(Bensasson et al . 2004, Burns et al . 1991, Davison 1999,
Dzidic & Bedekovic 2003, Guyot et al . 1999, Ho et al .
2001, Kaiser 2005a, Lorenz & Wackernagel 1994).
To our knowledge, no technical literature is available covering the current problem of nucleic acid de­ contamination. It is the objective of this brochure to collect the most important data and facts.
Nucleic acid decontamination • AppliChem © 2008

N
N
Basic elements of the nucleic acids are the nucleo­ tides. They are composed of 3 important components: the base, sugar and a phosphate residue. The phos­ phate groups release H + ions in the water; thus, these molecules act as weak acids, which eventually led to the nomenclature of “nucleic acid” (acid inside the
“nucleus”). The sugar types are ribose and deoxy­ ribose. The former can be found in the ribonucleic acids (RNA), the latter in the deoxyribonucleic acids
(DNA). Sugar and phosphate are called the sugar­ phosphate backbone, the supporting structure for bases. They don’t contribute to the real genetic in­ formation, as they are always identical. Both types of nucleic acids get by with different nucleotides each that are polymerized via the phosphate residues.
The bases that are, in fact, the carriers of the infor­ mation are eponyms of the respective nucleotides and can be subdivided into purines (adenine,
guanine), or pyrimidines (cytosine, uracil, thymine), respectively. The order of the bases provide for the sequence.
H
H
2
2
N
Purines
N
N
N
2
Adenine
N
NH
2
N
HN
O
N
N
N
O
N
N
N
N
N
H
N
H
N
N
N
N
H
N
HC
H
H
C
2
N
N
N
H Pyrimidines
HN
N
N
N
NH
N
Guanine
O
N
2
N
N
N
H
N
N
H
Today, it is assumed that the first biological genetic information was stored in the shape of single­stranded
RNA molecules (Vlassov et al . 2005). These, however, are less stable than in the form of DNA molecules, but additionally offer certain catalytic characteristics. There­ fore, especially at the beginning, they particularly
accelerated the evolution of biological molecules in their capacity as multifunctional molecules. Currently, functional RNA molecules can still be found for example as Transfer­RNAs for the binding of amino acids, as ribosomal RNA inside the ribosomes for the
H
O
N
C
N H
C
2
H
N
CH
N
H
CH
Cytosine
HC CH
N
H
3
C
O
O
H N
O
C
C
N
H N
H
Thymine
N H
O
H
H
H
O
H N
N H
C
O
C
H
O
H
Uracil
CH
CH
© 2008 AppliChem • Nucleic acid decontamination

AT
CG
CG
AT
CG
GC
CG
TA base pairing – double strand
HOCH
2
H
H
O
H
OH H
Deoxyribose
OH
H
HOCH
2
H
H
OH
O
H
Ribose
OH
OH
H
H
C
NH
2
C
N
HO
O
P
OH
O
H
C
H
C
H
C
H
OH
O
H
C
N
H
C
H
C
H
C
O
AT
CG
CG
AT
A
C
C
A
CG
GC
CG
TA
G
C
G
A double strand – with breakages single strand – with breakages
A
C
C
A
T
G
A
G
G
T
C
G
C
G
C
Double strand – with breakages after denaturation
T protein synthesis and as catalytic RNAs in ribozymes or telomerases (Chen et al . 2007, Isaacs et al . 2006).
For a better conservation of the genetic information, evolution provided a pairing of the single strand with a complementary strand to ensure that in case of a dam­ aged strand a second backup copy would be available.
This is possible since the bases can be matched in a precisely defined way by hydrogen bonds and a steric fit. Only one adenine (A) can match up with one
thymine (T) or uracil (U) and one guanine (G) with one cytosine (C).
In the shape of a double strand, nucleic acid mole­ cules are much more stable than in that of a single strand. By base pairing, reactive chemical groups are protected from the outside. Thus, undesired reactions with other foreign molecules, as well as chemical mod­ ifications aren't possible as easily as they are with sin­ gle strands. Further, even individual breakages in the sugar phosphate structure have serious consequences for the single strand, since the molecule immediately breaks apart completely. In contrast to that, a double strand can suffer many such single strand breakages
(“nicks”) without breaking apart, since the paired strands support the coherence of the overall molecule as long as the single strand breakages occur in different areas of the molecule. It is after denaturation of the molecules only that strand breakages in double strand­ ed DNA leads to a decomposition into fragments. As an increased stability has many advantages, a gradual tran­ sition from RNA molecules to DNA molecules for pri­ mary genetic information storage occurred. As a conse­ quence, virtually all organisms living today make use of the double stranded DNA for primary genetic informa­ tion storage. Nowadays, the far less stable RNA mole­ cules mainly serve for the short­term relay of informa­ tion in the shape of messenger RNA for the protein
Nucleic acid decontamination • AppliChem © 2008

N O CH
3
N
H
Section from the sequence of the phage T7 DNA
N
A
H N T
N
N
O
N
N
N
A
H
N H O
H N T
N
O
CH
3
N
N
(1) AT base pair
O H N
H
N
G
N
H
N
H
H
N C
N
O
N
N
O H N
H
N
G
N
H
N
H
H
N
O
(2) GC base pair
C
N biosynthesis. Here, the faster degradation and the re­ duced half­life of these molecules even show regula­ tory advantages for obtaining a timely and quantity­ dependent exploitation of information. Today, single stranded or double stranded RNA can only be found in viruses or viroids (Becker 1999).
© 2008 AppliChem • Nucleic acid decontamination

For several years, we have made “free” nucleic acids a topic for our studies and we have come to the conclusion that the significance of this topic should not be underestimated, but given more attention instead. We define as free nucleic acids those nucleic acids that are no longer enveloped by a cell or nuclear membrane. The first important distinction, of course, concerns the natural incidence of nucleic acids on the one hand and artificial molecules created through genetic engineering and molecular­ biological methods on the other hand.
The naturally prevalent nucleic acids are a source of contaminations in a variety of areas. Forensic tests, for instance, microbiological, medical analyses and analyses of ancient DNA samples require a working environment that is free from nucleic acids (Balogh et al . 2003, Haak et al . 2004). Similarly, there are natu­ ral multi­resistant plasmids among clinically relevant bacteria that increasingly pose problems in the area of hospital hygiene (Cohen 2000, Croft et al . 2007,
Knobler 2003, Tillotson & Watson 2001).
Since the early days of genetic engineering some 30 years ago, more and more recombinant DNA and RNA molecules are created, the controlled decontamination of which is essential for biological safety (Bensasson et al . 2004, Brower 1998, DeVries & Wackernagel 1998,
Ho et al . 2001, Bush 2004). The resistance genes for antibiotics used in genetic engineering concern the same antibiotics that are being employed in therapeu­ tic treatment (Amyes 2001, Guy et al . 1999, Levy &
Marshall 2004, White et al . 2001). At the same time it becomes evident that the transformation of living cells and bacteria also occurs under natural conditions, i. e., not by experimental work (Burns et al . 1991, Lorenz
& Wackernagel 1994, Maiden 1998, Mercer et al . 1999,
Steinmoen et al . 2003) Preventing an uncontrolled release of recombinant nucleic acids must therefore be an integral part of all genetic engineering work.
Nucleic acid decontamination • AppliChem © 2008

Dr. Wolfram Marx, AppliChem GmbH, Germany
As we all know, not everything existing in nature was created in a natural way. Man likes to give a helping hand. The release of genetically engineered plants in field-grown tests and in agricultural
production, the formation of resistance in microorganisms against antibiotics and antimycotics
(hospital germs, livestock farming) or gene therapy
(viral vectors) have become part of the discussion in public. Special aspects of this debate are the risks and dangers for man and the environment emanating from free nucleic acids – also known as naked nucleic acids. Not least due to recent findings from research, this topic is repeatedly discussed in a controversial manner. These discussions carry the entire spectrum of opinions from the probably intentional distortion of the truth (fear-mongering) to trivialization. I recently came across these topics, when AppliChem launched DNA-ExitusPlus™, their new product for DNA decontamination, which had been developed in collaboration with multiBIND
Biotec in Cologne. The special feature of this product is that nucleic acids and proteins are destroyed and not only modified or denatured as is the case with most other products. What happens with
bacterial or viral DNA/RNA that is, in fact, released by the treatment with conventional decontamina- tion products?
Free nucleic acid is the term for DNA and RNA that is not bound by proteins or protected by a protein enve­ lope. What really happens with recombinant nucleic acids created in laboratories and what happens with antibiotic resistance genes or other nucleic acids,
released from genetically engineered, manipulated
(micro­)organisms (GMOs) after they have died? At present time, studies are under way to research the absorption of such nucleic acids by human, animal and plant cells and, in particular, by microorganisms in the laboratory and in nature. Here, again, the spontaneous absorption is of high interest, as this way represents the real danger for the environment as man has really no control over it. In a first step, we need to find out what occurs naturally in the environment and what, by
contrast, is produced by man in an artificial way.
Science has often taken nature as a paradigm in the development of new technologies (e. g., PCR) or simply used natural molecules and mechanisms as tools
(e. g., restriction enzymes, plasmids). This way, the
protracted breeding process could be cut short. Man recombines the way he wants to and decides to the large extent about selection. In other words, man
creates a revolutionary evolution in the sense of an
accelerated, imagined progress – “quick and dirty”, with all its unknown consequences. Is it by accident that evolution and revolution are distinguished by a single letter only?
Reproduction and HGT: The naturally intended ex­ change of nucleic acids for one is effected by natural reproduction within one species (“vertical genetic transfer”). During the procreation of offspring (repro­ duction), the genes of the parents are recombined dur­ ing the fusion of the ovule and the sperm. He who gains advantages in his habitat by this process will pre­ vail; he who does not has to look for a niche (special­ ization) or gets the short end of the stick. A mating of direct relatives was not envisioned by nature, since
© 2008 AppliChem • Nucleic acid decontamination

nature always looks for the highest possible degree of genetic recombination. The consequences of inbreed­ ing – if viable – cannot be overlooked (e. g., “overbred” dogs). Alternatively, in contrast to natural reproduction, there is a nucleic acid exchange between species termed “horizontal gene transfer” (HGT). By principle, a HGT can be obtained by different mechanisms: 1.)
Zygosis – a direct exchange of DNA between cells by physical contact; 2.) Transduction – DNA transfer by viruses. Some infectious viruses are capable to move between the DNA of host organisms; 3.) Transforma­ tion – direct absorption of DNA from the environment, originating from the soil, water or, for instance, diges­ tive tracts. The HGT is a central point in the GMO dis­ cussion.
The absorption or the exchange of genetic informa­ tion by or between microorganisms in nature has been a known fact for a long time. The most recent example was the development of highly infectious influenza
viruses from avian flu pathogens (type H5N1) and hu­ man flu viruses. Through the exchange of plasmid
DNA, bacteria develop resistances against antibiotics.
Particularly dreaded are the resistant hospital germs, cause for the failure of many therapies. Without the existence of the selection pressure by antibiotics, the resistance would not offer the bacteria an advantage for survival. Their progeny would even take longer, as they also have to reproduce the genetic information of
“resistance”. For more than thirty years, viroids have been known, infectious envelope­free ribonucleic acid molecules (circular closed and single­stranded), identi­ fied as causative organisms of diseases in plants. Their genetic information consists of only 200 to 400 nucleo­ tides, making them about 20 times smaller than the smallest known viruses or bacteriophages. On the one hand, they show similarities to transposons, “direct”, as well as “inverted repeats”. On the other hand, sequence homologies exist with “small nuclear RNAs”, which play an important role in the splicing of animal genes.
This would also explain the pathogenicity, namely in­ teraction with natural splicing. If this is – as it indicates to be – an effect comparable to RNAi, nature was again faster in its ingenuity than man. Since the viroid ge­ nome does not encode for proteins, the effect trigger­ ing the symptoms has to stem from the sequence and the structure of the viroids (ribozymes; interaction with introns inside the host DNA, etc.). Most probably, in­ jured cells are required for infection to take place.
Transport within the plant is realized by cell­cell con­ nections (plasmodesms) and the nutrient transport sys­ tem (phloem = stele). Viroid RNA is highly resistant against enzymatic digestion, since it does not have any free ends. It should also be remarked that the genome of the human pathogenic hepatitis D virus (HDV) shows high similarities to the viroids.
Nucleic acid decontamination • AppliChem © 2008

I am going into this much detail, since these smallest patho­ gens show nat­ ural mechanisms of evolution in an excellent way and a further development can be expected. Let’s bear in mind that evolution has not stopped. As already mentioned, viroids show similarities to transposons – an important tool in biotechnology. A transmission of the viroids from plant to plant by insects is possible. Up to now, infections caused by viroids normally occur in the tropics and subtropics where they also affect important agricultural crops (potato, lemon, cucumber, avocado, etc.). Today, the worldwide trade and
exchange of goods provides for a fast spreading of diseases, animal and plant species that would normally have difficulties in overcoming continental separa­ tions.
Among man, free nucleic acids can also be ob­ served, for instance i) fetal, cell­free nucleic acids in the blood of pregnant women, ii) plasma nucleic acids and nucleic acids in the urine, used to diagnose dis­ eases (tumors) or iii) autoimmune mediated diseases that can lead to anti­DNA antibodies (systemic lupus erythematosus). These types of free nucleic acids have not yet been studied in every detail and may be present in apoptotic bodies enveloped by proteins. The so­called “naked viruses” (e. g., parvovirus, adenoviruses, enteroviruses, rhi­ noviruses) are not really “naked” either. Their nucleic acids are associated with proteins; however, they are lacking the envelope it­ self, which is typical for viruses.
Apoptotic bodies: One consequence of the “programmed cell death” (apop­ tosis) is the dissection of genetic
material by nucleases into bigger fragments. These are released as apoptotic bodies upon the disinte­ gration of the cell membrane.
The horizontal transfer of DNA by the absorption of apoptotic bodies by phagocyting cells has been shown in vitro (phagocytosis = absorption of solid particles not from the cells). Cells carrying the Epstein­
Barr­Virus­DNA integrated in the ge­ netic information were co­cultivated with other cells. The absorption of the
DNA in the shape of apoptotic bodies and their expression inside the cell nu­ cleus of the co­cultivated cells could be proven (Holmgren et al . 1999). This way, cells that do not possess a receptor for the virus on the surface can be infected as well.
Free DNA inside the plasma: the origin of the free DNA
(and RNA!) and the shape of the nucleic acids could not yet be determined. In the case of tumor DNA (e. g.,
K­ras, Epstein­Barr­virus DNA) it may stem from dead tumor cells or circulating tumor cells. Neither is it known, whether the release of nucleic acids is an active or a passive process. Studies have shown, however, that the tumor DNA can be absorbed by other cells
(transfections) and that the genetic information inside the transfected cells is also expressed (Garcia­Olmo et al . 1999, Garcia­Olmo et al . 2000). The authors pro­ posed the term “genometastasis”.
Free DNA inside the cytoplasm: Viral infections or dam­ age to tissue can trigger autoimmune reactions. In such a case, an abnormal expression of the “major histocom­ patibility complex“ (MHC) genes of classes I and II and of other genes for antigen processing or presentation occurs inside the cells. The same phenomenon can be observed in non­immune cells when admitting double­ stranded nucleic acids (sequence independent). 25 base­pair sized DNA pieces inside the cytoplasm are sufficient to lead to an increased gene expression (Su­ zuki et al . 1999). Since in tissue damages double­ stranded genomic nucleic acids are released as well, the artificial addition (transfections) of nucleic acids might reflect a natural mechanism. Authors Suzuki et al . speculated on the possibility of genetic therapeutic treatments with respective plasmids or other plasmid
DNA vaccines being able to trigger such reactions.
Transposons (“jumping genes“, transponable = mobile genetic elements) are rare, but they occur in all types or organisms. These are short DNA sequences that can be replicated (multiplied) and change their position in­ side the genome or on the plasmids, i. e., they “jump” to different positions. The locations, where transposons are integrated into the genome are usually random. At its ends, a transposon contains nearly identical se­ quences and reverse, repeated sequences going into the opposite direction (“direct” and “indirect repeats”).
The transposon encodes for the transposase enzyme, which, in turn, catalyses the insertion into the chromo­ some. Thus, the insertion process is independent from the recombination system of the host cell. Prokaryotic transposons can carry genes that provide the host with new phenotypical characteristics, such as, for instance, a resistance to antibiotics.
Depending on their mode of actions, transposons can be divided into two different groups: i) Class I transposons proliferate and move inside the genome
© 2008 AppliChem • Nucleic acid decontamination

by creating RNA copies (“reverse”) transcribed back into DNA. The new copies can again be introduced into the genome. In their behavior, these transposons correspond to that of retroviruses (e. g., HIV) and are thus termed retrotransposons. ii) Class II transposons carry in their sequence the information of the trans­ posase enzyme, cutting it out from the DNA with the possibility to introduce it at another location. The ma­ jority of natural mutations is caused by transposons.
From a human point of view, viruses, and retroviruses in particular, have the big disadvantage of not being particularly orderly, or to put it another way: they are quite variable. Errors and changes are thus tolerated in the own genome or even used for fast modification.
Those integrating into the host genome tend to take a few neighboring nucleic acids or complete genes of the host along once they leave it again. Under the influence of the, at least in part, very strong promoters and muta­ tions oncogenes evolved (e. g., v­src, v­ras, v­myc, v­fos). The knowledge of the “behavior” of viruses is important, when speaking about the utilization of those in gene therapy or another biotechnological exploita­ tion and molecular­biological treatment. They are, as already mentioned previously, not really free from pro­ teins; however they are handled in protein­free form
(see below).
Dead organisms and the stability of free nucleic acids:
Considering that 11 11 to 11 12 human cells divide daily, and that a similar number of cells have to die to main­ tain the tissue homeostasis, some 1 – 10 g of DNA
“waste” is produced daily. In nature, there is a contin­ ual coming and going: old people die; newborns see the light of day. Those dying leave a huge quantity of
DNA behind entering the soil. To a great extent, the soil consists of silicates, quartz sand or clay materials
showing similar characteristics to those of artificial
DNA purification matrices. These materials can bind free nucleic acids and thus even stabilize them. Conse­ quently, DNA remains a part of nature much longer than originally anticipated. Even 60 days after free nu­ cleic acids were introduced into the soil, bacteria could be transformed with intact DNA molecules (Chamier et al . 1993; Romanowski et al. 1993). This finding is par­ ticularly interesting, as it was previously assumed that free nucleic acids were unable to survive for longer periods of time once outside the protection of a cell, where nucleases are kept under control. The extended availability of these nucleic acids increase the probabil­ ity – or risk, depending which way you look at it – of
(micro) organisms to absorb such nucleic acids: re­ leased nucleic acids of animals, plants and microorgan­ isms, or from contaminations in laboratories. It has to be mentioned, though, that the uptake of plasmid DNA by soil bacteria is much less than linear, chromosomal
DNA. The reason for this may be the reduced avail­ ability of the small plasmid molecules by binding to the soil (Chamier et al . 1993; Nielsen et al . 1997). In the publications it is also stated that the transformation of the bacteria requires an exponential growth of the sub­ ject of the case study ( A. calcoaceticus ). Natural soil of this type being very poor in nutrient content and
permitting no growth, the transformation efficiency is extremely low. Nielsen that a transformation of et al . come to the conclusion
A. calcoaceticus probably does not occur, unless the nucleic acids were recently
released and the bacteria are in their growth phase.
Man has added a number of sources of free nucleic acids: viral vectors in gene therapy, sera (vaccines), cloning vectors in molecular and cell biology –
especially those to study oncogenes, complete viral genomes, and transposons, to name but the most
problematic ones.
Transposons: In laboratories, for example, they are em­ ployed in the genome­wide transposon mutagenesis in yeast, plants, mice or fruit flies (P­elements). This tech­ nology permits the creation of a high number of muta­ tions that are then studied based on the phenotype and the specific gene expression pattern. Transposons can be used to insert reporter genes and regulatory ele­ ments among others into the host genome. For details on the yeast technology, we recommend Current
Protocols in Molecular Biology (2000) 13.3.1­13.3.15
Supplement 51. On mouse transposons and techniques,
I would recommend Roberg­Perez et al . 2003.
Viruses: In the purification process of nucleic acids from human­pathogenic microorganisms, and viral nucleic acids in particular, the bigger part of infectious­ ness is lost. The degree of infectiousness of free nucleic acids depends on the virus type. A virus possesses
respective enzymes and structures on its surface that enable or expedite the binding to and integration into the host cell, respectively. Free nucleic acids lack same; however, they may be able to resort to the cell's own enzymes, for instance for replication. The RNA extract­ ed from flaviviruses or alphaviruses is infectious, if
inoculated intracerebrally in newborn mice. Therefore, this RNA is classified as the same safety hazard as the complete virus particle. The risk of infections of cells in standard media by free viral nucleic acids is lower by a factor of 10 –6 to 10 –8 . The variety of hosts subject to infections, however, is much wider, as the special
Nucleic acid decontamination • AppliChem © 2008

receptors on the cell surface for binding the virus with protein envelope are not required (see above). Due to the fact that nucleic acids are more stable than proteins, infectious nucleic acids can be isolated from viruses inactivated by heat. DNA copies of certain RNA viruses are infectious (e. g., poliovirus). Also, free nucleic acids sidestep the immune defense by antibodies formed against viral proteins. Naked linear RNA is extremely unstable, because ribonucleases (RNases) can be found just about anywhere. Therefore, the theoretical risk in this case is minimal. This and additional information is offered at www.virology­online.com/general/Replication.htm.
many years, antibiotics were used as growth stimulant in livestock husbandry rather than for medical reasons.
Estimates go as high as 9,000 tons of antibiotics per year within the European Union fed to livestock, a third of which for medical reasons. Today, feeding antibiotics as a growth stimulant is prohibited in the
EU. The most recently approved antibiotics were not used in human medicine.
Resistant hospital germs result from incorrectly used antibiotics, not from genetic engineering. With increas­ ing frequency, this incorrect use of antibiotics in human medicine is deplored. On the one hand, even in case of “minor” infections antibiotics are being prescribed.
Frequently, incorrect doses are given – doses that are too low – giving rise to formation of resistant strains.
Antibiotics are released “undigested” into the environ­ ment through the digestive tract – in the clinical field, as well as in agriculture.
Cloning vectors: To a great extent, the activity of a gene is controlled by promoters, typically found immediately adjecent to the gene in the genome. In order to sustain a big or at least a sufficient quantity of the genetic product, in most cases strong or constantly active pro­ moters are used in the artificial genetic constructs.
Among them are, for example, the promoters of the
Cytomegalovirus (CMV), the Human Immune Deficiency
Virus (HIV), and the Simian Virus (SV40) and, in the case of constructs for plants the Cauliflower Mosaic
Virus (CaMV) promoter. Task of the viral promoters is the conversion of the cell metabolism to the virus­
specific “production”. Promoters that are also functional in the human cell are problematic. If they are integrated in the genome, they can take over the regulation of the activity of neighboring genes. In addition, most cloning vectors carry an antibiotic resistance gene for selection purposes – in most cases the bone of contention in the discussions on released nucleic acids. As already
mentioned above, cloning vectors with oncogenes
require particular attention. For the handling of nucleic acids with oncogenic potential the ZKBS (Central
Commission for Biocontainment) recommends that
“persons with bigger skin lesions (open eczemas, wounds and infections) or with a pronounced verrucosis
(warts) should not conduct any work with such nucleic acids”.
Nucleic acids in gene therapy: These nucleic acids are employed for the treatment, the healing or the prevent­ ion of diseases. Possible targets are either somatic cells
(body cells) or germ cells (egg, sperm). Whereas in gene therapeutic treatment of somatic cells only the genome of the recipient is changed, changes can also be transmitted to offspring when treating germ cells.
The latter is not taken into consideration, not least for ethical reasons. Gene therapeutic treatment has noth­ ing to do with cloning, since no genetically identical
“being” is created. Ideally, gene therapy has to be con­ ducted only once, if the transgene is integrated into the genome in a stable way (e. g., plasmids capable of transposition = transposon system). Here, the disease­ causing gene is replaced with the therapeutic gene
(homologous recombination), or a “healthy gene” is additionally placed in another position of the genome.
Further, a repair or the correct regulation might be
feasible as mechanisms.
Pathogenic, resistant microbial and fungi strains:
Despite the fact that these bacteria and fungi strains are not free nucleic acids, mentioning them at this point is worthwhile. They in particular are in genetic
exchange with their conspecifics and are capable of spreading recombinant nucleic acids or trans­ fer acquired resistances. The increasing resis­ tance formation among pathogens should not be inferred from the release of microorgan­ isms from the laboratories modified by ge­ netic engineering, but rather from the hospi­ tal sewage and from agricultural production
(Kümmerer et al . 2002). Over a period of
© 2008 AppliChem • Nucleic acid decontamination

There are different ways to introduce a new gene into the respective cells i) Viral vectors ; viruses have found a way to infiltrate the host cell with their disguised nucleic acids and to express them pathologically. The disease­triggering genes are replaced with the “healing” genes. The
vectors used are modified retroviruses, adenoviruses, adeno­associated viruses and herpes simplex viruses.
As virus genomes are usually quite small, the size of therapeutic DNA that can be introduced is restricted. ii) Free nucleic acids , requiring huge quantities of
DNA and can be used for certain tissues only, iii) Liposomes ; the nucleic acids are “wrapped” in a lipid envelope that can fuse with the cell membrane, or iiii) a human artificial chromosome (HAC) , which is very big and thus difficult to insert into the cell. It is a prerequisite for all of the above that the new gene is accepted and that the correct expression and regulation has to be assured.
There must be no triggering of an immune response.
Deaths traced back to an immune response to viral vectors have been described (example: Jesse Gelsinger
1999) . In addition, there is a theoretical risk of viral vectors in the body reacquiring the capacity to trigger diseases. Until now, an exclusion of toxicity, of an im­ mune or an inflammation response, the gene control, or the control of the insertion into a certain targeted sequence (place of integration) are not possible with viral vectors. It is possible, that other genes are mutated or destroyed (inactivated), that their regulation is changed and that other diseases are triggered. For in­ stance, symptoms similar to leukemia could be ob­ served (refer to http://www.genomenewsnetwork.org/ articles/2004/01/23/gene_therapy.php; Davé, U.P. et al.
(2004) Gene therapy insertional mutagenesis insights.
Science 303, 333; Hacein-Bey-Abina et al. (2003)
LMO2-associated clonal T-cell proliferation in two
patients after gene therapy for SCID-X1. Science 302,
415-419) . In somatic treatments, gene transfer vectors were found in seminal fluids. Accidental changes of the genome in germ cells cannot be ruled out.
Meanwhile, the use of ribozymes, antisense RNA, siRNA, and shRNA (“small hairpin containing inhibitory
RNA”) are being tested to downregulate the gene ex­ pression.
Originally, antigens for immunization are produced with bacterial expression plasmids and the purified protein is dissolved in adjuvants and injected into the laboratory animal. The body then raises antibodies against the respective proteins. A more recent technol­ ogy circumvents the intermediate step of bacterial ex­ pression, which has the additional disadvantage that the antigens are not modified posttranslationally as in mammal cells. In genetic immunization, the research animals are intravenously injected with an expression plasmid, either into a tail vein („Hydrodynamic Tail
Vein Delivery“ = HTV) or a limb vein („Hydrodynamic
Limb Vein Delivery“ = HLV). In the case of the HTV, the protein encoded on the plasmid DNA is primarily ex­ pressed in hepatocytes, the spleen, the lungs and the myocardium, or the skeletal muscle (HLV), respective­ ly. This method is currently used with mice, rats and rabbits. Thus, we are speaking of direct transfections.
The cells produce the antigen with all naturally occur­ ring modifications (e. g., glycosylation), and the body reacts by producing antibodies. Parts of the expression plasmids are controlled by the CMV or Ubiquitin pro­ moter (Bates et al. 2006) .
Transgenic organisms carry a foreign gene, which is stably integrated in the genome. There are different occasions for the production of transgenic organisms.
Some of them are used for the production of foreign proteins: The desired proteins are “harvested” from sheep and goat milk or from the egg whites of hen’s eggs. Others, for instance, are bred for medical basic research: wild type mice cannot be infected with the polio virus, as they are lacking a respective receptor protein on the cell surface. In order to be able to study the disease in the relatively “cheap” mouse model, transgenic mice are bred that express the human
receptor protein. They then show the corresponding symptoms of a polio infection.
In plants, frequently a higher crop yield thanks to an improved adaptation to climatic conditions or a re­ sistance to pests plays a role. In the past, selection markers (antibiotic resistance genes) in particular were the target of criticism.
Nucleic acid decontamination • AppliChem © 2008

In nature, hosts and parasites meet constantly, also in the shape of their free nucleic acids. Both sides are perfectly primed for battle. At this point, our inter­ est focuses on man’s options to fend off undesired
intruders, especially microorganisms. Today we know that bacteria or viruses cannot penetrate intact skin.
Only skin lesions permit their intrusion. The mucous membranes are much more sensitive and are therefore the preferred entry.
Several defense mechanisms already exist on the surface of the skin and the mucous membranes:
1. Sweat contains lysozyme , an enzyme employed for the isolation of plasmid DNA in the alkaline lysis of bacteria. This enzyme is present on the surface of mucous membranes as well. Here, in addition, secretionary antibodies (IgA) can be found. Last but not least, nucleases are present as well!
2. The acidic pH value inside the stomach and the alkaline pH value of the intestine supported by various digestion enzymes also serve to create in­ hospitable conditions.
3. The urogenital tract is protected by the acidic pH value of the urine, in females additionally by the colonization with the lactic acid producing bacteria
Lactobacillus acidophilus (Doderlein’s bacillus). The acidic environment created by the lactic acid also prevents colonization by the potentially pathogenic yeast Candida albicans .
4. By principle, the entire surface of the body (skin and, for instance, intestinal flora) is colonized with microorganisms that are “tolerated” on the surface.
In their own interest, they ensure a growth contain­ ment of undesired, mutually competitive germs.
5. All body fluids contain a great variety of antimicro­ bial substances as well (lysozyme, the enzymatic complement system, peroxidase, fibronectin, inter­ ferons, interleukins, lactoferrins and transferrins).
Interleukins cause fevers. An increased body
temperature is also counted among the important defense mechanisms. Therefore, in many cases it is preferable to “weather” a fever – especially children
– to permit an effective healing process to take place and not to intervene immediately with antipyretic products.
6. Phagocytes (scavenger cells) are amoeboid­moving cells capable of phagocytosis. They include macro­ phages, monocytes, as well as neutrophile and
eosinophile granulocytes. They are not only moving inside the tissue, they also patrol the surface of
mucous membranes. Once they have absorbed
intruders, these are digested.
7. Inside the cell, the defense activities continue.
Lysosomes contain alkaline proteins perturbing the permeability of the bacterial cell walls. The acidic pH value (up to pH 4.0) inside the phagolysosomes optimizes the activities of different lysosomal en­ zymes (lysozyme, glycosylases, phospholipases, and nucleases).
8. The various classes of antibodies bind to the in­ truded, exogenous substances and microorganisms and contribute to the inactivation.
9. DNA methylation: This process was described in bacteria for the first time. Most bacterial strains
contain so­called restriction endonucleases. These restriction enzymes recognize certain short DNA
sequences and digest (cut) the DNA at these sites. By modifying the own DNA with a strain­specific meth­ ylation pattern, the bacterium can distinguish be­ tween its own and the intruded foreign DNA.
Methylation protects the bacterial DNA against diges­ tion by its own restriction enzymes. It is assumed that in mammals methylation represents a defense mechanism to protect their own genome against for­ eign DNA, such as viruses. Frequently, viral DNA integrated after infection into the host DNA is meth­ ylated. The methylation of eukaryotic DNA does not mark same for purposes of digestion, but methyla­ tion can inactivate promoters and thus silence the expression of genes regulated by viral promoters.
This assumption is further corroborated by the fact that most methylated cytosines in the mammal ge­ nome lie within viral sequences and transposon
DNA. In addition to turning off (“silencing”) the
expression of foreign DNA promoters, it could be demonstrated that methylation prevents the move­ ment of transposable elements to other sites inside the genome. This way, methylation can prevent the spreading of infectious viruses from cell to cell or the negative effects of transposon sequences.
One has to be aware of the fact that in lysis of bacteria or viruses, their nucleic acids are released. Therefore, nucleases are always part of the defense mechanism!
Viral sequences can also be found in the human ge­ nome. There are, of course, viruses and bacteria that can cross all barriers ( also refer to Lisowsky 2006 ).
© 2008 AppliChem • Nucleic acid decontamination

In conclusion to the topic of “natural defense” let me remark that frequently microorganisms do not be­ come dangerous until they enter the body by injection or through open wounds. Neither should one ignore the potential risk to laboratory personnel, if nucleic acids are dissolved in solvents that permeate the skin or have been mixed with membrane fusion reagents.
The interdictions to pipette with the mouth and to eat or drink in the laboratory, the recommendation to use plastic instead of glass (danger of breaking) wherever possible and to avoid the generation of aerosols are evident. Apart from that, extracellular nucleases
(defense on the skin, on mucous membranes, in tear fluid) are the biggest enemy of the nucleic acid experi­ menter in the laboratory. The problem created by man is the fact that the frequency of “contact” has risen ex­ ponentially – in certain professions for quite some time already, for the world at large quite recently.
The absorption of naked nucleic acids by cells seems to be a natural phenomenon. Should that be the case, this has to be based on a mechanism. How is nucleic acid “waste”, released by apoptotic cells ( cf. Review by
Gewirtz et al. 1998 ), disposed of? Since nucleic acids, thanks to their phosphate backbone, have a high
negative charge, a simple absorption by diffusion through the lipophilic cell membrane is hardly possible, yet cannot be completely ruled out. Therefore, a recep­ tor­controlled absorption is favored, all the more, be­ cause marked oligo­nucleotides in so­called “Clathrin coated pits” that have been known from other endo­ cytosis processes could be detected in lysosomal and endosomal compartments ( Beltinger et al. 1995 ). In view of the administration of gene therapeutic nucleic acids, this type of absorption is considered as highly inefficient.
Once the nucleic acids can leave the endosomes or lysosomes in the cells, respectively, they collect – prob­ ably by diffusion – inside the cell nucleus ( Beltinger et al. 1995 ). There, they are presumably held by nuclear binding proteins and are possibly no longer available for biological processes. The availability of oligonucleo­ tides inside the human body in the sense of pharma­ codynamics was studied as well. Within a time period of 24 hours, 50 % of the originally intravenously infu­ sion­administered oligo were excreted with the urine, in part intact, in part in a degraded state; within
96 hours this figure rises to approx. 70 %. Comparable experiments in mice and monkeys have shown that oligos accumulate most inside the liver and the kidney.
( cf. Review by Gewirtz et al. 1998 ).
Free foreign DNA ingested with food is not com­ pletely degraded in the gastrointestinal tract of the mouse. In experiments, phage DNA (M13mp18) was fed to mice and later detected in peripheral leukocytes, the spleen and the liver. A mere 2 to 8 hours after feed­ ing, phage DNA already circulated in the blood of the mouse. In the feces, DNA fragments of sizes between
100 to approx 1,700 base pairs could be isolated. From the total spleen DNA, phage DNA fragments of sizes up to 1,300 base pairs could be isolated, covalently linked with mouse DNA ( Schubbert et al. 1994; Schubbert et al. 1997 ). These research animals were fed daily with foreign DNA M13 for periods of 3 days and one week respectively. After one­time ingestion, no stable phage
DNA integrated in the mouse’s genome could be de­ tected.
Although, after feeding chickens with transgenic corn, the DNA of the transgenic plants could be de­ tected in crop and stomach, this was not the case in the subsequent sections of the digestive tract ( Chambers et al. 2002 ). Natural mitochondrial plant DNA does not survive the digestion in the chicken stomach either.
The absorption of free DNA or DNA from foodstuffs after digest by saliva can start in the oral cavity. A great variety of bacteria exist inside the oral cavity, bacteria that are in part naturally competent, i. e., they are ca­ pable of absorbing foreign DNA. During incubation of free DNA with human saliva, DNA is partially digested in vitro ; however, this happens so slowly as to leave sufficient time to transform the oral cavity bacterium
Streptococcus gordonii DL1 in an in vitro experiment with the remaining DNA ( Mercer et al. 1999 ).
The discussion on the dangers of free nucleic acids was triggered or intensified, respectively, by the ex­ periments of Burns et al . (1991). They were able to prove in vivo the generation of tumors in the skin of mice by applying plasmid DNA that encodes the ge­ netic information for the human T24 H­ras oncogene.
No further agents (tumor promoters) were required to transform endothelial cells of the skin to form lymph­ angiosarcomas. By comparison, the absorption of DNA by epithelial cells is far less effective (multiple treat­ ment with oncogene or tumor promoter) than by endo­ thelial cells in vivo . After all, it was this study that caused the ZKBS in 1991 to make a general statement by recommending precautionary measures when handling nucleic acids with an oncogene potential. It is explicitly pointed out that “laboratory surfaces and laboratory equipment having come in contact with those nucleic acids should be cleaned thoroughly upon completion of the work” and “laboratory waste con­ taining such nucleic acids should be denatured either chemically or by autoclave treatment”.
Nucleic acid decontamination • AppliChem © 2008

© 2008 AppliChem • Nucleic acid decontamination

Man has been sensitized by nuclear power, chemical accidents, foodstuff scandals, pollution of the environ­ ment and natural catastrophes the effects of which seem to be compounded by human behavior. Regard­ less, we continue to build our homes next to the run­ way, in earthquake zones, on slopes prone to land­ slides, or in floodplains. Following the catastrophe, political campaigning floods the area like tourism and once this has been weathered and the water has drained away, aid moneys for reconstruction pour in.
Now, genetic engineering comes on top. Ripe tomatoes that look it but don’t taste it; that stay ripe longer, be­ cause they no longer rot. Are the consequences clear to us? Can the advantages justify possible disadvantag­ es? Were enough checks completed before the world at large was confronted with a genetically engineered product? Chemical contaminations are washed out (di­ luted) with time or chemicals decompose or are de­ graded. DNA contaminations can be transmitted, re­ combined in nature and multiplied. The sequence analysis of homologous genes of different species has shown that complete genes or partial gene sequences are identical, even between organisms not evolution­ arily related. The actual cause can only be a direct ge­ netic transposition.
Have we humans learned by now, how to deal with such sensitive topics? The opponents of the spreading of GMOs point out various negative effects and badly calculable risks:
1. Bacillus thuringiensis (Bt) has been used for many years as pesticide (particularly wheat and cot­ ton). Genetically modified plants express the Bt delta endotoxin. There is increasing evidence of farm workers developing allergies from this toxin.
2. Antibiotics resistance as selection marker in the production of transgenic plants. DNA released into the environment is more stable than originally an­ ticipated. Bacteria can absorb this DNA. Particularly critical is the fact that the Ampicillin­resistance in
Novartis Bt grain is under the control of a bacterial promoter instead of a plant promoter. One could counter that the probability of this very DNA section being absorbed by bacteria in the soil or during in­ gestion is extremely low, since it represents but a minute fraction of the overall plant DNA. In contrast to multi­resistant germs in clinical areas, the resis­ tance should normally not represent a selection ad­ vantage for soil bacteria and disappear again.
3. Posttranslational modification: Depending on different organisms, acetylation and glycosylation of transgenic products can lead to a modified toxicity.
4. Non-predictability of the place of integration and the expression of the transgenic inserts: the number of inserts, their localization (chromosome or organelle chloroplast, mitochondria) and their exact position (where on which chromosome) can barely be predicted.
5. Positional effect: The insertion point influences the expression of the transgene. The transgene, in turn, also influences the expression of neighboring genes or silences them, if the insertion takes place in the middle of a gene. Since frequently only a weak expression of the desired gene could be
detected, strong promoters are being employed.
Therefore, it is desirable to know the sequences before and after the transgene, since strong promot­ ers can have an effect across many thousands of base pairs.
6. Horizontal gene transfer (HGT) is primarily
discussed in connection with microorganisms. The three variants are the direct absorption of naked nucleic acids from the environment, the absorption of DNA by viruses (bacteriophages) and by conju­ gation between different species of bacteria. Once again, the absorption of transgenes (e. g., resistance genes) is the focus of interest. The above explana­ tions make it clear that the probability of such an incident is extremely low, yet theoretically it cannot be ruled out completely. If an absorbed transgene under a respective selection pressure offers an ad­ vantage, same can establish itself in a population.
7. Genetic constructs with a corresponding replica­ tion unit and promoter can be active in different organisms.
Nucleic acid decontamination • AppliChem © 2008

People are unsettled, because no information intelli­ gible to all or formulated in a neutral way is available.
Even experts have difficulties to be unbiased in verify­ ing and evaluating all existing information. And it is difficult for the experimenter to create conditions that come at least close to the real conditions. Nobody working in a laboratory and sticking to the rules will swallow DNA by the gram or rub it in his skin. Yet is it not necessary that the odd genetically modified plant grows on open land so we can find out what really happens? Something that must not happen under any circumstance is to play irresponsibly with the fear of people. That incorrect information, processed pseudo­ scientifically, is fed to the public. And who can safely rule out that it is used unlawfully for reasons of greed or other base motives? Bioterrorism, unlabeled, geneti­ cally modified ingredients in foodstuffs – it is easy to paint a bleak picture of the future.
Why does man feed a herbivore with badly
processed animal waste? Nature fights back. If BSE
(TSE) is a pathogen to humans (Creutzfeld­Jacob
variant?), if the avian flu recombines with human influ­ enza viruses to form new, highly virulent strains and if
HIV was transmitted from the ape to man, who is to say whether or not another occurrence takes place with even more serious consequences? The question is not
“whether or not”; it should read “earlier or later”. Man increases the chance of a corresponding occurrence in nature happening; without this intervention, recombi­ nation and exchange occur naturally and only the
sustainable model gets a chance.
In their recommendations, the ZKBS does not speak of “no risk”, but of a “very low risk” or a “low probability”. In other words, a (residual) risk and a probability do exist. To my knowledge, the Federal
Office for Civil Protection does not explicitly list free nucleic acids under biological agents. Another point to think about.
Literature
Bates, M.K. et al. (2006) Genetic immunization for antibody generation in research animals by intravenous delivery of plasmid
DNA, BioTechniques, 40(2) , 199–208.
Beltinger, C. et al. (1995) Binding, uptake, and intracellular
trafficking of phosphorothioate-modified oligodeoxynucleotides,
J. Clin. Invest. 95(4) , 1814–1823.
Burns, P.A. et al. (1991) Transformation of mouse skin endothelial cells in vivo by direct application of plasmid DNA encoding the human T24 H-ras oncogene, Oncogene 6 , 1973–1978.
Chambers, P.A. et al. (2002) The fate of antibiotic resistance
marker genes in transgenic plants feed material fed to chickens,
J. Antimicrobiol. Chemother. 49 , 161–164.
Chamier, B. et al. (1993) Natural Transformation of Acinetobacter calcoaceticus by Plasmid DNA Adsorbed on Sand and
Groundwater Aquifer Material, Appl. Environ. Microbiol. 59 ,
1662–1667.
Garcia-Olmo, D. et al. (1999) Tumor DNA circulating in the plasma might play a role in metastasis. The hypothesis of genometastasis, Histol. Histopathol. 14 , 1159–1164.
Garcia-Olmo, D. et al. (2000) Horizontal transfer of DNA and the
„genometastasis hypothesis“, Blood 95 , 724–725.
Gewirtz, A.M. et al. (1998) Review Article: Nucleic Acid
Therapeutics: State of the Art and Future Prospects, Blood 92 ,
712–736.
Holmgren, L. et al. (1999) Horizontal Transfer of DNA by the
Uptake of Apoptotic Bodies, Blood 93 , 3956–3963.
Kümmerer, K. et al. (2002) Abschlussbericht Antibiotika-Resistenz und Übertragung in Abwasser, Oberflächenwasser und Trinkwasser Teil 2.
Lisowsky, T. (2006) Natürliche Rekombination und gentechnischmodifizierte Nukleinsäuren: Neubewertungen zur biologischen
Sicherheit, labor&more 2 (1) , 6–9.
Mercer, D.K. et al. (1999) Fate of free DNA and Transformation of the Oral Bacterium Streptococcus gordonii DL1 by Plasmid
DNA in Human Saliva, Appl. Environ. Microbiol. 65 , 6–10.
Nielsen, K.M. et al. (1997) Natural Transformation and Availability of Transforming DNA to Acinetobacter calcoaceticus in Soil
Microcosms, Appl. Environ. Microbiol. 63 , 1945–1952.
Roberg-Perez, K. et al. (2003) MTID: a database of Sleeping Beauty transposon insertions in mice, Nucleic Acids Res. 31 , 78–81.
Romanowski, G. et al. (1993) Use of Polymerase Chain Reaction and Electroporation of Escherichia coli To Monitor the Persistence of Extracellular Plasmid DNA Introduced into Natural Soils, Appl.
Environ. Microbiol. 59 , 3438–3446.
Schubbert, R. et al. (1994) Ingested foreign (phage M13) DNA survives transiently in the gastrointestinal tract and enters the bloodstream of mice, Mol. Gen. Genet. 242 , 495–504.
Schubbert, R. et al. (1997) Foreign (M13) DNA ingested by mice reaches peripheral leukocytes, spleen, and liver via the intestinal wall mucosa and can be covalently linked to mouse DNA, Proc.
Natl. Acad. Sci. USA 94 , 961–966.
Suzuki, K. et al. (1999) Activation of target-tissue immune-recognition molecules by double-stranded polynucleotides, Proc. Natl.
Acad. Sci. USA 96 , 2285–2290.
© 2008 AppliChem • Nucleic acid decontamination

Dr. Karl-Heinz Esser and Prof. Dr. Thomas Lisowsky, multiBIND biotec GmbH, Germany
With the new synthesis of the genome of the highly dangerous 1918 influenza pandemic virus proving that ancient, normally extinct infectious virus particles can resurge in eukaryote cells, a new milestone has been reached in genetic engineering. At the same time, this triggers controversial discussions on the topic of biological safety.
This also requires a re­evaluation of the risk potential inherent in free genetically modified DNA or RNA mol­ ecules. By now, recombinant nucleic acid constructs are produced in growing numbers worldwide. The original assessments of genetic engineering were based on the assumption that free DNA or RNA molecules are not dangerous. Consequently, only the controlled
disposal of genetically modified organisms is mandated by the applicable laws on genetic engineering with
regards to biological safety. Latest studies show, how­ ever, that in certain cases free nucleic acid molecules are sufficient to cause biological transformations,
functional expressions or new genetic recombinations.
In the short run, these occurrences are still infrequent, in the long run, however, and with constantly rising numbers of recombinant nucleic acid molecules, this could lead to grave consequences. Therefore, anybody employing genetic engineering methods should be
interested in minimizing the risk potential of recombi­ nant nucleic acid molecules – as a preventive step as well as in a sustainable way. In the interest of a safe exploitation of genetic engineering as a future key technology, an environmentally safe disposal of recom­ binant DNA and RNA molecules must be ensured. The latest data derived from the current standard method number one for the professional and correct disposal by autoclave treatment have shown that new techno­ logies or solutions have to be developed for this very purpose. By employing the sensitive method of
PCR analysis it could be established that after the autoclave treatment of, for instance, infectious micro­ organisms, big sections or even complete molecules of the DNA remain intact. The current studies highlight a possible gap in biological safety that can be closed by sustainable, long­term safety measures only. The most recent data on the current developments in this area are summarized in this article and practical consequences are proposed based on the example of the endosymbiontic hypothesis of the evolution.
At the beginning of the systematic use of genetic
engineering methods since approximately 1980, no­ body considered free DNA molecules to be potentially dangerous. General opinion was that free DNA mole­ cules would not be able to last long in the environment and that their efficient absorption by living organisms was hardly possible. As a consequence, only geneti­ cally modified organisms were subjected to statutory regulations regarding their safe disposal. To this day, no legal requirements exist anywhere in the world to professionally dispose of free nucleic acid molecules
– whether natural or artificially engineered.
Nucleic acid decontamination • AppliChem © 2008

Table 1 Frequently produced and used recombinant DNA / RNA molecules
Plasmids, vectors Characteristics: small, circular DNA molecules with replication sequences, antibiotic resistance genes and multiple cloning sites for the insertion of foreign DNA.
Fieldsofapplication: most frequent constructs for the amplification of foreign DNA in bacteria, fungi and cell cultures
Artificial chromosomes
Integration cassette
Transposons
Characteristics: Centromere, telomere, insert
Fieldsofapplication: Transfer of particularly big genes or foreign sequences in cells
Characteristics: linear DNA molecules with targeted sequences for the integration in chromosomal regions, antibiotic-resistant genes
Fieldsofapplication: targeted destruction of genes, transfer of new genes
Characteristics: carrier of foreign DNA derived from “jumping” genes
Fieldsofapplication: Insertion of DNA sequences at random genome positions
to inactivate or control the genetic expression
PCR products Characteristics: linear, double-stranded DNA molecules produced by synthesis. Combined with the synthesis of random start primers, in vitro this is today the most universal method of producing any type of DNA molecules.
Fieldsofapplication: universal use in all areas of genetic engineering and molecular biology
DNA vaccines Characteristics: DNA molecules for the transient expression of antigens
Fieldsofapplication: Immunization, selective production of specific antibodies
Viral genomes (DNA/RNA) Characteristics: integration cassettes derived from viral genes
Fieldsofapplication: transfer of foreign DNA into the genome
Antisense DNA/RNA Characteristics: DNA expression molecules for the synthesis of individual strands that are a complement to the known messenger RNA molecules
Fieldsofapplication: blocking of the expression by hybridization with target molecule
Within a very short time, methods of genetic engi­ neering rapidly spread in molecular biology. The engi­ neering of free recombinant DNA or RNA molecules gained a rapidly growing significance. Some of the most important new, artificial recombinant molecules developed in the laboratory have been summarized in table 1. We know from numerous, recent analyses and research papers that all genetic engineering methods employed in laboratories are derived from natural ge­ netic mechanisms. Since the beginning of the evolution of living cells they have been used by nature in even more sophisticated and refined ways. Each accelerated progress and every step forward in evolution can be ascribed to such natural, genetic mechanisms. It is therefore rewarding to look at some basic examples of natural DNA transfer between various organisms. Since to us humans our own history of evolution has always been particularly interesting, we will take a look at our own genome.
Thanks to the human genome project, the entire DNA sequence of the human genetic information is available.
First evaluations revealed that in the course of genetic evolution a multitude of foreign genes and DNA frag­ ments were integrated into the human chromosomes, where they left their marks. Today, there are, for in­ stance, hundreds if not thousands of former bacterial foreign genes that have been integrated in the human chromosomes by natural gene transmission and non­ homologous recombination over a period of millions of years. Today, they at least in part fulfill important and indispensable functions inside the human cells.
The best­researched example of this natural DNA transfer – even between very distinct organisms – is the development of today’s mitochondria. Figures 1A to 1D depict the most important stages of the genetic transfer
© 2008 AppliChem • Nucleic acid decontamination

Fig. 1A-D: Four steps for the
natural transfer of bacterial genes into the cell nucleus
Fig. 1A Bacteria have circular, double-stranded DNA genomes and
eukaryotic cells have linear chromosomes with centromere for
replication. This is an example of each of the genomes, although many of these genes occur in the cell nuclei and the bacteria. A long time ago, in a so-called endosymbiosis, bacteria were absorbed by eukaryotic cells (symbolized by the arrow).
Fig. 1B Upon absorption of the bacteria by the eukaryotic cell,
repeatedly fragments of bacterial DNA molecules were released inside the eukaryotic cells by the degradation processes or dying bacteria.
Over millions of years, various DNA fragments were thus transferred from the bacterial genomes into the cell nuclei.
Fig. 1C Individual fragments of the released bacterial DNA were stably integrated in the chromosomes of the eukaryotic cell.
Fig. 1D Today, the former bacteria are counted among the essential cell organelles or the eukaryotic cell as mitochondria. Also human mitochondria still contain small circular DNA molecules originating from the former bacterial genome. These mitochondrial genomes still contain a few genes. The biggest part of the former bacterial genes, however, has meanwhile been integrated into many different chromosomes. It is estimated that today several hundred old bacterial genes have been integrated in the chromosomes. process as it took place over millions of years and still occurs today. At the beginning stood the absorption of bacteria by a eukaryotic cell. Advantage of this so­ called endosymbiosis was that the bacteria were able to go through metabolism and synthesis processes not ex­ isting in the eukaryotic cell. In return, the bacteria won a new, protected habitat. Over long periods of times of these close ties between two extremely different cells with genes of their own, step after step, individual, free
DNA fragments of the bacterial DNA were spread in the cell through degradation processes and finally, occa­ sionally also penetrated the nucleus. There, the integra­ tion of the bacterial DNA fragments in the chromo­ somal DNA could take place and their functional adaptation to the eukaryotic cell evolved. Residues of these old bacterial genomes still exist today in our hu­ man cells. These small, circular molecules represent but a fraction of the original, complete bacterial ge­ nome. But even these small residual genomes continue to encode some important genes for the functions of these cell organelles. At the same time, the mitochon­ dria represent an even more exceptional example for the complex ways of natural gene transfer. As mito­ chondria contain functional genes of their own, their
Nucleic acid decontamination • AppliChem © 2008

Fig. 2 A closer view into the human mitochondria surprisingly shows that an enzyme of the bacteriophage type executes the transcription of the circular, mitochondrial, residual DNA. This enzyme consists of a single protein and is shaped like a hand with fingers and a thumb. Like a hand, this bacteriophage RNA polymerase encloses the promoter and starts the transcription of the mitochondrial genes from there. This essentially distinguishes the structure of the bacteriophage RNA polymerase from the RNA polymerases of the bacteria and also of the eukaryotes, all of which consist of several different subunits. It is assumed that the gene for the RNA polymerase of bacteriophages moved in a special genetic transfer from a bacteriophage genome to the genome of the bacterium a long time ago. Following the endosymbiosis of this bacterium with the eukaryotic cell, the gene then entered the cell nucleus of the human cell.
Today, this former bacteriophage gene is crucial for the survival of the human cell, since having adapted its functions it now controls the
expression of the mitochondrial DNA. This shows the adaptability of cells and their genetic systems and how nature itself takes advantage of the natural genetic engineering without any prejudice. gene into the endosymbiosis. Currently under discus­ sion is the possibility that the peculiarities of mitochon­ drial transcription and replication are directly linked to the problems in the therapy of HIV viruses. The nucle­ otide analogons employed in AIDS therapy to inhibit the viral replication enzymes also cause damage to the
mitochondrial DNA as a side effect.
The evaluation of the sequence of the human
Y­chromosome identified further astonishing traces of genetic exchange processes. Inside, an unexpectedly high quantity of DNA fragments was detected, derived from the genetic information of viruses. Therefore, the human Y­chromosome by now is called the “graveyard of viral genetic elements”. These viral DNA fragments have their origin in infections of influenza viruses, for instance, in the course of which fractions of virus ge­ netic information were inserted in the chromosomes.
By principle, such insertions can take place in all
23 chromosomes of the human being. The high ampli­ fication and conservation of these viral insertions in the human Y­chromosome are due to its special position.
The Y­chromosome is the only one in the double sets of chromosomes in the cell that does not have a
homologous partner. Therefore, no repair processes exist, where defective or altered DNA areas have to be repaired by or replaced with the suitable second chromosome. Thus, insertions of foreign DNA primarily accumulate on the Y­chromosome and are conserved there.
These are merely three striking examples for the ingenious mechanisms for the natural genetic exchange of cells even across species that has taken place for a long time. Under the respective pressure of selection, the cells explore all possibilities for a faster functional adjustment. Most probably, there are a lot more of similar, natural transcription occurrences still to be
explored by future research. The artificial, recombinant nucleic acid molecules now introduce a new degree of dynamics into the natural developments. Hence, we will present two examples of biotransformation by
recombinant nucleic acid molecules. information has to be translated to RNA and protein. A more detailed analysis of the mitochondrial transcrip­ tion resulted in the biggest surprise. The RNA poly­ merase inside the mitochondria clearly originated from bacteriophages (Fig. 2). Today, the gene for this en­ zyme is located inside the cell nucleus of the human, eukaryotic cell. There, it is transcribed into messenger
RNA, translated in the cytosol and the gene product is then imported into the mitochondria. The origin of this typical gene of a bacteriophage could not yet be
unveiled completely. A lot suggests, however, that a bacterial cell infected with a phage introduced this
Initial laboratory data questioning the innocuousness of free DNA molecules are connected with DNA con­ structs for so­called oncogenes. The identification of genes involved in tumor formation was a big step for­ ward for deciphering the mechanisms responsible for it. Decisive for the problem of free, recombinant DNA molecules proved studies on the effect these free DNA molecules had on endothelial cells of laboratory mice.
A direct application of free DNA plasmids with inser­
© 2008 AppliChem • Nucleic acid decontamination

tions of known oncogenes led to the formation of skin cancer. This would mean that the respective recombi­ nant DNA molecules are absorbed in significant quanti­ ties by skin cells, where they are biologically active.
The cells thus transformed then mutate to cancer cells under the effect of the oncogenes’ gene products.
The latest scientific breakthrough in genetic engi­ neering refers to the artificial reproduction of a long extinct virus. The influenza virus of 1918 triggered one of the last big pandemics with devastating consequenc­ es. Techniques of molecular biology have now made it possible to resurrect this virus after close to a century.
To this end, biological material was removed from vic­ tims of that pandemic, who had been buried in the permafrost soil of Alaska since 1918. From this material, the components of the viral genome were reconstruct­ ed in vitro and newly synthesized by employing ge­ netic engineering methods. Inside cells of laboratory mice, the expression of the viral genes, a replication of the genetic material and finally the new synthesis of the viral proteins and the assembly of complete, infectious virus particles consisting of viral RNA and envelope proteins could be achieved. The resurrection of an old and normally extinct virus now provokes highly con­ troversial discussions regarding the necessity and the benefits of such experiments. These discussions are just starting and deal with all aspects of biological safety.
The examples shown here represent but a small selection from the fascinating variety of natural mecha­ nisms for the transfer of genes and DNA. In nature, successful solutions once developed are being used as often as possible, and across species. The potential for a natural recombination or new combination of genes can be found in all genetic systems. Traces of such exchange processes can therefore be proven in all newly sequenced, complete genomes.
New methods of genetic engineering merely enter a new quality and quantity into this process. On the one hand, processes, normally extending over millions of years, are extremely accelerated; on the other hand, however, completely new combinations of nucleic acid molecules become possible. As the potential to absorb free nucleic acid molecules exists in nature, and since all mechanisms for the integration and new combina­ tion can be found in the most diverse cell types, a re­ sponsible handling of artificial, recombinant molecules mandates that through suitable methods of decontami­ nation, inactivation and destruction be employed to prevent these recombinant molecules from being re­ leased to the environment. This raises the question of how to professionally inactivate and destroy these arti­ ficial recombinant nucleic acid molecules.
Genetic engineering laboratories resort to three
different methods to warrant biological safety. These three established methods to dispose of organisms modified by genetic engineering are antimicrobial
Tab. 2 Important methods for decontamination in gene laboratories
Method Mechanism of action
Antimicrobial • toxic and aggressive substances decontamination • Permeabilization of membranes
• Denaturations
Nucleic acid • aggressive chemicals decontamination • chemical denaturation
• partial degradation of the
nucleic acid molecules
Autoclave treatment • high temperature (120°C)
• high pressure (1.2 bar)
• thermal denaturation
Problems
• no product is effective for all
microorganisms and viruses
• nucleic acids remain intact
• detrimental to health
• products have no antimicrobial effect
• in most cases, only RNA
or DNA molecules are degraded
• insufficient inactivation
• detrimental to health
• can only be employed in laboratories for certain
solutions and materials
• no treatment of surfaces and equipment
• latest studies show that no complete removal
of all bigger nucleic acid molecules
is obtained
Nucleic acid decontamination • AppliChem © 2008

disinfection, DNA decontamination and autoclave treat­ ment. All three methods, however, are individually limited in their effectiveness and application (refer to table 2). Though antimicrobial disinfection inactivates infectious organisms, it does not remove their genetic material. In addition, these products are only selective­ ly efficient against certain microorganisms.
DNA decontamination is obtained through aggres­ sive chemical substances that in most cases do not have an antimicrobial effect and frequently inactivate either
RNA or DNA molecules, while leaving proteins and enzymes intact.
The method considered to be the most effective to­ day is autoclave treatment. In this process, microorgan­ isms are killed under high pressure and at high tem­ peratures, while the nucleic acid molecules are denatured by the thermal exposure and broken down into small fragments. Until recently, it was assumed that under standard conditions of 120°C and 20 minutes of exposure time the nucleic acid molecules were reduced to fragments of a size that did no longer contain com­ plete genes or functional DNA areas. Studies based on
PCR analysis have shown, however, that this is not
always the case. After the autoclave treatment of
infectious microorganisms, for example, bigger­sized nucleic acid molecules continue to be detected.
Today, it is a known fact that a multitude of sophisti­ cated mechanisms exist in nature for the genetic trans­ fer of free nucleic acid molecules. The following issues are crucial in the evaluation of the risk of absorption and new combinations of recombinant nucleic acid molecules in living cells:
2 Recombinant DNA / RNA molecules remain stable
2
2
2
2 in the environment over long periods of time.
Most organisms possess manifold, natural mecha­ nisms for the absorption of foreign DNA.
All organisms possess systems for the new combina­ tion of genes.
Traces of inserted foreign DNA can be detected in the genomes of most of the examined organisms.
These processes extend over long periods of time permitting even very rare occurrences to be taken into consideration.
Problems are caused by the undesired new combina­ tions of genes. Recombinant nucleic acid molecules should consequently be kept away from the natural evolutionary process of genomes by thorough and pro­ fessional decontamination.
This problem can be compared to the prevention of infections in hospitals. This is achieved in a much more sustained and economical way by hygienic measures, than by the later treatment of new infections with anti­ biotics. base technology bioDECONT™ new generation of biological decontamination solutions
Inactivation and destruction of n n n
DNA and RNA
Proteins and lipids bacteria, fungi, viruses fields of application
DNA decontamination
RNasedecontamination microbial disinfection and decontamination product examples
DNA-
ExitusPlus
RNase-
ExitusPlus current product developments
Fig. 3 The new bioDECONT™ base technology permits a great variety of product developments for the solution of specific and universal biological decontaminations.
© 2008 AppliChem • Nucleic acid decontamination

Fig. 4 The autoclave treatment of recombinant bacteria only leads to partial DNA degradation. 50 ml of cultures of recombinant E. coli cultures were autoclave-treated under addition of water (-) or Autoclave-ExitusPlus™ (+) for a period of 20 minutes at 120 °C and under a pressure of 1.2 bar. Subsequently, 10 µl aliquots of these cultures were examined in analytical DNA agarose gels. After the addition of sterile water (-), big quantities of high molecular weight DNA fragments still exist after autoclave treatment. An identical culture with added Autoclave-ExitusPlus™ (+) reveals a degradation of the DNA into fragments smaller than 20 base pairs.
Fig. 5 PCR analysis of the autoclaved E. coli cultures from Fig. 4.
The recombinant E. coli cultures contained a plasmid with the resistance gene for ampicillin (Amp R -Gene). Therefore, 2 µl aliquots of these cultures were tested in PCR reactions with primers for the complete Amp R -Gene after autoclave treatment. The sample of the preparation with sterile water (-) shows strong PCR bands for the complete Amp R -Gene. The sample of the preparation with Autoclave-ExitusPlus™ (+) by contrast does not contain any intact DNA fragments for the Amp R -Gene. As positive control (K), a 2 µl aliquot of the sample treated with Autoclave-ExitusPlus™ was mixed with
2 ng template DNA for the Amp R -Gene. The amplification of the respective
DNA strands in this reaction shows that the PCR can run normally under these conditions.
Fig. 6 Protein gel for the analysis of autoclaved samples without (-) or with (+) addition of Autoclave-ExitusPlus™.
Test solutions of 10 mM Tris, pH 8.0 with BSA (bovine serum albumin) and RNase A were autoclave-treated for 20 minutes after the addition of water (-) or Autoclave-ExitusPlus™ (+) at
120 °C and under a pressure of 1.2 bar. Then, 10 µl aliquots were separated each with 1 µg BSA and RNase A in a 4–12 % polyacrylamide gel and stained with Coomassie blue. The sample with sterile water does not show a significant degradation of proteins, whereas the addition of
Autoclave-ExitusPlus™ (+) leads to a virtually complete degradation of both proteins.
Nucleic acid decontamination • AppliChem © 2008

Conventional decontamination methods for biomole­ cules are time­consuming and employ products that in most cases are toxic or corrosive. These questionable constituents do not only represent dangers to the user; their highly corrosive characteristics can irreversibly damage or even destroy laboratory equipment in the long run.
The development of more efficient and above all innocuous products for the decontamination of active biomolecules is therefore imperative, since the stan­ dard technology of autoclave treatment does not lead to a full inactivation of all biomolecules [1].
In times of increasing dangers emanating from arti­ ficial bio­agents and natural, infectious microorgan­ isms, the demand for suitable decontamination prod­ ucts rises. Apart from recombinant nucleic acids from laboratories, viruses, such as the avian flu pathogen
H5N1 are current topics of discussion. On the other hand, artifacts from contaminations in PCR analyses can result in fatal errors in diagnostic or forensic
examinations.
Already today, the new generation of disinfectants developed by multiBIND from the bioDECONT™ base technology (refer to Fig. 3), meets parts of the new requirements. These products are based on a novel chemico­catalytic mechanism, which does not require the use of hazardous components and yet yields far better results than most of the conventional disinfec­ tants.
In laboratories in particular, it is important to inacti­ vate nucleic acids and certain proteins that would oth­ erwise negatively influence experimental results and could frequently represent a potential danger for the scientist or his objects of examination. The products
DNA­ExitusPlus™ and RNase­ExitusPlus (AppliChem) derived from the bio­DECONT™ base technologies close these safety gaps. Initial studies have shown that both reagents do not only destroy nucleic acids [2] and proteins quite effectively, but also present no danger of damaging surfaces, materials and equipment in the laboratory. Having achieved the objective of surface decontamination, a new bioDECONT formulation for use in the autoclave was developed. This new product,
Autoclave­ExitusPlus, is a powder blend that is directly introduced into the solution to be decontaminated be­ fore autoclaving.
For this test, standard overnight cultures of recombi­ nant Escherichia coli bacteria were autoclaved by add­ ing sterilized water, followed by the same process with
Autoclave­ExitusPlus™ as additive. The results from the
DNA molecule size analysis from these preparations have been documented in Fig. 4. As in the first studies on autoclave treatment of virus particles [1] it can be proven again that even by autoclave treatment, DNA molecules of recombinant bacteria are not completely destroyed and inactivated. DNA binding proteins and other factors within microorganisms apparently pro­ duce a partial protection of the DNA molecules. The addition of Autoclave­ExitusPlus™, by contrast, leads to a virtually complete degradation of all DNA mole­ cules into fragments smaller than 20 base pairs.
Further studies by PCR analysis [3] confirm these findings. Since for many genetic engineering tasks the
β ­Lactamase Gene (Amp R ­Gene), coding for ampicillin resistance, is being used, suitable primers for the am­ plification of the complete Amp R ­Gene were used in these tests (refer to Fig. 5). The PCR analysis shows that the samples of recombinant bacteria that were auto­ clave­treated with sterile water still contain intact Amp R ­
Genes. Only in the samples of recombinant bacteria autoclaved with Autoclave­ExitusPlus™ no further in­ tact Amp R ­Gene can be detected.
These results prove that there is, in fact, a general safety gap when autoclaving recombinant microorgan­ isms, as biologically active DNA molecules are not suf­ ficiently destroyed. Free DNA fragments containing complete genes can be absorbed again by microorgan­ isms or cells and biologically exploited [4]. The rising numbers of recombinant genetic products and new ge­ netic engineering methods call for an improvement of biological safety in all fields of application. Autoclave­
ExitusPlus™ can close this safety gap for biological molecules, as the results have shown that Autoclave­
ExitusPlus™ is perfectly suited as additive in the auto­ clave treatment, where it acts as a catalyst for the safe and efficient degradation of all DNA molecules.
In a second step, the current studies on autoclave treatments were extended to include protein molecules.
Defined protein mixes of bovine serum albumin and
RNase A were prepared in Tris­buffered solutions (10 mM
Tris, pH 8.0) and mixed in one sample with the same quantity of sterile water, in the other sample with Au­ toclave­ExitusPlus™. Following autoclave treatment of these preparations, identical aliquots were analyzed in
SDS­polyacrylamide gel electrophoresis. The difference between both samples is even more pronounced than that of the DNA tests. The autoclave treatment of pro­ teins in aqueous solutions basically leads to a denatur­ ation, but not to a significant degradation of these mol­
© 2008 AppliChem • Nucleic acid decontamination

ecules (Fig. 6). It is no secret that autoclave treatment is not sufficient for the efficient inactivation of particu­ larly thermoresistant proteins, such as many RNases, for example. At present, the only possibility to obtain an extensive RNase decontamination is through auto­ clave treatment by adding diethylpyrocarbonate
(DEPC). DEPC again has a number of other disadvan­ tages, such as a highly toxic and carcinogenic effect, a low boiling point and thus a high volatility. Further,
DEPC leads to a modification of proteins and biomol­ ecules. It is therefore particularly interesting that RNase­
ExitusPlus™ as a purely aqueous solution with unob­ jectionable ingredients, used as additive in the autoclave treatment, acts as a catalyst for a quasi­complete degra­ dation of the tested proteins. Even RNase A, known to be extremely stable and heat­resistant, is very efficient­ ly degraded under these conditions (Fig. 6).
Further systematic studies revealed that there is also a general additional increase in efficiency in DNA­Exi­ tusPlus™ and also in RNase­ExitusPlus when raising the temperature to a range between 30°C and 120°C.
This permits an even more efficient decontamination of materials, surfaces and, in particular, of sensitive and complicated laboratory equipment other than the auto­ clave. The advancing mechanization and automation of synthesis and analysis processes, as well as the produc­ tion in the fields of molecular biology, genetic engi­ neering and biotechnology, results in completely new demands for equipment decontamination. Apart from particularly delicate materials, pipe and hose systems of small diameters require new solutions with regard to biological decontamination. Especially for such appli­ cations, these new products offer special, in some cases unique characteristics:
2 purely aqueous solutions
2 low ionic strength of all components
2 high solubility of all components
2 little affinity to plastic and metallic surfaces
2 low viscosity
2 no volatile substances
2 no temperature­sensitive components
Current tests of our own therefore concentrate on new fields of application, such as the decontamination by the rinsing of hoses, valves, pipes – in particular those with very small diameters – (pipetting robots, produc­ tion equipment, fermenters, etc.), and on additives for heat baths, laboratory dish washers or autoclaves. In applications for particularly critical fields, an additional efficiency increase for the solubilization and inactiva­ tion of contaminations, as well as for their degradation is achieved by raising the temperature to a range be­ tween 30°C and 120°C. Even at increased temperatures, the solutions used do not demonstrate any detrimental effects on the plastic and metallic materials normally used in laboratories.
Nucleic acid decontamination • AppliChem © 2008

The indicated and proven safety gap in the field of bio­ logical decontamination can be bridged with Auto­ clave­ExitusPlus™ and RNase­ExitusPlus. This opens completely new fields of application, such as health, hygiene, foodstuff production and household. In a technological partnership of multiBIND biotec GmbH,
Cologne and AppliChem GmbH, Darmstadt further de­ velopments of these innovative processes and solutions for the decontamination of nucleic acids and proteins are under way. We are certain that this will set new benchmarks for efficient and careful decontamination.
According to the latest findings on the biological effects of free DNA molecules, this is particularly important for biocontainment in the fields of genetic engineering and biomedical hygiene.
Literature
[1] Ho M.-W. et al. (2001) ISIS Report: Unregulated Hazards
‘Naked’ and ‘Free’ Nucleic Acids. Online publication
(http://i-sis.org.uk/naked.php).
[2] Lorenz M.G. & Wackernagel W. (1994) Bacterial Gene
Transfer by Natural Genetic Transformation in the Environment. Microbiological Reviews 58 , 563–602.
[3] Cavalli-Sforza, L.L. (2005) The human genome diversity project: past, present and future. Nat. Rev. Genet. 6 , 333–340.
[4] Grivell, L.A. (1995) Nucleo-mitochondrial interactions in mitochondrial gene expression. Crit. Rev. Biochem. Molec.
Biol. 30 , 121–164.
[5] Masters, B.S., Stohl, L.L. & Clayton, D.A. (1987) Yeast mitochondrial RNA polymerase is homologous to those encoded by bacteriophages T3 and T7. Cell 51 , 89–99.
[6] Tiranti, V. et al. (1997) Identification of the gene encoding the human mitochondrial RNA polymerase (h-mtRPOL) by cyberscreening of the expressed sequence tags database.
Human Molec. Genet. 6 , 615–625.
[7] Lisowsky, T. et al. (2002) The C-terminal region of
mitochondrial single-subunit RNA polymerases contains species-specific determinants for maintenance of intact mitochondrial genomes. Mol. Biol. Cell 13 , 2245–2255.
[8] Cermakian, N. et al. (1996) Sequences homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA polymerases are widespread throughout the eukaryotic lineage.
Nuc. Acids Res. 24 , 648–654.
[9] Lewis, W. (2005) Nucleoside reverse transcriptase inhibitors, mitochondrial DNA and AIDS therapy. Antivir. Ther. 10
Suppl 2 , M13–27.
[10] Lewis, W. (2004) Cardiomyopathy, nucleoside reverse
transcriptase inhibitors and mitochondria are linked through AIDS and its therapy. Mitochondrion 4 , 141–52.
[11] Kjellman C. et al. (1995) The Y chromosome: a graveyard for endogenous retroviruses. Gene 161 , 163–170.
[12] Burns, P.A. et al. (1991) Transformation of mouse skin
endothelial cells in vivo by direct application of plasmid
DNA encoding the human T24 H-ras oncogene. Oncogene
6(11) , 1973–1978.
[13] Tumpey, T.M. et al. (2005) Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science
310(5745) , 77–80.
[14] Kaiser, J. (2005) Virology. Resurrected influenza
virus yields secrets of deadly 1918 pandemic. Science
310(5745) , 28–29.
[15] Taubenberger, J.K. et al. (2005) Characterization of the 1918 influenza virus polymerase genes. Nature 7060 , 889–893.
[16] Kaiser, J. (2005) Biocontainment. 1918 flu experiments spark concerns about biosafety. Science 306(5696) , 591.
[17] Bush, R.M. (2004) Influenza as a model system for
studying the cross-species transfer and evolution of the
SARS coronavirus. Philos. Trans. R. Soc. London B.
Biol. Sci. 359 , 1067–1073.
[18] McCarthy, A.D. & Hardie, D.G. (1984) Fatty acid synthase
- an example of protein evolution by gene fusion. Trends
Biochem. Sci. 9 , 60–62.
[19] Simmon, K.E. et al. (2004) Autoclave method for rapid preparation of bacterial PCR-template DNA. J. Micobiol
Methods 56 ,143–149.
[20] Elhafi, G. et al. (2004) Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction. Avian Pathology
33 , 303–306.
[21] Gibbs, M.J. et al. (2001) Recombination in the hemagglutinin gene of the 1918 „Spanish flu“.Science 293(5536) ,
1842–1845.
[22] Esser, K.-H., Marx, W.H. und Lisowsky, T. (2006) DNA-
Dekontamination: Die Neuentwicklung DNA-ExitusPlus™ im Vergleich mit konventionellen Mitteln, labor&more 1/06 ,
10–11.
[23] Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. (eds)
(1990) PCR Protocols - A guide to methods and applications,
Academic Press, Inc., San Diego, California
[24] Guyot, A. et al. (1999) Molecular epidemiology of multi-resistant Escherichia coli, J. Hosp. Infect. 43(1) , 39–48.
[25] Lisowsky, T. (2006) Natürliche Rekombination und gentechnisch-modifizierte Nukleinsäuren: Neubewertungen zur biologischen Sicherheit, labor&more 1/06 , 6–9.
© 2008 AppliChem • Nucleic acid decontamination

Prof. Dr. Joachim Burger, Tina Capl,
Institute for Anthropology, AG Palaeogenetics, University of Mainz, Germany
Depending on the methodology, contaminations by nucleic acids are perceived sometimes more, some­ times less obviously. Standard PCR reactions of no more than 30 cycles can be considered relatively impassible, as compared to cycle numbers of up to
50, which amplify and make visible even minute con­ taminations or artifacts. The probably most sensitive
DNA analysis is conducted in cleanroom laborato­ ries for old DNA (ancient DNA) of which only a few exist worldwide. One of these laboratories is led by
Prof. Burger at the Mainz University with an enor­ mously high degree of safety precautions impos­ sible to impose on a normal research laboratory.
But also standard molecular­biological laboratories can profit from the latest findings and the safety
precautions for nucleic acid­free work environments and adhere to the most essential fundamental rules.
The safety measures in a cleanroom laboratory concern the entire laboratory setup, the process and the organization of the individual work stages, the training of the laboratory staff and the use of suitable, efficient decontamination products.
Only traces of ancient DNA can be found in the bone and in a degraded condition only. Therefore, it cannot compete with modern DNA, even if the latter is only present in extremely minute quantities. It is simply su­ per­imposed. The difficulty lies in the ability to distin­ guish these contaminations from the endogenous DNA.
In order to avoid the introduction of foreign DNA, par­ ticular precautions are taken when working with an­ cient DNA. First of all, the old bone material is treated in a separate cleanroom laboratory, which is kept free from modern DNA as much as possible. In Mainz, the cleanroom laboratory is strictly separated from other molecular­genetic laboratories in a different building. A
“one­way street regulation” is imposed on everybody:
The rooms termed trace laboratory in Mainz may be accessed by such personnel only that have not yet en­ tered any post­PCR areas on the same day. These post­
PCR areas include the offices and molecular­genetic laboratories of other workgroups. In addition, the per­ son must have taken a shower to remove as many loose skin cells and hair. The person has to wear fresh­ ly cleaned clothes, since PCR products in the air can collect on the clothes or in the hair. The trace labora­ tory is then entered through an air lock. Jackets, bags and shoes cannot be cleaned regularly and conse­ quently have to be taken off and stored in the provided lockers before entering the first air lock. Inside the first room of the air lock, all street wear is taken off with the exception of the underwear. Next, a head scarf, a
T­shirt, face mask, as well as two pairs of gloves are put on, before entering the following room, air lock num­ ber 2. Then, in air lock 2, a one­piece cleanroom over­ all (DuPont Tyvek) and galoshes are put on. After dressing in protective gear, the last pair of gloves is replaced as they have come in contact with parts of the body. Then, a third pair of gloves is put on. The protec­ tive gear and the galoshes are subjected to UV light
irradiation overnight and replaced in regular intervals,
T­Shirt and head scarfs (OR caps available in the lab) are washed at home and brought to the laboratory fresh. When putting on the protective gear, it has to be made sure that the exterior is not touched. In addition, a visor serves to protect the eye zone. This way, the further rooms of the trace laboratory can be accessed.
Upon entering another room and during, as well as in­ between individual working steps, the outermost pair of gloves is replaced.
There are several ways how samples to be used for the isolation of ancient DNA can be contaminated:
Nucleic acid decontamination • AppliChem © 2008

In order to remove this surface contamination, the sam­ ples are first irradiated on all sides in the UV room with ultraviolet light for a minimum period of 30 minutes.
During the following treatment of the samples, the sur­ face is removed as generously as possible with suitable tools (Dremel, circular saw type K10 EWL, KaVo). Next, the bone is crudely reduced to small pieces by using the circular saw with a diamond blade. These small pieces of bone are again irradiated on all sides with ultraviolet light for a period of approximately 30 min­ utes. Now, the bone fragments can be ground to bone­ meal in a ball triturator (MM200 Retsch). ports are subjected to a similar treatment. In case of chemicals, irradiation is frequently not possible. In such cases the vessels are cleaned on the outside and then stored in suitable supply cabinets. Systematic contami­ nation of vessels and chemicals can be proven by emp­ ty controls over all working steps. For the extraction and the PCR, as well as for the production of several re­ agents HPLC water is required, which has also been ir­ radiated with a waterproof UV lamp overnight while being constantly agitated by a magnetic stirrer with magnetic stir bar. Tap water for rinsing is obtained from an osmosis installation and irradiated under permanent agitation for a minimum of 24 hours.
This type of contamination play a particular role pri­ marily in human samples, as in animal samples a suit­ able primer design (mismatches to the human DNA) can prevent an amplification of contaminations. In hu­ man samples, however, it is difficult to distinguish a contamination of the endogenous bone DNA in hind­ sight, since this contamination is also human DNA. To minimize the contamination with human DNA, the people ideally wear masks and gloves during excava­ tion already to prevent a transfer of DNA. In some cases (particularly with museum pieces) it cannot be discounted that the bone samples have already passed through several hands. It is also possible that archeolo­ gists wash samples directly after excavation on site, introducing contaminations of the workers or from the water deep into the bone. These contaminations can be largely eliminated by the surface removal and the irra­ diation. By comparing the results with the genotypes of all laboratory staff and the workers not in the working team (e. g., archeologists), contaminations can be de­ tected. Apart from this, each PCR is accompanied by one or several empty controls and extraction controls.
In the laboratory, contaminations by workers are re­ duced to a minimum by the above described procedure on donning the correct protective clothing.
All objects, packing and containers are similarly entered into the trace laboratory through the air lock. Inside air lock 1 they are cleared of packing as far as this is pos­ sible and washed with UV­irradiated soap water and
DanKlorix or DNA­ExitusPlus™, respectively. Reaction vessels are irradiated overnight in the UV room while they are left open. Pipet tips and reaction vessel sup­
If amplified PCR products are transferred to samples, these can hardly be identified as they can correspond to the desired amplification product. This type of con­ tamination can be minimized by strictly separating the pre­ and post­PCR areas and by following the one­way street rule. Apart from the staff, the one­way street rule also extends to all objects and chemicals. No person or object, nor any consumables may be taken from the post­PCR area to the pre­PCR area. Therefore, the con­ sumables are directly delivered to the air lock of the trace laboratory.
By sloppy work, the DNA of one sample can be trans­ ferred to another. To avoid this type of contamination, all utensils and work surfaces are carefully cleaned with soap water and bleach in­between individual sam­ ples. The equipment (e.g., tweezers, pliers, saw blades) and the surfaces should incubate for some time (mini­ mum 10 minutes) with DanKlorix or DNA–ExitusPlus™, to permit an optimal reaction. Before starting to work on a new sample, the outermost pair of gloves should be replaced with a new one. To avoid a carry­over of the DNA by aerosols, the reaction vessels of different samples should not be open at the same time during the extraction and the PCR.
By carrying along the empty controls, a contamina­ tion can normally be detected and examined more closely through further empty controls and PCRs, if in doubt about the origin (e.g., in case of contaminated chemicals). To remove contaminations, all work sur­ faces and laboratory rooms are irradiated at night for a period of six hours by a timer­controlled UV installa­ tion. Despite all these measures for the prevention of contaminations, same cannot be ruled out completely.
© 2008 AppliChem • Nucleic acid decontamination

Dr. Karl-Heinz Esser 1 , Dr. Wolfram H. Marx 2 und Prof. Dr. Thomas Lisowsky 1
Fundamental rules and rules of conduct for a nucleic acid­free working environment (as far as this is possible) are just starting to be defined. After 30 years of molecular­biological and genetic engi­ neering work, many laboratories are more or less contaminated with residues of old, recombinant
DNA constructs. The sources for contamination are manifold and complicated, as the article on the structure and organization of a cleanroom DNA laboratory shows. The high stability of DNA mole­ cules bound to surfaces, dried up in dust particles or on glass, is another problem. One major source of contamination is the air conditioning of rooms,
freely distributing by its constant circulation of the air flow microorganisms, cells and dust particles with DNA. The known primary causes for nucleic acid contamination in the laboratory have been compiled in a list (table 1). The sequence of causes within that list normally correlates to the frequency of the contaminations caused.
1 multiBIND biotec GmbH
2 AppliChem GmbH w.marx@applichem.de
To many it comes as a surprise that one of the main sources of nucleic acid contamination in the laboratory is the autoclave! Perfectly as the autoclave may be suit­ ed for the inactivation of living organisms, it is badly suited for the sustained degradation of nucleic acid molecules (Elhafi et al . 2004, Simmon et al . 2004). DNA molecules in recombinant microorganisms are simply fragmented inside the autoclave and then released and distributed in the room in large quantities with the va­ por when opening the autoclave. The statistical size of such fragments with 1 to 2 kb is ideal for amplifications in PCR reactions or for transformations. Therefore, cleanroom laboratories for DNA analysis have mean­ while removed the autoclaves from their immediate working area.
Also water from pipes, taps, distillation apparatuses or water baths are carriers of and habitat for many mi­ croorganisms that contribute to a variety of contamina­ tions with their endogenous DNA. Particularly prob­ lematic are legionellae, that can also survive higher temperatures of up to 70 °C and cause serious health problems in the water for domestic use. (Fields et al .
2002, Makin 2005). The development of fast, molecu­ lar­biological diagnostic tests was required to grasp this health problem in all its wide­ranging consequences and to have this problem under control by implement­ ing respective measures. At the same time, these new molecular­biological tests revealed an additional prob­ lem, because the tests showed that theoretically, all commercial DNA preparation kits can be contaminated with legionellae in the course of their production pro­ cess already, resulting in false positive tests in analytical
PCR (Evans et al . 2003, Peters et al . 2004, Zee et al .
2002). Today, these problems exist for all PCR tests destined to prove microbiological contaminations by bacteria, fungi or viruses.
Since the analytical PCR today has become so sensi­ tive that even single nucleic acid molecules lead to false positive signals, a sustained decontamination in
Nucleic acid decontamination • AppliChem © 2008

Table 1
Sources for nucleic acid contamination
Room ventilation
Autoclave
Laboratory water
Chemicals
Solutions and buffer
Reagents/kits already contaminated at the supplier’s
Reagents/kits
(cross contamination by careless handling)
Centrifuges
Multiple-use laboratory vessels
(centrifuge beaker, test tubes, flasks, etc.)
Workers (hair, skin cells, sweat, individual way of working)
Table 2
Conversion of DNA quantity to the number of DNA molecules
MW per base pair of double-stranded DNA
MW per base pair of double-stranded DNA x 1000 bp
Conversion into the µg unit
650 g/Mol
650 kg/Mol
650 kg/Mol = 6,5 x 10 11 µg/Mol
1 Mol contains 6.023 x 10 23 molecules
No. of molecules per 1 µg of DNA of a 1000 bp fragment 6,023 x 10 23 : 6,5 x 10 11 ≈ 10 12
1 µg of DNA fragments with 1000 bp contains approx. 10 12 DNA molecules
1 ng of DNA fragments with 1000 bp contains approx. 10 9 DNA molecules
1 pg of DNA fragments with 1000 bp contains approx. 10 6 DNA molecules this area is of particular importance. To properly assess the problem of DNA contamination, one has to have an idea of how many DNA molecules are contained in a defined quantity of DNA. As many DNA fragments for amplification and cloning operations are in the range of 1000 bp, we took as an example the calculation of those DNA molecules that contain 1 µg of DNA at frag­ ments of a length of 1000 bp.
To do this, the molecular weight has to be known, as
1 Mol of a substance contains 6,023 x 10 23 molecules.
The molecular weight for one base pair of a double­ stranded DNA is 650 g/Mol.
Thus, for 1000 bp of a double­stranded DNA we get:
650 kg/Mol or 6.5 x 10 11
6,023 x 10 23
µg/Mol
divided by 6.5 x 10 11 equals the number of molecules per 1 µg of DNA with 1000 bp fragments.
The basic data for the conversion of the DNA quan­ tity to the number of molecules have been summarized in table 2 for better understanding.
In molecular­biological or genetic engineering laboratories, several µg of DNA are synthesized in a small PCR reaction of 50 µl already; medium­sized
DNA plasmid preparations result in DNA quantities in the milligram range and bigger preparations even in the gram range.
Contaminations in the µg range already can hardly be removed by washing with standard detergents, as even a thousandfold or a hundred thousandfold diluti­ on still leaves 10 9 or 10 6 DNA fragments behind.
A similar problem of the combination of very small particles in combination with a high number of particles can be found in the field of disinfection for the decontamination of problematic microorganisms.
Therefore, reduction rates were defined that are sup­ posed to reduce the contamination to a certain limit value. A reduction rate of 10 5 is considered excellent.
Apart from the information on reduction rates, there are limit values in the field of disinfection that can be reached and that define, what microbiological burden is still acceptable for which application. From
© 2008 AppliChem • Nucleic acid decontamination

Table 3
Main “chemical” classes of detergents
Typical ingredients
Effect on materials and skin
Mineralic acids HCl, H
3
PO
4
Alkaline products KOH, NaOH highly corrosive highly irritating highly corrosive highly irritating
Radical products NaOCl
H
2
O
2 highly corrosive highly irritating
DNA-ExitusPlus™ synergistic acting non-corrosive mixture of biomolecules and mild organic acid slightly irritating
Effect on DNA Effect on RNA partial degradation denaturation denaturation partial degradation partial degradation modification modification fast degradation fast degradation
Incubation
Fig. 1 Testing DNA degradation by selected, conventional DNA decontamination products compared to DNA-ExitusPlus™.
200 ng of CCC plasmid DNA each were treated in 10 µl of water with 5 µl of the indicated solutions for 3 and 10 minutes, respectively, at ambient temperature. Next, a bromophenol blue buffer solution was added and denatured for 3 minutes at 92 °C. The denatured samples were immediately cooled down to 4 °C and loaded onto the gel in their entirety. After gel electrophoresis, the DNA was stained with ethidium bromide in a 1% agarose gel and photographed. The control (K) shows the intact CCC plasmid DNA (7 kb; 200 ng, 10 µl) after treatment with sterilized water
(5 µl). By introducing strand breakages, fragments of a lower molecular weight are the result. These can be identified in the gel by comparison with the control and by the molecular weight marker (M; 1 kb ladder).
Under these conditions, reagents X1–X4 show virtually no degradation of the test DNA. In sample D (conventional DNA-Exitus™), only a partial degradation can be observed under these conditions. Only DNA-
ExitusPlus™ (D+) shows a very fast and nearly complete DNA degradation after 3 minutes already, leaving only a small residual fraction of fragments smaller than 500 base pairs that can be identified. After ten minutes, no further DNA can be detected under these assay conditions.
Fig. 2 PCR test to prove the complete removal of DNA contaminations by DNA-ExitusPlus™. Various quantities (0.1 to 1 ng) of a test DNA were dried in PCR tubes. These PCR tubes with the dried up DNA were treated with either sterile water or with DNA-ExitusPlus™ for a period of
20 seconds. Subsequently, the tubes were rinsed twice with 100 µl of sterile distilled water each. Then, 50 µl of a PCR mix were filled into the tubes and the PCR was conducted. The PCR mix contains primer pairs for the amplification of the control DNA and the test DNA. The control
DNA (1 ng) is added to all samples and indicates, whether or not the PCR was successful. One band of the test DNA shows, whether still intact
DNA molecules were present as template for the PCR. In case of a complete removal or degradation of the test DNA, no respective DNA bands should be amplified by the PCR. After gel electrophoresis in a 1 % agarose gel, the DNA was stained with ethidium bromide and photographed. In a negative control with sterile water (H
2
O) DNA bands are amplified for the test and the control samples. In the samples with DNA-
ExitusPlus™, only the control DNA is amplified. By their treatment with
DNA-ExitusPlus™, all templates of the test DNA were removed or destroyed.
Nucleic acid decontamination • AppliChem © 2008

practice it is obvious, that a complete removal of all germs is impossible. Thus, even for THE foodstuff of drinking water, the limit value of 10 2 germs per liter is still acceptable.
To this day, not only the definition of limit values for the contamination and the definition of reduction rates for the decontamination products are lacking for the field of nucleic acid decontamination; a standar­ dized, accepted test is not available either. Similar to the microbiological burden it can be assumed that for nucleic acids most products can produce depletion within certain limits only as well.
This leads to the question of how the currently available nucleic acid decontamination products work and what degree of reduction of problematic DNA and /or RNA molecules can be obtained?
As already mentioned, the established deconta­ mination products derive from classic detergents and disinfectants. As is the case with detergents, there are three major classes: I.) Aggressive mineralic acids, such as phosphoric acid or hydrochloric acid, II.)
Bases, such as NaOH or KOH, and III.) Highly radical products, such as chlorine bleach (“bleach”) NaOCl or H
2
O
2
. The most important representatives and their characteristics have been summarized in table 3.
A special exception among the nucleic acid decon­ tamination products is the new DNA­ExitusPlus™, which was specifically developed for nucleic acid decontamination and degrades DNA, as well as RNA quickly and completely (Fig. 1); at the same time, it is gentle to the skin and to materials. All components are biodegradable.
The user can see the features and disadvantages of the various products at first glance when looking into the product information/instruction leaflet. Dangerous products can usually be identified quickly by the warnings, such as highly corrosive, highly irritating and/or harmful, vapors or aerosols must not be inhaled, application under fume hood is recommended or even mandatory.
Depending on their effect on nucleic acids, the products can be divided into three groups: denatura­ tion, modification and degradation. These are clearly discernible in the analytical DNA gel.
When using analytical gels to prove DNA degra­ dation, several important basic rules have to be obser­ ved. Many of the aggressive chemicals contained in the established products prevent the proof of DNA by ethidium bromide staining as they destroy the color! If no color appears, this gives the impression that the gel does no longer contain any DNA, although big quanti­ ties of unstained DNA remain in the background of the gel. Therefore, the product has to be either removed, or diluted or neutralized before gel analysis. Another point that is frequently overlooked is the denaturation of double­stranded DNA before application to the gel.
Since double­stranded DNA does not disintegrate into small fragments even in case of a great number of single strand breakages, no comparable and reprodu­ cible results for the DNA degradation can be obtained, unless all samples were completely denatured by hea­ ting them up to a minimum of 90 °C for three minutes prior to their application to the gel.
Analytical DNA gels with samples thus treated offer a first indication for controlling the effectiveness of nucleic acid decontamination products. However, these alone are not sufficient. Only the combination of analytical DNA gels and PCR tests permit a sufficient control of remaining DNA contaminations.
In PCR reactions, too, important control steps have to be included. A positive zero control has to accom­ pany the testing at all times, which shows that the PCR is not impeded. Many researchers, for instance, take swab samples of laboratory benches or surfaces after decontamination without sufficiently removing the decontamination reagent first. Even minute residues from these products, in particular the highly aggressive products, inhibit any PCR. Here, too, the inhibited PCR feigns the non­existence of amplifiable DNA despite the fact that the reaction mix contains many DNA molecules. This problem can only be detected by a respective positive zero control. For the test PCR it is just as important to select DNA fragments that are not too big. Bigger DNA fragments of more than 1 kb can be easily inactivated by a single nick, again regularly leading to an underestimation of the effectiveness of decontamination products, insufficient exposure times and contaminations by small DNA fragments. (Fig. 2).
The particular consequences from these findings for successful nucleic acid decontamination in prac­ tice will be outlined in more detail in the following chapter.
© 2008 AppliChem • Nucleic acid decontamination

Until recently, no products developed specifically for nucleic acid decontamination existed. As described earlier, users resorted to conventional, aggressive, chemical substances from the field of cleaning and disinfection. The effectiveness of these products was not specifically destined for nucleic acid deconta­ mination and they are characterized by highly
corrosive and hazardous ingredients.
The first targeted product development of a sustainable and at the same time non­aggressive nucleic acid de­ contamination product under the brand of the new
DNA­ExitusPlus™ also permits completely new appli­ cations; these have been summarized in the following paragraphs.
Nucleic acid decontamination • AppliChem © 2008

Dr. Karl-Heinz Esser 1 , Dr. Wolfram H. Marx 2 und Prof. Dr. Thomas Lisowsky 1
Modern genetic engineering shows that in many
cases free DNA molecules are sufficient to cause infections, recombination or biological transformations [1, 2]. In addition, verification procedures for
DNA molecules become increasingly sensitive. As a consequence, detecting contaminations or preventing amplification artifacts become more and more important for PCR in genetic engineering, criminology, biomedicine and hygiene. The complete decontamination of equipment and materials from DNA molecules thus advances to a decisive factor in the provision of biological safety.
1 multiBIND biotec GmbH
2 AppliChem GmbH w.marx@applichem.de
In DNA decontamination we distinguish between three basic principles for the destruction or inactivation of genetic information, depending on the molecular mode of action of the agents involved:
1.) Modification, which leaves the DNA strand intact and only blocks the reading;
2.) Denaturation, i. e., following a renaturation an in­ tact nucleic acid molecule could well be present again and
3.) Degradation, e. g., by adding DNase or chemical decomposition. Depending on the composition of the agents, these three principles can be employed individually or in combinations.
This knowledge compelled us to examine the molecular mode of operation of the DNA decontamination agents on the market today. For this purpose, the characteris­ tics of the conventional agents were compared with our own product DNA­ExitusPlus™ under a very high
burden (big DNA surplus) with defined DNA contami­ nations. As a test system, we employed a DNA strand breakage test specifically developed for this purpose.
This DNA degradation test permits a sensitive, quantita­ tive comparison of speeds of the DNA degradation.
Quite unexpectedly we found out that some of the well­known commercial agents exclusively work on the principle of modifying or denaturing the DNA
molecules. The DNA strands are not degraded (Fig. 1); the genetic information encoded by these DNA strands are simply just masked. A chemical unmasking of the
© 2008 AppliChem • Nucleic acid decontamination

DNA molecules by removing the blocking groups, the genetic information would become readable and am­ plifiable again. With today’s standard of knowledge regarding genetic engineering and the problems inher­ ent in new combinations of genetic material, such agents should be considered no longer up­to­date. But also agents leading to a verifiable degradation of DNA strands effect a partial degradation at best. Here as well sizeable DNA fragments remain, which in part can still contain the complete genetic information or at least part of it.
The strand breakage activity of DNA­ExitusPlus™ is in­ dependent from the size of the DNA fragments and is triggered chemically, not enzymatically. For verification purposes, a 760­bp PCR product was incubated with
DNA­ExitusPlus™ (Fig. 2). As could be expected, the primers become undetectable first. After five minutes of incubation time with DNA­ExitusPlus™ virtually every­ thing is gone. To clarify: assuming we had an activity theoretically introducing 100,000 Nicks per minute into
DNA molecules, it is evident that this would lead to a degradation of all DNA fragments regardless of their size. Only the smaller fragments will have disappeared faster than the bigger ones. Therefore, a small fraction of fragments sized between 200 and 500 bp of a test molecule of 6 kb in CCC form remains detectable after five minutes. After 10 minutes, only fragments smaller than 20 bp can still be detected (refer to Fig. 1 and 2, respectively). These, however, statistically show a com­ plete random distribution and do not represent a single class of molecules. Hence, the PCR will also come back negative for this fraction. By spraying DNA­ExitusPlus™ on laboratory benches, a huge surplus results since ap­ proximately 1 to 5 ml of solvent attack minute DNA quantities. RNA molecules are destroyed within short­ est periods of time as well (Fig. 3).
When incubating DNA with DNA­ExitusPlus™ or an­ other DNA decontamination agent and then applying a sample of this preparation to an agarose gel without prior neutralization or denaturation, no quantifiable de­ termination of the DNA degradation will be obtained, as many DNA fragments continue to stay attached even after strand breakage and thus form bigger units. 10 to
20 homologous base pairs are sufficient to hybridize even smallest DNA fragments to form bigger units. This
DNA fragment hybridizing phenomenon with “sticky ends” to form bigger units is also known from the prov­
Fig. 2 Degradation of a PCR product and the primers by DNA-ExitusPlus™. To verify the degradation of smaller DNA fragments, 500 ng of DNA per sample of a PCR with a 750 bp PCR product and the respective primers were incubated for the indicated time periods (1, 2, and 5 minutes) with DNA-ExitusPlus™. +5 µl of DNA with 5 µl
DNA-ExitusPlus™; C control 5 µl of DNA with 5 µl of water; M molecular weight marker 1 kb ladder. After treatment, the DNA was denatured for 2 minutes at 95 °C.
Nucleic acid decontamination • AppliChem © 2008
Fig. 1 Testing of DNA degradation by selected, conventional DNA decontamination products in comparison to DNA-ExitusPlus™.
Samples of 200 ng CCC Plasmid DNA each were treated in 10 µl water with 5 µl of the respective solutions for 3 and 10 minutes respectively at ambient temperature. Next, bromophenol blue buffer was added to the preparations and they were denatured for 3 minutes at 92 °C. The denatured samples were immediately cooled down to 4 °C and applied to the gel in their entirety. After gel electrophoresis in a 1 % agarose gel, the DNA was stained with ethidium bromide and photographed.
Control (K) shows the intact CCC plasmid DNA (7 kb; 200 ng, 10 µl) after treatment with sterilized water (5 µl). Inserting strand breakages creates fragments of a lower molecular weight. These can be identified in the gel by comparing them with the control and the molecular weight marker (M; 1kb ladder). Under these conditions, products X1-X4 show virtually no degradation of the test DNA. In sample D (conventional
DNA-Exitus™), only partial degradation can be observed under these conditions. Only DNA-ExitusPlus™ (D+) produces a very fast and nearly complete DNA degradation after 3 minutes already; only a small remaining fraction of fragments smaller than 500 base pairs can be identified. After 10 minutes no further DNA can be detected under test conditions.

Fig. 3 RNA degradation by DNA-ExitusPlus™
5 µl with 1 µg total RNA of E. coli were mixed with 5 µl of the listed solutions and incubated at RT for the indicated time periods. Then, the samples were mixed with a buffer solution, heated to 60 °C for 2 minutes and directly loaded onto an agarose gel of 1.5% with formamide/formaldehyde as denaturing agents. After rinsing and renaturing of the gel, the RNA was stained with EtBr (L rRNA: large ribosomal RNA; s rRNA: small ribosomal RNA).
M: 1 kb ladder
K: Control (sterilized water)
1: D+ 0.5 minute
2: D+ 1 minute
3: D+ 2 minutes
4: D+ 5 minutes
5: RNaseA (10 ng/5 minutes)
Fig. 4 PCR Test to verify the complete removal of DNA contaminations with DNA-ExitusPlus™. Various quantities (0.1 to 1 ng) of a test DNA were dried in PCR tubes. These PCR tubes with the dried-up DNA were treated for 20 seconds with sterile water or DNA-ExitusPlus™.
Subsequently, the tubes were rinsed twice with 100 µl of sterile, distilled water each. Then, 50 µl of a PCR mixture were filled into the tubes and the
PCR was started. The PCR mixture contains primer pairs for the amplification of the control DNA and the test DNA. The control DNA (1 ng) is included in all samples and indicates, whether or not the PCR was
successful. One band of the test DNA indicates, whether intact DNA molecules were still present as template for the PCR. In case of a complete removal or destruction of the test DNA, the PCR was not supposed to amplify respective DNA bands. After the gel electrophoresis, the DNA was stained with ethidium bromide in a 1% agarose gel and photographed. In the negative control with sterilized water (H
2
O) the DNA bands are amplified for the test and the control sample. In preparations with DNA-
ExitusPlus™ only the control DNA is amplified. By treatment with DNA-
ExitusPlus™ all templates of the test DNA were either removed or destroyed. en λ ­DNA size standards for electrophoresis, which have to be denatured for this very reason before ap­ plication.
Further, the reagents of other suppliers frequently contain high concentrations of strong acids or bases.
Even swab samples on laboratory benches after the application of these products contained such high quantities of agents that they would block the PCR in spite of high dilution. Without neutralizing these sam­ ple preparations you will notice that depending on the pH value, the color indicator bromophenol blue in the loading dye changes color (color changes at pH 3­4.6 from greenish­yellow to blue­violet). If a respective sample is applied to a gel, it can be observed that the gel pocket can be destroyed by the chemicals. Neither can ethidium bromide be employed under these cir­ cumstances, since this dye is destroyed under extreme conditions as well and DNA staining becomes im­ possible. The gel lane appears completely transparent although large quantities of unstained DNA molecules are still present in the background.
By first neutralizing the sample with Tris buffer, the
“correct” color of the bromophenol blue appears again.
Depending on the characteristics of the various prod­ ucts, either 100 mM Tris pH 12 or 100 mM Tris pH 3 are required for neutralization. For DNA­ExitusPlus™/
DNA sample mixture of 1:1, the buffer capacity of stan­ dard buffer solutions is absolutely sufficient to preserve the stability of all components. If the color of the bro­ mophenol blue buffer indicates a successful neutraliza­ tion of the samples, they are denatured for a period of two minutes at 90 °C immediately prior to their loading on the gel.
Figure 4 depicts the efficient destruction of DNA molecules by DNA­ExitusPlus™ through PCR analysis.
A positive control of the PCR with a mixed sample from a defined template and an aliquot of the swab sample are always necessary.
Today, only non­standardized PCR tests are consid­ ered state­of­the­art for the verification of successful
DNA decontamination. If the selected test template size is too big, while their concentration and dilutions are very low and rinsing is performed with sterile water, the significance of the tests is difficult to judge.
Another disadvantage of conventional decontamination agents becomes obvious by testing the corrosive poten­ tial of the various solutions. For this purpose, metallic surfaces were incubated with identical aliquots of the agents for a period of 20 minutes. The selected metals are representative for standard appliances and equip­ ment commonly used in laboratories (Fig. 5). It was
© 2008 AppliChem • Nucleic acid decontamination

Fig. 5 Testing the corrosive potential of various commercially available DNA decontamination products in comparison with
DNA-ExitusPlus™. For this test, standard metals normally used for laboratory equipment or surfaces were selected. 10 µl each of the listed solutions were sprinkled on the selected metallic surfaces. Sterilized water served as control (0). After 20 minutes of incubation, the solutions were wiped off and the metallic surfaces rinsed with water and dried. The metallic surfaces were then photographed. Reagents X2,
X3 and D (from Fig. 1) for DNA decontamination in most cases result in strong, irreversible corrosion and a destruction of the surface. With
DNA-ExitusPlus™ (D+) no destruction of the surface could be observed.
In some cases the so-called polishing effect without any damage to the surface was produced by the removal of dirt or oxide layers.
Fig. 6 Autoclave treatment of recombinant bacteria: Studies of DNA degradation.
50-ml-cultures of recombinant E. coli cultures were subjected to autoclave treatment for 20 minutes at 120°C and under a pressure of
1.2 bar after adding identical quantities of water (-) or DNA-ExitusPlus™
(+). Next, 10 µl aliquots of these cultures were examined in the analytical
DNA agarose gel. By adding the same volume of sterile water (-), high quantities of higher molecular weight DNA fragments remain present after autoclave treatment. An identical culture where the same volume of DNA-ExitusPlus™ (+) was added, produced a DNA degradation into fragments smaller than 20 base pairs.
Fig. 7 PCR analysis of the autoclaved E. coli cultures from figure 6.
The recombinant E. coli cultures contained a plasmid with the resistance gene for ampicillin (Amp R -Gene). Therefore, after the autoclave treatment, 2 µl aliquots of the cultures were tested with primers for the complete Amp R -Gene in PCR. The sample preparation with sterile water
(-) shows a strong PCR band for the complete Amp R -Gene. The sample preparation with DNA-ExitusPlus™ (+) by contrast, does not contain any intact DNA fragments for the Amp R -Gene. For positive control (K), a 2 µl aliquot of the same sample treated with DNA-ExitusPlus™ was mixed with 2 ng of template DNA for the Amp R -Gene. The amplification of the respective DNA band in this reaction shows, that the PCR reaction can run normally under these conditions. revealed that all known commercial agents contain ag­ gressive chemical components causing corrosion, and which are detrimental to health. Known components of the conventional products are azides, mineralic acids such as phosphoric acid or hydrochloric acid, aggres­ sive peroxides or highly corrosive substances such as sodium hydroxide. As a consequence, after a mere 20 minutes of exposure time strong and irreversible corro­ sion could be detected on the various metallic surfaces
(Fig. 5). Here, in this test, the advantages of the newly developed and patented DNA­ExitusPlus™ become particularly apparent. Under similar conditions, DNA­
ExitusPlus™ was additionally tested on a great variety of plastic surfaces without causing any corrosion or other damages (data not shown). Thus, DNA­
ExitusPlus™ offers a highly effective, yet at the same time nonaggressive alternative to conventional products.
Nucleic acid decontamination • AppliChem © 2008

It is extremely difficult to remove dried up
DNA residue from surfaces. Even by autoclave treatment they are not sufficiently degraded. After the autoclave treatment of virus particles, for instance, complete virus genomes could still be detected [11].
This is especially the case, if nucleic acids are protected by protein envelopes (e. g., viruses) or within microor­ ganisms (e. g., bacteria). Further, this method is re­ stricted to the decontamination of heat­resistant sur­ faces of smaller items, but not for work surfaces or workbenches. The reaction time of DNA­ExitusPlus™ corresponds to the exposure time. After 10 to 20 min­ utes, the sprayed­on product has dried up. DNA­Exi­ tusPlus™ not being heat­sensitive due to its chemical composition and not containing any volatile substances that are detrimental to health, the activity of the reagent could be tested with increased temperatures on bacte­ ria cultures and their nucleic acids. (Fig. 6 and 7).
It was revealed that only the addition of
DNA­ExitusPlus™ efficiently degrad­ ed bacterial DNA, whereas compara­ tive samples in media or water under today’s standard conditions always prove positive – surprising and shocking at the same time.
Hence in view of the results on hand, the PCR test alone as control of a complete removal of DNA molecules has to be looked at critically. Such a PCR test will also lead to a negative result with decontamination products that simply modify or mask the
DNA, even if the DNA molecules are neither removed nor destroyed. A complete evaluation of the decontamination potential of any product conse­ quently can be obtained only through a combination of the PCR analysis and a DNA degradation test.
The current standard method of autoclave treatment has to be viewed just as critical, as according to the knowledge available today
DNA molecules from viruses or microorganisms are not sufficiently inactivated by this process.
Summary of the particular characteristics:
1. Through catalytic and cooperative effects of the
solvent components, a very fast non­enzymatic, se­ quence­unspecific degradation of DNA and RNA molecules is obtained.
2. All components of the DNA­ExitusPlus™ solutions are biodegradable, harmless to humans and non­toxic.
3. No aggressive mineralic acids or bases are being used; even after prolonged exposure times
equipment and materials are neither attacked, nor damaged or destroyed.
4. When sprayed on surfaces, no hazardous aerosols
(aqueous solutions!) are produced.
5. Increasing the temperature to more than 50°C
accelerates the reaction time and effectiveness.
© 2008 AppliChem • Nucleic acid decontamination

Literature
[1] Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J.
(eds) (1990) PCR Protocols – A guide to methods and
applications. Academic Press, Inc., San Diego, California
[2] Cavalli-Sforza, L.L. (2005) The human genome diversity project: past, present and future. Nat. Rev. Genet. 6 ,
333–340.
[3] Oliver, S.G. (1996) From DNA sequence to biological function. Nature 379 , 597–599
[4] Tumpey, T.M. et al. (2005) Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science
310 (5745), 77–80.
[5] Burns, P.A. et al.(1991) Transformation of mouse skin endothelial cells in vivo by direct application of plasmid
DNA encoding the human T24 H-ras oncogene.
Oncogene 6 (11), 1973–1978.
[6] Moniz, M. et al. (2003) HPV DNA vaccines Front. Biosci.
8 , d55–68.
[7] Gibbs, M.J. et al. (2001) Recombination in the hemagglutinin gene of the 1918 „Spanish flu“.Science 293 (5536),
1842–1845.
[8] Kaiser, J. (2005) Biocontainment. 1918 flu experiments spark concerns about biosafety. Science 306 (5696), 591.
[9] Kaiser, J. (2005) Virology. Resurrected influenza virus yields secrets of deadly 1918 pandemic. Science
310 (5745), 28–29.
[10] Guyot, A. et al. (1999) Molecular epidemiology of multiresistant Escherichia coli. J. Hosp. Infect. 43 (1), 39–48.
[11] Elhafi, G. et al. (2004) Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction. Avian Pathology
33 , 3003–306.
1. The optimum incubation period for surfaces is 10 minutes. Wiping DNA­ExitusPlus™ off the surfaces
BEFORE it has completely dried up (still possible after approx. 10 to 15 minutes), is completely suf­ ficient. A subsequent rinsing with sterile water is completely unnecessary. This is an important new characteristic as compared to the conventional, ag­ gressive decontamination products. An additional rinsing with sterile water – mandatory in these cases
– could introduce new contaminations.
2. Once the solution has dried up completely, no fur­ ther decontamination effect can take place. In case of high contaminations it is therefore recommended to repeat the cleaning process.
3. DNA­ExitusPlus™ residues on surfaces: This was examined by extensive spraying of glass and Per­ spex surfaces with DNA­ExitusPlus™ and letting it dry up completely WITHOUT wiping or rinsing. To detect undesired DNA­ExitusPlus™ residues on sur­ faces, a color indicator was added to the solution.
Once completely dried up after 20 to 40 minutes, the residues appear in violet to blue colors. These residues can be easily removed with sterile water or a TE buffer and a paper towel.
Decontamination of laboratory surfaces: DNA­Exi­ tusPlus™ is directly applied to the surface to be cleaned and incubated for a period of 10 to 15 minutes. DNA­
ExitusPlus™ residues are wiped off with a damp paper towel (sterile water). Rinsing the surface with water is not required.
Decontamination of laboratory equipment: DNA­
ExitusPlus™ is applied to a paper towel, which is then used to wipe all surfaces of the equipment that might come in contact with the sample. The cleaned parts are subsequently rinsed with water and dried with a paper towel. Smaller parts can be immersed in DNA­Exi­ tusPlus™, rinsed with water and dried.
Decontamination of plastic and glass containers: Fill container with enough DNA­ExitusPlus™ to ensure that by shaking or agitating the entire surface is wetted.
Then pour away the solution and rinse the container with distilled water.
Decontamination of pipettes: Cleaning should be ef­ fected by following the instructions of the manufac­ turer. The shaft is removed from the pipette and from it all seals. The shaft is immersed in DNA­ExitusPlus™ for one minute and then thoroughly rinsed with water.
Let dry before reassembly.
Decontamination of tweezers and scalpels: To take samples or extract cell material for DNA and RNA anal­ yses, as well as for PCR tests, tweezers and scalpels are being used that have to be decontaminated before tak­ ing new samples. For this purpose, they are first wiped off with DNA­ExitusPlus™; then, blades and endings are immersed in a DNA­ExitusPlus™ solution, where they are kept until the next sample is taken, but at least for ten minutes. For a particularly fast and thorough decontamination, DNA­ExitusPlus™ can be heated to
50–60 °C (glass containers, heating block).
Nucleic acid decontamination • AppliChem © 2008
FAQ

For higher contaminations we recommend to wipe off the first application of DNA­ExitusPlus™ from the surface after ten minutes and to repeat the treatment.
An additional decontamination effect can be obtained by heating up the DNA­ExitusPlus™ to 50 °C to 60 °C, which will considerably increase the degrada­ tion rate.
Even minute quantities of DNA­ExitusPlus™ can be de­ tected on surfaces after drying, as the contained color indicator leaves a blue/violet color.
If small DNA­ExitusPlus™ residues are detected, they can be removed by wiping the surface with sterile cloth soaked with sterile water.
To inactivate bigger quantities of DNA­ExitusPlus™, surfaces can be cleaned with a sterile solution of 50 mM
Tris, 10 mM EDTA, pH 8.0.
EPDM = ethylene propylene diene monomer
Polypropylene, stainless steel, EPDM and silicon seals are not damaged by DNA­ExitusPlus™. If DNA­Exi­ tusPlus™ residues have dried on surfaces, these can be simply removed in one step by rinsing with sterile wa­ ter or 50 mM Tris, 10 mM EDTA, pH 8.0 and subsequent wiping off with a sterile cloth.
In contrast to various other DNA decontamination products, the concentration of the ingredients is not that high as to result in a high­viscosity solution. DNA­
ExitusPlus™ not only shows a low ionic strength; in addition, all components are highly soluble in water.
The affinity to metallic and plastic surfaces is very low.
One single rinsing process, even of very small­diameter hose or pipe systems with 50 mM Tris, 10 mM EDTA, pH 8.0 and a subsequent rinsing with sterile water safely removes all residues for DNA­ExitusPlus™.
You may want to check the ph value of the water in the last rinsing step. If it ranges between a pH of 6 to 8, everything is as it should be. It makes sense to check the pH value of the water before rinsing, as water pro­ duced via an anion exchanger frequently shows a very low pH value!
Inside the pockets, residues of DNA­ExitusPlus™ ap­ pear fluorescent – NOT nucleic acids. It is obvious that these small molecules in the pockets diffuse in all di­ rections – despite the electrophoresis. While the DNA collects at the bottom of the gel pocket, the DNA­
ExitusPlus™ components diffuse across the entire sur­ face of the gel pocket and in all directions. Under the chosen test conditions, neither RNA nor DNA precipi­ tate and in the RNA sample there is no highly molecular
DNA that might remain caught up in the pocket.
Tests were conducted on smooth plastic laboratory sur­ faces (cabinets, floor and work table). Thoroughly soaked paper towels were used and the quantities ap­ plied resulted in the liquid running down the vertical walls. We recommend to apply 1 liter per 10 m² and to switch the paper towel repeatedly to avoid transferring pollutions from corners of one surface to the next.
© 2008 AppliChem • Nucleic acid decontamination

In a biotechnological research laboratory, stains on equipment, working surfaces or the floor are considered a blemish, as it indicates sloppy working conditions or simply that something was spilled.
It can become really dangerous, if something is spilled that you cannot see – not even after the spilled reagent has dried up.
Ethidium bromid does not become visible until the room or the object is illuminated with ultraviolet light.
But what about acids and bases? Have you ever put an undamaged garment into your washing machine only to find it full of holes upon taking it out? The acid or base splashes had not been visible before! Sodium azide is a toxic component of many buffers to prevent the growth of bacteria and fungi. Strangely enough, it is sometimes also contained in certain nucleic acid de­ contamination products – despite the fact that is does not have any degrading effect on nucleic acids. And you are spraying this product on your surfaces as well!
The spraying of many precarious reagents in particular lead to the so­called “stacking effect”, meaning that over time, residues of the reagents that were not re­ moved accumulate on surfaces, as well as inside equip­ ment. Once a critical concentration is reached, surfaces, boards and computers start being attacked or even de­ stroyed, without the user being able to make the con­ nection to the products used! Many reagents for nucle­ ic acid decontamination exercise their “effect”, among others, by inhibiting PCR reactions – something they can only do, if they are not removed in their entirety.
In contrast to this, our products work differently:
DNA­ExitusPlus™ really disintegrates nucleic acids into their individual components without acting corrosively on surfaces or equipment. In order to be able to see, where DNA­ExitusPlus™ was used, we have added a color indicator to our nucleic acid and RNase decon­ tamination products DNA­ExitusPlus™ and RNase­Exi­ tusPlus™. It leaves a reddish­violet film on the treated surface that is easily removed with water. Thus, you can see exactly, where the product was used. Not every user was happy with this. Therefore, we offer DNA­
ExitusPlus™ in an indicator­free (IF) version as well.
There is no difference in the application of DNA­
ExitusPlus™ (IF) and that of DNA­ExitusPlus™. You can simply follow the instructions on the previous
pages. Here, a few additional remarks:
The optimum incubation time for surfaces is 10 to
15 minutes. DNA­ExitusPlus™ IF works a bit slower than DNA­ExitusPlus™. This, however, is irrelevant at the concentration employed! If the solution should be diluted in your application, the incubation time has to be extended. A solution, for instance, that has been diluted five times, has a much slower effect. It is also true for DNA­ExitusPlus™ IF that increasing the
temperature to 50–80 °C considerably increases the activity!
Nucleic acid decontamination • AppliChem © 2008

What do surfaces (standard laboratory table) look like after the application of DNA ExitusPlus™ or the indicator-free variation, respectively?
DNA-ExitusPlus™ – color development after dripping on the surface
(standard laboratory table surface, Köttermann), dropwise addition of 1 ml each left: DNA-ExitusPlus™ IF, 4-month-old solution right: DNA-ExitusPlus™, 4-month-old solution
DNA-ExitusPlus™ – color development after dripping on the surface (standard laboratory table surface, Köttermann), dropwise addition of 1 ml each left: DNA-ExitusPlus™ IF, fresh solution right: DNA-ExitusPlus™, fresh solution
Fig. 1 PCR test to prove the complete removal of DNA contaminations by DNA-ExitusPlus™ IF. Test DNA (0.5 or 1 ng, respectively) was dried in PCR tubes. The PCR tubes with the dried up DNA were treated for
20 seconds with sterile water or DNA-ExitusPlus™ IF. Next, 50 µl of a PCR mix were filled into the tubes and the PCR was completed. The
PCR mix contains primer pairs for the amplification of the control DNA and the test DNA. The control DNA (0.5 ng) is added to all samples and indicates, whether or not the PCR was successful. A band of test DNA shows, whether intact DNA molecules were still present as template for the PCR. In case of a complete removal or destruction of the test
DNA, the PCR should not amplify any respective DNA bands. After gel electrophoresis in a 0.8 % agarose gel, the DNA was stained with ethidium bromid and photographed. In the negative control with Tris (1 mM, pH 8), all DNA bands for the test and control samples are amplified. In the reactions with DNA-ExitusPlus™, only the control DNA is amplified.
The treatment with DNA-ExitusPlus™ removes or destroys all templates of the test DNA.
Fig. 2 Degradation of a PCR product and the primers by DNA-
ExitusPlus™ IF. To verify the degradation of smaller DNA fragments,
5 µg of DNA per PCR sample with a 780 bp PCR product and the respective primers are incubated for the indicated times (2 and 5 minutes) with
DNA-ExitusPlus™ IF.
(M) Marker; (+IF) 5 µl of DNA plus 5 µl of DNA-ExitusPlus™ IF; (C) 5 µl of DNA plus 5 µl of water (control); (+) 5 µl of DNA plus 5 µl of DNA-
ExitusPlus™ (control); (P) 5 µl of PCR reaction, directly applied without prior denaturation (control).
© 2008 AppliChem • Nucleic acid decontamination

Today, hardly a molecular­biological or cell­biological experiment is conceivable without employing recom­ binant DNA. Studies of the regulation of gene expres­ sion, the over expression of proteins in cells after transfections and, of course, the production of prote­ ins on a larger scale to name but a few, were facilitated and sometimes even became possible for the first time by the introduction of plasmids. This caused a con­ stantly rising demand of purified DNA. The available methods of the classic minipreps (alkaline lysis; Birn­ boim & Doly 1979) and maxipreps are labor­intensive and, in the case of the maxipreps, require expensive chemicals (cesium chloride) and equipment (ultra centrifuge). The development of new technologies be­ came necessary.
In the summer of 2005, AppliChem introduced the first regeneration system for pure silica matrices on the market. These reagents, developed by multiBIND bio­ tec, were optimized in collaboration with AppliChem and are now available under the name of maxXbond.
Both regeneration solutions quickly and reliably re­ move all DNA residues from used columns and regen­ erate the full binding capacity. This has been proven by gel electrophoresis (Vogelstein & Gillespie 1979) and
PCR analysis (Innis et al. 1990). This way, cost savings of up to 70 % can be realized.
The regeneration of the silica matrices also requires a refill of the buffer system for the DNA isolation. For this purpose, AppliChem offers a new, universal buffer system: maxXmore.
Binding of DNA to silicate in a batch process (glass powder; Vogelstein & Gillespie 1979) for the purifica­ tion of DNA represented the first step towards DNA binding columns with fixed silica matrix. This material permits the isolation of the DNA in a miniprep scale in a much shorter time period and of a much higher pu­ rity. These DNA binding columns, however, have their price. To be able to purify DNA in a larger scale, the
DNA binding matrix with anion exchange resins was introduced. Quite often, we are talking here of DEAE, coupled with a silica matrix.
Pure silica matrices are only exceptionally re­used several times in case the identical plasmid is purified via the identical column. A regeneration of anion
exchangers was described; however, data on the com­ plete removal of DNA residues were not shown. As a consequence, pure silica columns were usually dis­ carded after use, since a complete regeneration for mo­ lecular or cell biological purposes was not possible.
The two decisive criteria for a full regeneration are the complete absence of nucleic acids and the full binding capacity.
As already mentioned, when talking about DNA bind­ ing materials, we distinguish between pure silica matri­ ces and anion exchange resins coupled with silica
matrices.
Common to both is the use of the negative charges of phosphate residues of the DNA molecules for bind­ ing (Fig. 1). In the pure silica matrix, the DNA binds with the positively charged surface of the silicates. In the anion exchange resins, the DEAE molecules are bound to a silica matrix and the nucleic acids bind to derivates of DEAE molecule amino groups (Fig. 1). The different binding characteristics of both carriers also require different buffers. The principal difference can be seen in the elution buffers. In pure silica matrices, the DNA is eluted with sterile water or 10 mM Tris/HCl, pH 8.5. In contrast to this, the anion exchangers require a highly concentrated salt elution of 1.2 to 1.5 M NaCl in the buffer. This requires a subsequent DNA precipi­ tation with isopropanol. The advantage of the silica matrix is a very fast completion of the preparation,
Nucleic acid decontamination • AppliChem © 2008

A
+-
+high salt concentration; pH ≥ 7
+-
-
-
-
+-
+-
-
+low salt concentration; pH ≥ 7
-
-
-
-
+-
+-
+-
+-
+-
+-
+-
+-
Fig. 1 A + B
Binding to and elution of DNA molecules from silica matrices A and anion exchange resins
B . By principle, in all processes the negative
charge of the phosphate residues is used for the binding to positive charges. In a pure silica matrix, the binding is effected directly on the surface of the silicates. When coupling anion exchange resins to the silica matrix, binding is effected via the positive charge of the anion exchange resins (yellow). Different binding
buffers and elution solutions result from this.
At the silica matrix, the binding is obtained in solutions with chaotropic salts by removing the hydrate envelope. The elution is then conducted with sterile water or Tris/HCl, pH 8.5. For the binding of the DNA, anion exchange resins require medium-range NaCl concentrations and for the elution buffers with highly molar NaCl.
B
+-
+
+-
-
+
+
++
+normally medium salt concentration pH 5.5–7 variabel
+-
+-
+-
-
-
-
+-
+-
-
+-
+-
-
-
-
-
+
+
+
+ high salt concentration; ≥ 8
Tab. 1 Comparison of the characteristics of silica matrices and anion exchange resins
Binding
Elution
SILICA chaotropic salts, high salt concentration pH pH
≤
≥
7
7 in TE (low salt)
Advantages • very pure DNA
• simple procedure, no alcohol precipitation of the DNA
• Eluate can be used immediately
• inexpensive solution
• robust matrix, can be re-used many times
• suited for screening in high throughputs
Disadvantages • not suited for purification
high DNA quantities
• Traces of impurities can impede very
sensitive downstream applications
of the DNA (e. g. transfections)
ANION EXCHANGER
(SILICA-based DEAE) normally medium salt concentration, e.g., 750 mM NaCl pH 5.5–7 (variable) high salt concentration, e.g., 1.25 M NaCl pH (normally) ≥ 8
• ultrapure DNA (highest degree of purity)
• suitable for the purification of very high
DNA quantities
• variable conditions for the elution
• very elaborate procedure
• duration of the preparation
• alcohol precipitation of the DNA
• relatively expensive whereas the anion exchanger warrants the highest
possible degree of purity for the DNA sample. The most important data for the various matrices have been summarized in table 1.
Today, both different column types are real “high­ tech” products with a comparably high material value.
The fact that until now not all nucleic acid molecules could be washed off of the matrices with conventional buffer systems normally did not permit a multiple use of these products.
After the standard isolation with DNA binding col­ umns with a pure silica matrix, between 5 % and 10 % of the nucleic acids to be isolated remain bound to the column. This residual quantity of DNA plasmids is com­ prised of free molecules and molecules encased in pre­ cipitated protein particles or bacterial fragments (Fig.
2). Therefore, even in a limited re­use of the columns, for instance for an identical plasmid, the binding capac­ ity of the matrix is reduced. As a consequence, piles of rubbish of high­valued material accumulate in every laboratory working with DNA binding columns. Due to the attached residues of recombinant DNA molecules and bacterial impurities, we are even looking at ge­ netically engineered hazardous waste. In accordance
© 2008 AppliChem • Nucleic acid decontamination

free DNA- molecules inclusions in protein particles
Regeneration of DNA binding columns in approx. 30 minutes
Step 1
Removal of the 5-10% of residual DNA
Step 2
Removal of the RG1 residue and regeneration of the full binding capacity
750 m l RG1 750 m l RG2
Incubation for 30 min.
centrifugation direct centrifugation
5-10 % inclusions in bacterial cells
90-95 %
Fig. 2
Principle and problems in the purification of DNA plasmids by DNA binding columns. After the binding of the DNA molecules to the silica matrices, the DNA is washed and eluted. During elution, only 90 to 95 % of the DNA is released from the silica matrix. The residual DNA remains bound to the columns. Here, free DNA molecules, as well as inclusions in protein particles or bacterial cell residues can remain bound. These residual DNA molecules contaminate the column and reduce its DNA binding capacity. Those are the two main reasons, why the “high-tech” product
DNA binding column remains a disposable to this day.
Fig. 3
Schematic drawing on the sequence of a regeneration of DNA binding columns. 750 µl each of both regeneration solutions RG1 and RG2 are centrifuged consecutively through the DNA binding columns. During the 30 minutes of incubation time, the first solution removes residual
DNA molecules of the prior isolation. The second solution removes and inactivates RG1 residues and restores the full DNA binding capacity of the column material. The entire regeneration process takes 30 minutes only. with the guidelines on genetic engineering, this waste has to be subjected to autoclave treatment to destroy the nucleic acids and bacteria before disposal.
The following new characteristics are decisive for the success of maxXbond in practical use:
2
2 fast and simple use
complete removal of all DNA molecules, whether freely accessible or encased in particles non­aggressive treatment of the column material 2
2
2 full binding capacity after regeneration inexpensive
Here, maxXbond builds on the known working proto­ cols for the standard isolation with DNA binding col­ umns. The two special solutions are called regenera­ tion buffer 1 (RG1) and regeneration buffer 2 (RG2) In a two­step process, a fast and efficient regeneration of
DNA binding columns is obtained in a mere 30 minutes
(Fig. 3). First, the RG1 solution is applied on the col­ umn, where it removes all remaining DNA molecules in their free form, as well as encased particles within 30 minutes. Test incubations of up to 24 hours have shown that the columns and their matrix are not damaged by
RG1. The RG1 is then removed by a short centrifugation cycle. The subsequent centrifugation of the RG2 solu­ tion through the column then removes and inactivates all RG1 solution residues and simultaneously restores the original DNA binding capacity. The DNA columns such regenerated can be directly re­used for a new preparation or stored for any period of time until their next use. Any single DNA column is thus used approx­ imately 20 times for the isolation of any new DNA prep­ aration. The analysis of the isolated DNA quantities after the various regeneration processes did not show any reduction in the binding capacity (Fig. 4).
Nucleic acid decontamination • AppliChem © 2008

Column:
Plasmid:
Use:
A
X
A
X
A
X
A
X
B
Y
B
Y
B
Y
B
Y
1x 5x 10x 20x 1x 5x 10x 20x
Column: C D C D
Plasmid: X X Y Y
Use: 1x 1x 2x 2x
Plasmid::X
K1 0 K2 C D
PCR- produkt
Primer
A B
Fig. 4
Proof of the identical binding capacity of DNA binding columns, even after 20-fold use. One after the other, both columns A or B were used for 20 cycles of isolation and regeneration for the preparation of plasmid DNA from identical aliquots of a recombinant E. coli culture. Identical aliquots of the eluted DNA samples were separated on the agarose gel. After staining the gel with ethidium bromide, it was
photographed. Before electrophoresis, the plasmid DNA was linearized by a restriction digest.
Fig. 5
A + B Proof of the absence of nucleic acids on regenerated columns.
Both columns C and D were first used for the isolation of the plasmid X.
After regeneration of the columns, a second plasmid Y was purified via the identical columns. The analytical agarose gel in 5 A shows similar aliquots of the DNA isolations. The different molecular weights of the X and Y permit a quick identification of contaminations. In the second DNA isolation, no traces of the first DNA sample can be detected. Before gel electrophoresis, the plasmid DNA was linearized by restriction. Neither does the analysis of the PCR products in Fig. 5 B reveal any DNA
residues of the first isolation. Before purification of the DNA sample Y, column C was treated with RG1 for 24 hours and column D for 5 minutes. Subsequently, 750 µl of RG2 each were centrifuged through both columns. Finally, 50 µl of an elution solution (10 mM Tris / pH 8.0) were centrifuged through the columns. Of these 50 µl eluates, aliquots of 2 µl each were introduced into 50 µl of test PCR reactions with the respective primers for the insert X. (K1: control by addition of the plasmid::X DNA
(1 ng); 0: no plasmid::X DNA; K2: control by addition of the plasmid::X
DNA (1 ng) and 2 µl of the eluate after regeneration of columns C and D;
C: 2 µl of eluate from column C after isolation of the plasmid X and regeneration (24 h); D: 2 µl of eluate from column D after isolation of the plasmid X and regeneration (5 min.).
To verify the absence of nucleic acids (ill 5) in the re­ generated columns, analytical agarose gels, as well as
PCR tests were used. For this purpose, the regenerated columns were treated with 50 µl of the respective stan­ dard elution buffer after treatment with RG2 with a subsequent analysis of the eluate. The analytical DNA gels showed that no residues of the previous DNA sample could be detected (Fig. 5A). Even the highly sensitive PCR analysis cannot produce proof of resi­ dues of the previous DNA preparation in the eluates of regenerated columns (Fig. 5B).
The plasmid DNA from isolations of regenerated columns meets all quality standards and is fully compa­ rable to DNA preparations that were isolated through new columns. Thus, a great variety of different DNA isolations by DNA binding columns could meanwhile be successfully used for a broad range of molecular­ biological applications such as DNA plasmid screens, clonings, restrictions, isolations of DNA fragments, liga­ tions, inverse transformation, DNA sequencing, etc.
An important factor for the success of this new pro­ cess lies in the particular characteristics of maxXbond:
2 All maxXbond components are biodegradable, non­
2
2
2 hazardous and non­toxic.
No aggressive mineralic acids or bases are being used; equipment and materials are neither attacked, nor damaged or even destroyed, even after long exposure times.
Caused by the catalytic and cooperative effects of the solution components, an extremely fast and ef­ ficient removal of a great variety of biological mol­ ecules, such as membranes, proteins and nucleic acids is obtained.
Also in the pH range of 6 to 8 the new solutions are quite effective.
© 2008 AppliChem • Nucleic acid decontamination

The new process and the respective solutions have been patented. Further developments will be promoted in a technical partnership between the multiBIND bio­ tec GmbH, Cologne, and the AppliChem GmbH, Darm­ stadt. This way, a new sustainability is introduced into the daily laboratory work of DNA isolations, accompa­ nied by big cost savings in materials at the same time.
Particularly suited for the new regeneration process proved to be all commercially available DNA binding columns containing a pure silica matrix. Recently, it could also be shown that mini columns with silica ma­ trix for the purification of PCR products can be regener­ ated just as well with maxXbond without any problems.
PCR fragments of 500 bp up to 3 kb were perfectly isolated from regenerated columns (Fig. 6). As maxX­ bond does not change the characteristics of the silica matrix, the isolation characteristics of the columns are not modified either. The purification of very small PCR fragments exclusively depends on the combination and the ionic strength of the buffers. Neither is it of any consequence, which original material the PCR is per­ formed with – single cells or templates or mixtures. As long as the respective suitable buffers are being used, the regenerated and new columns function alike.
Since 96­well plates are nothing else than the com­ bination of 96 mini columns in one plate, the proce­ dure, volumes and buffers of the preparation are virtu­ ally identical to the plasmid mini columns, as long as they are silica membranes. During the application of maxXbond 750 µl of RG1 and RG2 are used per well.
The same is true for free silica particles as used for the isolation of DNA fragments from agarose gels (glass milk, batch process). Thus, the field of application suc­ cessfully proven for maxXbond constantly expands.
Four independent DNA samples of the same plasmid were sequenced from columns regenerated several times by Sequiserve GmbH, an independent sequenc­ ing laboratory. In addition, one of the samples (REG­4) was purified by using their own column system for best sequencing results.
All four clones deliver perfectly readable sequences of up to 750 bp. There is not one single nucleotide dif­ ference between the four samples. The electrophero­ grams can even be evaluated up to 1000 bp. REG­1 and
REG­2 were AppliChem columns and REG­3 was a col­ umn of a different supplier. Before, all columns had been used at least 5 times for other DNA preparations
5,1 kb
870 bp
560 bp ca. 30 nt
(Primer)
780 bp ca. 30 nt
(Primer)
+ M 1 2 3 4
Fig. 6 A
Test of the DNA binding capacity (6 A) and the absence of nucleic acids (6 B) from purification columns for PCR fragments.
In 6 A, the binding capacity of 10x regenerated PCR-fragment purification columns was tested with commercial standard buffers and new refill buffers. A mixture of linear DNA fragments was isolated via 10x regenerated purification columns and eluted with
50 µl 10 mM Tris (pH 8.0) each. 8 µl of the eluate each were analyzed on a 0.8% agarose gel. Lanes: +: mix of the three DNA fragments
(approx. 500 ng) before purification, M: molecular weight marker,
1 and 2: purification by using the PCR purification columns and buffer of the market leader, 3 and 4: purification by using newly developed solutions.
60 min 10 min 5 min Kontrollen
1 2 3 4 5 6 E+ – P+
Fig. 6 B
Section 6 B of the figure depicts the PCR test for the complete removal of DNA fragments after regeneration with maxXbond. After
10 cycles of isolation and regeneration, the PCR fragment purification columns were used for the purification of linear test DNA fragments and subsequently regenerated with maxXbond. This was followed by an elution with 50 µl 10 mM Tris (pH 8.0) each and 2 µl each of the eluates were checked for a complete removal of the DNA in an analytical PCR.
10 µl each of the PCR were analyzed on a 0.8% agarose gel.
Lanes: 1 + 2: 60 min. of regeneration, 3 + 4: 10 min. of regeneration,
5 + 6: 5 min. of regeneration, E+: PCR with 2 µl of eluate from regenerated column + 50 ng template, -: negative control (PCR without template), P+: positive control (PCR with 50 ng template).
A mere 10-minute-treatment with maxXbond completely removes the
DNA from the columns.
Nucleic acid decontamination • AppliChem © 2008

>REG­1 / 5 min. RG1+ / AppliChem / (M13rev)
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGAC
CTGCAGTATTGAATTTGAAGCATGA AATCGTGCTTATCAATTTTATGT
CACCCTAAAACATCTGTACGTGTTTATATAGATATTTAAAGCAATATTT
GC CAGGATTTGGTGAAGATCCCTCATATAACTCTCATAAATGCGGAT
TTTCGGAGCGAAAAAAGCCTAAATTCTT GTCTGGAAGTATAATTGGC
GGTGAAATAGAAAAGGTGGCAATCACGACTGAAAAGGGTACAGCTT
TCG CAACTGACATATACAGACGGTGAAAAGTAATAAATTGCCCAAGT
GTGAACATGTCAGGTGTAAGCTCTGTTA TGCTCGGTCTTCGACCTG
CTACAAGAATTTTTTTCCGCAGTAATATTTCGGTTTCACCTTCGAGGA
CTTT TGTATCATATATTGGAAGATCCCAGAGCACGTCGATACTCAAA
AATGCTCCCAACTTAGAGGACAATGTCA CAAATCTTCAGAAAATTAT
ACCGAAACGGTTCTTTTCTCAAACATCAATTTTGAAATCAAGGTGGA
AGCCTATA TTCAATGAAGAAACTACTAATCGATACGTACGTTTGAACA
GGTTTCAGCAGTACCAGCAGCAGAGAAGCGG CGGCAATCCTCTGG
GCTCTATGACTATTTTGGGGCTCTCTTTAATGGCAGGAATATATTTTG
GCTCCCCTTA TTTGTTCGAGCACGTTCCACCCTTTACGTATTTTAAGA
CGCATCCAAAGAATCTGGTATACGCGTTA
>REG­2 /5 min. RG1+ / AppliChem / (M13rev)
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGAC
CTGCAGTATTGAATTTGAAGCATGA AATCGTGCTTATCAATTTTATGT
CACCCTAAAACATCTGTACGTGTTTATATAGATATTTAAAGCAATATTT
GC CAGGATTTGGTGAAGATCCCTCATATAACTCTCATAAATGCGGAT
TTTCGGAGCGAAAAAAGCCTAAATTCTT GTCTGGAAGTATAATTGGC
GGTGAAATAGAAAAGGTGGCAATCACGACTGAAAAGGGTACAGCTT
TCG CAACTGACATATACAGACGGTGAAAAGTAATAAATTGCCCAAGT
GTGAACATGTCAGGTGTAAGCTCTGTTA TGCTCGGTCTTCGACCTG
CTACAAGAATTTTTTTCCGCAGTAATATTTCGGTTTCACCTTCGAGGA
CTTT TGTATCATATATTGGAAGATCCCAGAGCACGTCGATACTCAAA
AATGCTCCCAACTTAGAGGACAATGTCA CAAATCTTCAGAAAATTAT
ACCGAAACGGTTCTTTTCTCAAACATCAATTTTGAAATCAAGGTGGA
AGCCTATA TTCAATGAAGAAACTACTAATCGATACGTACGTTTGAACA
GGTTTCAGCAGTACCAGCAGCAGAGAAGCGG CGGCAATCCTCTGG
GCTCTATGACTATTTTGGGGCTCTCTTTAATGGCAGGAATATATTTTG
GCTCCCCTTA TTTGTTCGAGCACGTTCCACCCTTTACGTATTTTAAGA
CGCATCCAAAGAATCTGGTATACGCGTTA
>REG­3 /5 min. RG1+ / Market Leader / (M13rev)
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGAC
CTGCAGTATTGAATTTGAAGCATGA AATCGTGCTTATCAATTTTATGT
CACCCTAAAACATCTGTACGTGTTTATATAGATATTTAAAGCAATATTT
GC CAGGATTTGGTGAAGATCCCTCATATAACTCTCATAAATGCGGAT
TTTCGGAGCGAAAAAAGCCTAAATTCTT GTCTGGAAGTATAATTGGC
GGTGAAATAGAAAAGGTGGCAATCACGACTGAAAAGGGTACAGCTT
TCG CAACTGACATATACAGACGGTGAAAAGTAATAAATTGCCCAAGT
GTGAACATGTCAGGTGTAAGCTCTGTTA TGCTCGGTCTTCGACCTG
CTACAAGAATTTTTTTCCGCAGTAATATTTCGGTTTCACCTTCGAGGA
CTTT TGTATCATATATTGGAAGATCCCAGAGCACGTCGATACTCAAA
AATGCTCCCAACTTAGAGGACAATGTCA CAAATCTTCAGAAAATTAT
ACCGAAACGGTTCTTTTCTCAAACATCAATTTTGAAATCAAGGTGGA
AGCCTATA TTCAATGAAGAAACTACTAATCGATACGTACGTTTGAACA
GGTTTCAGCAGTACCAGCAGCAGAGAAGCGG CGGCAATCCTCTGG
GCTCTATGACTATTTTGGGGCTCTCTTTAATGGCAGGAATATATTTTG
GCTCCCCTTA TTTGTTCGAGCACGTTCCACCCTTTACGTATTTTAAGA
CGCATCCAAAGAATCTGGTATACGCGTTAT
Control
>REG­4 / 5 min. RG1+ / AppliChem / +Sequiserve Column (M13rev)
ATGATTACGAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGAC
CTGCAGTATTGAATTTGAAGCATGA AATCGTGCTTATCAATTTTATGT
CACCCTAAAACATCTGTACGTGTTTATATAGATATTTAAAGCAATATTT
GC CAGGATTTGGTGAAGATCCCTCATATAACTCTCATAAATGCGGAT
TTTCGGAGCGAAAAAAGCCTAAATTCTT GTCTGGAAGTATAATTGGC
GGTGAAATAGAAAAGGTGGCAATCACGACTGAAAAGGGTACAGCTT
TCG CAACTGACATATACAGACGGTGAAAAGTAATAAATTGCCCAAGT
GTGAACATGTCAGGTGTAAGCTCTGTTA TGCTCGGTCTTCGACCTG
CTACAAGAATTTTTTTCCGCAGTAATATTTCGGTTTCACCTTCGAGGA
CTTT TGTATCATATATTGGAAGATCCCAGAGCACGTCGATACTCAAA
AATGCTCCCAACTTAGAGGACAATGTCA CAAATCTTCAGAAAATTAT
ACCGAAACGGTTCTTTTCTCAAACATCAATTTTGAAATCAAGGTGGA
AGCCTATA TTCAATGAAGAAACTACTAATCGATACGTACGTTTGAACA
GGTTTCAGCAGTACCAGCAGCAGAGAAGCGG CGGCAATCCTCTGG
GCTCTATGACTATTTTGGGGCTCTCTTTAATGGCAGGAATATATTTTG
GCTCCCCTTA TTTGTTCGAGCACGTTCCACCCTTTACGTATTTTAAGA
CGCATCCAAAGAATCTGGTATACGCGTTATT
Fig. 7 Sequencing of DNA preparations that were purified via
DNA binding columns regenerated several times with maxXbond.
The sequences can be analyzed up to 1000 bp. There has been not one single nucleotide exchange, nor any deviations caused by contamination.
© 2008 AppliChem • Nucleic acid decontamination

and regenerated. For all columns, AppliChem isolation buffers S1­S5 were used (washing buffer, lysis buffer, elution buffer). www.sequiserve.de
To study the time dependency of the DNA degradation, in a test series 1 µg of ccc plasmid eluates were incu­ bated with 5 µl of RG1 maxXbond for 1, 2, 5, 10, 30 and
60 minutes in micro­reaction tubes.
From figure 8 it can be deducted, why PCR frag­ ments can still appear after 5 minutes, but not con­ taminations by plasmids. The degradation caused by maxXbond is very fast: Bigger fragments are immedi­ ately destroyed; therefore, no more replicable vectors exist after 5 minutes. Smaller fragments detected by the
PCR, however, may remain present during incubations of up to 10 minutes. Therefore, in our tests, we took a very small PCR fragment for control. After a prolonged incubation with maxXbond, even these small fragments are completely destroyed. Linearized DNA molecules are degraded faster than ccc plasmids (data not shown).
Preparation kit
• 1 µg of ccc Plasmid DNA in 5 µl H20 + 5 µl RG1 maxXbond
• Incubation [min.] at ambient temperature
• Denaturing for
5 min. at 97 °C
• 1 µg DNA sample per lane
K control 1 µg ccc
Plasmid DNA in
5 µl H
2
0 + 5 µl H
2
0
M Marker 1 kb ladder
Fig. 8 Time-dependency of the DNA degradation by maxXbond RG1.
After a mere 2 minutes, no further replicable plasmids or bigger DNA fragments are present.
DNA, isolated with self­produced isolation buffers (ly­ sis buffer, washing buffer, elution buffer, etc.) by regen­ erated columns, were incubated in a restricted and an unrestricted manner for 96 hours at 36°C, without any degradation occurring. This offers proof that RG1 does not damage the new DNA sample when regenerating the columns.
Fig. 9 Stability of DNA, purified through maxXbond-regenerated columns.
In this test, 4 independent plasmid isolations from columns regenerated several times were incubated by using self-produced isolation buffers (washing buffer, elution buffer, etc.) with the restriction enzyme Eco RI for the indicated times at 36°C.
First tests with anion exchanger did not yield optimum re­ sults, which led to the development of maxXbond AX for anion exchanger­based silica matrices (refer to page 55).
The increased employment of the regeneration process and the repeated use of DNA binding columns create a growing demand for standard solutions for DNA puri­ fication. Therefore, a new, universal solution system for
DNA binding columns with pure silica matrix was de­ veloped for the customer. The new maxXbond family member – maxXmore – offers a number of advantages as compared to the conventional solutions:
2
2
2 buffers S1­S5 are ready­to­use,
the final washing buffer does not contain any ethanol,
maxXmore can be universally used for all mini col­ umns with pure silica matrices and all solutions can be stored at ambient temperatures.
The maxXmore kit is also available in two variations.
One is suited for DNA binding columns with pure silica matrix, the other for those coupled with anion ex­ change resins.
Nucleic acid decontamination • AppliChem © 2008

Start: binding
50 µl of elution buffer
New round
Same Capacity as new column
Regeneration of the binding capacity
*
5–10 % of the DNA remain bound
750 µl
RG1
750 µl
RG2
Elution
Entfernung restlicher DNA
*
Extra-broad rim for better handling and labeling in case of repeated use
Fig. 10 For the optimum use of the regeneration system with solutions
RG1 and RG2, special new columns and collection tubes were developed. Thanks to their high stability, their broad rim for labeling and the safe handling, these products are ideal for the multiple use in the cycles of DNA preparations and column regenerations.
It is to be expected that maxXbond can also be used for the regeneration of many further DNA binding ma­ terials. Its applicability for the regeneration of silica columns for the purification of genomic DNA and RNA is presently being tested. This opens complete new fields of application for future use. Since the variety of
DNA binding materials is quite big and can vary from manufacturer to manufacturer, we welcome any feed­ back from our customers giving us information on their experience. We will analyze these field reports and make the results available to all our users. The use of
DNA binding materials in high throughput in particular offers completely new perspectives. Here, primarily silica particles or magnetic beads are of interest, as well as multi­well plates for automation.
The new regeneration process also makes demands on the stability and the handling of the DNA binding columns. This problem was accounted for by develop­ ing specially shaped DNA binding columns. These new columns have a broader upper rim permitting an ad­ ditional labeling and a safe handling. Further, the col­ lection tubes were produced in a particularly stable form (Fig. 10).
Literature
[1] Vogelstein, B. & Gillespie, D. (1979) Preparative and analytical purification of DNA from agarose. Proc. Natl. Acad. Sci.
USA 76 , 615–619.
[2] Innis, M.A., Gelfand, D.H., Sninsky, J.J., and White, T.J. (eds)
(1990) PCR Protocols – A guide to methods and applications. Academic Press, Inc., San Diego, California
[3] Birnboim, H.C. & Doly, J. (1979) A rapid alkaline lysis procedure for screening recombinant plasmid DNA. Nucl. Acids
Res. 7 , 1513–1522.
[4] Sambrook, J. & Russel, D.W., eds (2001) Molecular Cloning:
A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, NY.
[5] Chang, V.W.-H. et al. (1999) Recycling of Anion-Exchange
Resins for Plasmid DNA Purification. BioTechniques 26 , 1056.
© 2008 AppliChem • Nucleic acid decontamination

Fast regeneration (in about 30 minutes) of mini columns for the multiple binding of DNA
After elution of the plasmid DNA, 750 µl of the RG1-solution are applied to the column and incubated for a minimum of 30 minutes. Shorter incubation times
(6 – 10 minutes) suffice for columns that are only slightly contaminated! Longer incubation times do not damage the column materials, but may increase the puri­ ty of the column. If, in bigger columns, the passage of the RG1 reagent should be faster than 30 minutes (or the desired incubation time), the top of the column should be sealed with “Parafilm” (American National Can Company, USA) to make sure the RG1 stays on the column. In case of mini columns, the risk of a comple­ te passage does not exist, as enough RG1 stays on the columns thanks to the capillary forces. After incubation, the 750 µl of RG1 can be passed through the column by centrifugation, by vacuum or by gravity.
For columns with a high DNA contamination, 10 minutes of incubation with RG1 may not be sufficient for the removal of all DNA residues. Therefore, the incu­ bation time with RG1 is increased for these columns (60 minutes to 24 hours).
Detailed studies have shown that a one­hour incubation time has always removed all DNA residues from the column material of highly contaminated columns or from columns that were stored for longer periods of time before regeneration.
In a second step, 750 µl of the RG2 solution are applied to the column, which can be removed immediately afterwards by centrifugation or vacuum.
Column type
Mini column
96 well plates
RG1 & RG2
750 µl each
750 µl/well
Immediately following the rinsing step with RG2, the columns are ready for re­use. Alternatively, the columns can be stored at ambient temperature until their next use.
Columns were incubated with RG1 and RG2 for time periods between 5 minutes and 24 hours without any measurable damage to the DNA binding matrix or a reduction of the DNA binding capacity.
RG2
5
RG1
5
Incubation
≥ 30 minutes
Centrifugation
Vacuum
Gravity
Centrifugation, vacuum
Immediate re­use or storage
Nucleic acid decontamination • AppliChem © 2008

Fast regeneration of silica particles or glass powder
(glass milk) for multiple DNA binding
After elution of the DNA, approximately 10 µl of silica particles/glass pow­ der are resuspended in 500 µl of the RG1 solution and incubated for a minimum of
30 minutes. Longer incubation times do not damage the silica material but may increase the purity of the particles.
Following incubation, the silica particles / glass powder are centrifuged and the
RG1 supernatant is removed.
For laboratories it is much more effective to collect bigger quantities of silica particles. Up to 50 µl of silica particles/glass powder can be regenerated in 500 µl of RG1. By always taking 10 times the volume of RG1 and RG2 as compared to the volume of the silica particles/glass powder, a safe removal of DNA residues is guaranteed.
In a second step, 500 µl of the RG2 solution are added to the silica particles/ glass powder and are immediately removed again by centrifugation after vortexing.
Vortexing.
Incubation
≥ 30 minutes
RG1
5
Centrifugation
Vortexing
Centrifugation
RG2
5
Immediate re­use or storage
© 2008 AppliChem • Nucleic acid decontamination

Labeling of mini columns
According to our knowledge, only our columns are equipped with a higher rim: Use this area for the label­ ing of the columns, if necessary.
In your work, this further offers an advantage in handling. First of all, the tubes can be transferred more easily and more safely between rotor and Eppi racks; secondly, the other tubes have the inherent problem of solutions getting between the rim and the fingers when touching the tube at the small upper rim. This way, fingers, as well as solutions and tubes are frequently contaminated. Therefore, some workers wear gloves for preparations with these columns. The collection tube, too, has a particular and unmistakable shape when compared to competitor products and offers a higher stability in multiple use.
DNA residues from the previous isolation detectable in the PCR
Remedy: The incubation time with RG1 is extended. In case of very sensitive samples it can be extended to up to 24 hours without damaging the silica materials. Ac­ cording to our experience, even extensive DNA con­ taminations did never require more than 60 minutes for a complete removal of nucleic acids.
Discoloration of silica columns
In some cases, a yellow film develops on the mem­ brane of the silica columns after frequent regeneration.
This film consists of small, insoluble residues of the color indicator. It is not disruptive and can normally be removed with a 50 mM EDTA solution (pH 8.0 – similar volume to that of RG1 and RG2). The EDTA solution is applied following that of RG1 and removed from the column by centrifugation, vacuum or gravity.
RG1 precipitate on the column
In some overnight RG1 incubations, RG1 components can precipitate on the membrane, if the air condition was set to very low temperatures (e. g., 14 °C instead of
21 °C). This precipitate can be removed by rinsing with
RG2 at 40 °C. We recommend double rinsing with RG2.
Diminished binding capacity after prolonged storage
A few of the regenerated columns show a reduction of the binding capacity for new DNA after very long stor­ age (we made the experience once after two months).
A renewed RG1 and RG2 treatment directly before the new preparation restored the optimum conditions – therefore, never discard the columns immediately! A renewed treatment with RG1 and RG2 solves most of these problems. To this day, we have not lost one
single column.
Clogged columns after mini preps
Loose pellet residues can contaminate the column, if the clear supernatant after centrifugation of the pre­ cipitation is not removed with a pipette and applied to the mini column but is directly poured onto the column from the reaction tube. To prevent this from happen­ ing, the DNA­containing supernatant should be trans­ ferred to the column with a pipette. Tests have also shown that the quality of the lysis buffer and the solu­ tions for the neutralization/precipitation is of major importance. If these are not optimized for a “clean” precipitation, contaminated supernatants can clog the columns. The use of the maxXmore reagents precludes this problem.
Nucleic acid decontamination • AppliChem © 2008

Today, a great variety of commercial kits exist for the isolation and purification of DNA molecules.
These kits contain DNA binding materials of a high binding affinity, as well as all reagents for the binding, purification and elution of the sample. The two most frequent DNA binding materials are either pure silica matrices or silica-based anion exchange resins.
The quite different physical characteristics of these two materials also require very different buffer systems, ionic strengths or solutions and reagents for purifica­ tion (table 1).
Initially, with maxXbond, the first regeneration sys­ tem specifically for pure silica matrices was developed and launched on the market [1, 2]. At the customer’s, maxXbond permits a sustained cost reduction for DNA purification thanks to the multiple usability of the silica matrices, and has therefore become quite popular.
The manifold customer inquiries resulting from it show an even bigger interest in an optimized regenera­ tion system, specifically for silica­based anion exchange resins.
In this article, we are now presenting maxXbond
AX, the optimized regeneration kit for the multiple use of silica­based anion exchange resins. This kit is based on the newly adapted regeneration solutions RG1­AX and RG2­AX and meets all important prerequisites as were already defined for maxXbond:
2 complete removal of all nucleic acids
2 no damage to the silica­based anion exchange resins
2 complete regeneration of the DNA binding capacity
2 attractive price and high cost savings by multiple use of the columns.
The protocol for the application of maxXbond AX was adapted to the specific characteristics of the bigger and more complex matrices of silica­based anion exchange resins (refer to Fig. 1 A + B). First, the RG1­AX solution is applied to the column. During the incubation period with RG1­AX, all residual DNA molecules and nucleic acids – whether free or contained in particles – are degraded and removed from the matrix. Test incuba­ tions of up to 24 hours have shown that silica­based anion exchanger are not damaged by RG1­AX. Once
RG1­AX has been removed from the column, RG2­AX is applied immediately afterwards. This solution re­ moves and inactivates all RG1­AX residues and regen­ erates the original DNA binding capacity of the matrix at the same time.
For the customer, two different application proto­ cols exist for maxXbond AX (Fig. 1 A + B). For the standard protocol, RG1­AX and RG2­AX are simply pi­ petted on the upper column bed and then pass the column matrix by passive flow (Fig. 1A). In this pro­ cess, the incubation time of 1 hour recommended for
RG1­AX for the complete removal of all nucleic acids should be observed.
For a particularly efficient purification and regenera­ tion of highly contaminated columns, an application of
RG1­AX from the bottom column exit via a syringe was developed. This offers a better and faster contact of
RG1­AX with all areas of the matrix (Fig. 1B). Another important advantage of this type of application is the
© 2008 AppliChem • Nucleic acid decontamination

1A 1B
Fig. 1 A + B different application protocols for maxXbond AX.
1A For columns with little DNA contamination, RG1-AX is applied to the column bed from above. Once the first milliliters have drained through the exit of the column, same is closed, followed by an incubation period of 1 hour.
This permits an efficient contact of RG1-AX with all areas of the matrix. After this incubation period, the exit is opened and the RG1-AX is completely drained from the column.
Finally, RG2-AX is applied to the column. Once the RG2-AX has completely passed through and after suitable equilibration the next DNA sample can be applied and bound.
1B For columns with a high contamination of the previous DNA sample, the reverse application of the first buffer was developed.
In this protocol, RG1-AX is filled into the column with a syringe from the bottom exit.
During the incubation time of 1 hour, the buffer is passed through the matrix 3 to 5 times with the syringe. Subsequently, the RG1-AX is completely removed by inverting the column.
This serves to remove all particles and contaminations from the surface of the membrane, closing the column bed, at the same time. To remove all traces of RG1-AX and to completely wet the upper walls of the column, the column is left in the inverted position for 1 minute. Finally, RG2-AX is applied to the column from above. Once the
RG2-AX has completely passed through and after suitable equilibration the next
DNA sample can be applied and bound.
Tab. 1 Comparison of pure silica and silica based anion exchange matrices.
Binding
Elution
Advantages
SILICA chaotropic salts, high salt concentration, pH ≤ 7 pH ≥ 7 in TE (low ionic strength) high purity of the DNA simple process, no alcohol precipitation
Anion exchanger (SILICA­based) mostly medium salt concentration, e. g., 750 mM NaCl, pH 5.5–7 (variable) high salt concentration, e. g., 1.25 M NaCl, pH (as a rule) > 8 ultrapure DNA (highest possible purity) suited for the purification of very high DNA quantities eluate can immediately be re-used inexpensive alternative variable conditions for elution more complex matrix
Disadvantages robust matrix, can be regenerated by maxXbond without any problems
not suited for the preparation of very big DNA quantities more elaborate and complex process longer preparation time
Traces of contaminations can inhibit alcohol precipitation of the DNA required further sensitive applications with the DNA higher cost of preparation
Nucleic acid decontamination • AppliChem © 2008

2A
Plasmid
Use
Column
1
9x
2
10x
1 2 3 4 1 2 3 4
2B
+P - +E 1 2 3 4 M
780 bp
30 nt
(Primer)
Fig. 2 A + B Tests for the control of the binding capacity and the absence of nucleic acids of regenerated columns.
2A Four columns (1, 2, 3, 4) were used for the isolation of DNA plasmid
1 over 9 cycles and regenerated in-between each application with maxXbond AX. Subsequently, these columns were used for the purification of DNA plasmid 2. Identical aliquots of the eluted plasmid 1 and plasmid 2 DNA samples were analyzed on agarose gels. In the isolate of plasmid 2, no traces of plasmid 1 could be detected. The different preparations contained similar quantities of DNA, comparable to identical preparations with new columns.
2B PCR analysis of the elution with plasmid 2. Identical aliquots of 2µl of the plasmid 2 eluate were examined by analytical PCR. In this test, no traces of the plasmid 1 DNA from the previous isolation could be found. (Lanes: +P: positive control with 50 ng of plasmid 1 as template;
-: negative control without template DNA; +E: control with 2 µl eluate of the regenerated column and additional 25 ng of plasmid 1 as template; 1, 2, 3, 4: PCR analyses with aliquots of plasmid 2 DNA preparations from regenerated columns 1, 2, 3, 4; M: molecular weight marker).
removal of all particles and impurities from the upper membrane closing up the column bed. All columns re­ generated by maxXbond AX can immediately be reused for the next DNA isolation or stored at ambient tempera­ ture until they are required for the next application.
To prove the fully regenerated binding capacity and the absence of nucleic acids after treatment of the col­ umns with maxXbond AX, various tests were conduct­ ed. For this purpose, identical columns were used for the multiple isolation of two different DNA plasmids.
After elution and precipitation of the second DNA sam­ ple, same was eluted in a sterile TE buffer (10 mM Tris,
1 mM EDTA, ph 8.0). This second DNA sample was then tested for residual traces of the first DNA plasmid sample by analytical agarose gels [3] and PCR tests [4].
It was revealed that in both assays no molecules of the first DNA sample were detected in the second DNA plasmid DNA preparation (refer to Fig. 2 A + B). Plas­ mid DNA samples eluted by maxXbond AX­regenerat­ ed columns met all quality standards for molecular­bio­ logical work and are identical to plasmid DNA, purified with new columns. They were successfully used for
DNA plasmid screens, clonings, restrictions, enzymatic treatments, ligations, transformations, etc.
Incubation of DNA samples from regenerated col­ umns over a period of 96 hours at 37°C did not result in any degradation or modification of the DNA molecules.
This proves that DNA isolates from regenerated columns are intact and show a high stability (refer to Fig. 3).
The optimizations and adaptations realized in maxXbond AX for application with silica­based anion exchange resins do not change the particularly positive characteristics already known from maxXbond:
2 all maxXbond AX components are biodegradable,
2 non­corrosive and non­toxic
no aggressive acids or bases are being used; there­ fore, no damages to or changes of the material and equipment can be observed, even after prolonged
2 incubation periods
the special catalytic and cooperative characteristics of the solution components permit a fast and effi­ cient removal and degradation of biological mole­ cules, such as membranes, proteins and nucleic acids.
© 2008 AppliChem • Nucleic acid decontamination

12h 48h 96h
M 1 2 3 4 1 2 3 4 1 2 3 4
Duration of restriction
Column Prep
5.1 kb
870 bp
560 bp
Fig. 3 Test on the quality and stability of DNA isolates of regenerated columns. Identical aliquots of 4 different plasmid preparations (Prep) from columns that were 12 times regenerated each were restricted for
12 h, 48 h and 96 h, respectively, at 36°C ( Eco RI-restriction causes
3 bands). Lanes: M: Marker; 1, 2, 3, 4: restriction digests of the plasmid preps from columns 1, 2, 3, 4 (2 µl of the column eluates each were used).
The new maxXbond AX regeneration system was test­ ed with various commercial DNA binding columns with silica­based anion exchange resins. High­quality prod­ ucts of the leading manufacturers did not pose any problems in cycles with 10 to 15 DNA binding, regen­ eration and purification of new samples. We had to discover, however, that some products of smaller man­ ufacturers did not always show comparable quality at­ tributes and therefore were not always suited for mul­ tiple regeneration.
As a multiple regeneration of silica­based anion ex­ change resins increases the need for reagents for the isolation and purification with these columns at the same time, a new refill kit for these reagents was simul­ taneously prepared. The combination of this refill kit maxXmore AX with the regeneration system maxX­ bond AX enables the customer to regenerate most of the commercially available columns, thus realizing big savings in their budget for DNA purifications.
Literature
[1] Esser, K., Marx, W. & Lisowsky, T. (2005) Nucleic acid-free matrix: regeneration of DNA binding columns. BioTechniques 39 :270–271
[2] Esser, K., Marx, W. & Lisowsky, T. (2006) maxXbond: first regeneration system for DNA binding silica matrices.
Nature Methods 3(1): Application Notes I–II.
[3] Sambrook, J. & Russel, D.W. eds. (2001) Molecular
Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
[4] Innis, M.A., Gelfand, D.H., Sninsky, J.J. & White, T.J. (eds)
(1990) PCR Protocols – A guide to methods and applications. Academic Press, Inc., San Diego, California
Nucleic acid decontamination • AppliChem © 2008

Regeneration (for approx. 1 hour) of silica-based anion exchange columns for the multiple binding of DNA
Regeneration of highly contaminated, silica-based anion exchange columns for multiple DNA bonding
After elution of the plasmid DNA, the RG1-AX solution is applied to the column. The volume of RG1­
AX corresponds to double the volume of the equilibra­ tion buffer indicated for the respective column type.
Therefore, maxXbond AX can be used for the rege­ neration of all sizes of columns. Simply adapt the volumes of RG1­AX and RG2­AX in accordance with the table below:
Type of column Equilibration buffer
Midi column 4 ml
Maxi column
Mega column
Giga column
10 ml
35 ml
75 ml
RG1-AX
8 ml
20 ml
70 ml
150 ml
RG2-AX
8 ml
20 ml
70 ml
150 ml
After elution of the plasmid DNA, the RG1-AX solution is filled into the column from the bottom and
incubated for a period of one hour. The RG1­AX volume corresponds to double the volume of equilibration buffer indicated for the respective types of columns.
Column type
Midi column
Maxi column
Mega column
Giga column
Equilibration buffer
4 ml
10 ml
35 ml
75 ml
RG1-AX
8 ml
20 ml
70 ml
150 ml
RG2-AX
8 ml
20 ml
70 ml
150 ml
Every 15 to 20 minutes during incubation, slow­ ly pass the RG1­AX buffer 3–5 times through the col­ umn by using the syringe.
For standard contaminations, RG1­AX is applied to the column from above. Once the first milliliters have passed through the column, same is closed at the bottom with a hose and a stopper. While in this condition, the column is incubated with maxXbond AX RG1­AX for a period of one hour. During this time, RG1­AX removes all nucleic acid residues from the matrix. Then, the hose is opened and the RG1­AX runs through the col­ umn completely.
After one hour, slowly rinse the column with the entire RG1­AX buffer from the bottom and remove the latter by turning the column upside down – let residu­ al buffer drain for 1 minute.
Now the same volume of RG2­AX is applied to the column from above. RG2­AX removes all RG1­AX traces and restores the original binding capacity. The column is now ready for the binding of the next DNA sample or for storage until its next use.
Now, the same volume of RG2­AX as RG1­AX is added to the column from above and passed through.
RG2­AX removes all traces of RG1­AX and restores the original binding capacity. Upon completion, the column is ready for the binding of the next DNA samp­ le or can be stored until its next use.
Application Incubation
1 hour
Rinse Application
Slow application from the bottom
Incubation
& Rinsing
Draining
Appli- cation
3–5 x after every
15-20 min
If necessary, incubation with RG1­AX can take place overnight as well. Tests of 24 hours of incubation did not result in any damage to the columns or a reduced
DNA binding capacity.
© 2008 AppliChem • Nucleic acid decontamination

Regarding the silica­based anion exchange resins, big differences can be found in the structure and quality of the anion exchange resins and the column matrix, de­ pending on the manufacturer.
It is recommended to regenerate the anion ex­ change columns directly after use, since contamina­ tions are much easier to remove at that early stage.
Reduced binding capacity following prolonged storage
A few regenerated columns show a reduced binding capacity for new DNA after extensive storage. A re­ newed RG1­AX and RG2­AX treatment directly preced­ ing the new preparation restores the optimal conditions
– therefore, do not immediately discard the columns!
The renewed treatment with RG1­AX and RG2­AX solves most of these problems. To this day, we have not yet lost a single column. Not all column brands can be regenerated!
The columns by the market leaders invariably are of a quality prerequisite for multiple regeneration. These products were regenerated fifteen times in tests of our own and re­used for new DNA isolations. In these tests, no contaminations were detected and the DNA binding capacity was identical to or even higher than a compa­ rable new column. After several regeneration processes a slightly reduced flow rate through the columns may occur, which, however, does not have any impact on the quality and quantity of the purified DNA. With products of other manufacturers, a multiple use of some columns can lead to problems. The flow rate, for instance, can be drastically reduced or the silica matrix detaches from the carrier material.
At present time, it is impossible to give recommen­ dation for all columns available on the market. How­ ever, by looking for quality and brand products, a re­ peated regeneration of these quality products should not be a problem.
Clogged columns
Loose pellet residues from plasmid preparations or other sources of DNA can contaminate the column, if the clear supernatant after centrifugation of the pre­ cipitation is not removed with a pipet and applied to the mini column but is directly poured onto the column from the reaction tube. To prevent this from happen­ ing, the DNA­containing supernatant should be trans­ ferred to the column with a pipet. Tests have also shown that the quality of the lysis buffer and the solu­ tions for the neutralization / precipitation is of major importance. If these are not optimized for a “clean” precipitation, contaminated supernatants can clog the columns. The use of the maxXmore reagents precludes this problem. In case of a particularly high contamina­ tion of the columns or especially critical preparations, the incubation time of RG1­AX on the column matrix can be increased to up to 24 hours. At the same time, the application of RG1­AX can be effected from below with a syringe. This permits an especially thorough pu­ rification of the matrix and simultaneously removes particles that may have deposited on the upper mem­ brane.
Discolorations of the column materials
Until now, no discolorations caused by small, insoluble residues of the color indicator after the application of maxXbond AX could be observed. Nevertheless, if this should occur, they do not cause any problems and usu­ ally they can be removed with a 50 mM EDTA solution
(pH 8.0 – similar volume as for RG1­AX and RG2­AX).
The EDTA solution is applied after RG1­AX and is re­ moved from the column by simple rinsing (gravity).
Precipitate of RG1-AX on the column
In some overnight incubation processes with RG1­AX, components of RG1­AX may precipitate on the mem­ brane because of air condition systems set at too low a temperature (e. g., 14 °C instead of 21 °C). This precipi­ tate can be washed off with RG2­AX at 40 °C. We rec­ ommend rinsing twice with RG2­AX.
Filter units
In some kits, insoluble components after cell disruption are not only removed by centrifugation, but by filter units before the plasmid solution (“cleared lysate“) is applied to the column. If these filter units are no longer present, it absolutely suffices to fill the syringe with some sterile gauze, sterile cotton or siliconized glass wool and then to filter the plasmid solution through it.
Nucleic acid decontamination • AppliChem © 2008


The widely spread view autoclaving would completely destroy nucleic acids, should really be a thing of the past. To many it comes as a surprise that one of the main causes of nucleic acid contamination in laboratories is the autoclave itself! Perfect as the autoclave may be for the inactivation of living microorganisms, it is badly suited for the sustained removal of nucleic acid molecules (Espy, M.J. et al. 2002, Elhafi et al. 2004, Simmon et al. 2004).
DNA molecules in recombinant microorganisms are merely fragmented in the autoclave and subsequently released with the vapors when opening and distributed in large quantities. The statistical size of such fragments of 1 to 2 kb is ideal for amplification in PCR reactions or for transformations. As a consequence, cleanroom laboratories for DNA analytics have removed autoclaves from their immediate working area.
One basic problem is that there are no standardized tests to prove the actual decomposition of nucleic ac­ ids. Finally, a specially developed DNA strand break­ age test was able to show that the DNA did not really decompose in all commercial DNA decontamination reagents. It can simply no longer be amplified! This does not mean that the DNA is completely degraded.
Basically, there are two options that lead to the DNA being no longer amplifiable:
1. by degradation of DNA (e.g., by adding DNases or by chemical decomposition) or
2. by modifying the bases – which leaves the strand intact and only blocks reading!
DNA­ExitusPlus TM (A7089) most effectively destroys
DNA and RNA on a wide variety of surfaces. DNA­Exi­ tusPlus™ not only introduces strand breakages into the
DNA/RNA but also breaks down the DNA/RNA into their individual components. An amplification in PCR is no longer possible. Based on this patented product,
Autoclave­ExitusPlus™ was developed. By adding Au­ toclave­ExitusPlus™ to residual cultures or buffer solu­ tions, the nucleic acids are effectively destroyed in the subsequent autoclaving process.
1. Catalytic and cooperative effects of the solution components result in a very fast, non­enzymatic, non­sequence­specific degradation of DNA and
RNA molecules.
2. All components of Autoclave­ExitusPlus™ are bio­ degradable, harmless to humans and non­toxic.
3. No aggressive mineralic acids or bases are being employed, ensuring that appliances and materials will not be attacked, damaged or destroyed, even after prolonged exposure.
4. Aqueous solution: therefore, no organic solvents or volatile components, no toxic vapors.
5. At temperatures of 50 °C and above, reaction speed and effectiveness increase.
Studies have shown that at high temperatures – in par­ ticular during the autoclaving process – the speed of reaction multiplies. DNA composition and the “addi­ tional” sterilization effect are achieved, even if the au­ toclaving temperature is not fully reached, for instance, if the autoclave is defective or incorrectly set or be­ cause a big quantity of liquids inside does not reach the
120°C level, for instance in autoclaving processes with­ out temperature probe inside the medium. In such cases, the autoclave additive offers additional safety.
© 2008 AppliChem • Nucleic acid decontamination

Fig. 1 Autoclave treatment of recombinant bacteria only leads to a partial decomposition of DNA.
Over a period of 20 minutes, 50 ml cultures of recombinant E. coli were subjected to autoclave treatment at 120 °C and 1.2 bar after adding water
(-) or Autoclave-ExitusPlus™ (+). Next, 10 µl of aliquots of these cultures were examined in the analytical DNA agarose gel. After adding sterile water (-), big quantities of higher molecular DNA fragments are still present after the autoclave treatment. An identical culture with a similar addition in volume of Autoclave-ExitusPlus™ (+) shows a degradation of the DNA into fragments smaller than 20 base pairs. Two comparative samples were used from the same basis.
Fig. 2 PCR analysis of the autoclave-treated E. coli cultures from Fig. 1
The recombinant E. coli cultures contained a plasmid with the resistance gene for ampicillin (Amp R -gene). Therefore, after autoclave treatment,
2 µl aliquots of the cultures were tested in PCR reactions with primers for the entire Amp R -gene. The sample with sterile water (-) results in strong PCR bands for the entire Amp R gene. The sample preparation with Autoclave-ExitusPlus™ (+), however, does not contain intact DNA fragments for the Amp R gene. As positive control (K) a 2 µl aliquot of the sample with Autoclave-ExitusPlus™ was mixed with 2 ng template DNA for the Amp R gene. The amplification of the respective DNA template in this reaction reveals that the PCR reaction can run normally under these circumstances. Two comparative samples of the same preparation were used.
efforts were made to detect the ampicillin resistance gene through PCR analysis. Without Autoclave­Exi­ tusPlus™ it is possible (Fig. 2)!
To remove dried up DNA residues from surfaces is ex­ tremely difficult. Even in autoclaving, they are insuffi­ ciently degraded. Following the autoclaving of virus particles, for example, complete virus genomes could still be detected (Elhafi et al. 2004).
The activity of Autoclave­ExitusPlus™ as an additive to autoclave solutions was examined. Higher tempera­ tures increase the activity!
As depicted in figure 1, the DNA of recombinant
E. coli cultures is not sufficiently destroyed under stan­ dard autoclaving conditions. The addition of Auto­ clave­ExitusPlus™, however, results in an extent of
DNA decomposition that rules out any further danger from these small fragments. On average, the fragments are no bigger than 20 base pairs. To prove the validity,
Literature
Elhafi, G. et al. (2004) Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction. Avian Pathology 33 , 303–306
Espy, M.J. et al. (2002) Detection of Vaccinia Virus, Herpes Simplex Virus, Varicella-Zoster Virus, and Bacillus anthracis DNA by LightCycler Polymerase Chain Reaction After Autoclaving:
Implications for Biosafety of Bioterrorism Agents. Mayo Clin.
Proc. 77 , 624–628
Simmon, K.E. et al. (2004) Autoclave method for rapid preparation of bacterial PCR-template DNA. J. Micobiol. Methods 56 ,
143–149
Nucleic acid decontamination • AppliChem © 2008

General instructions: The product is suited for use at higher temperatures (50 °C to 133 °C, including auto­ claving). Before autoclaving, the powder must be dis­ solved completely. Ensure a good mixing of media, buffer and cell suspensions before introduction into the autoclave. Autoclave­ExitusPlus™ penetrates well mi­ croorganisms and viruses, where it destroys DNA, RNA and recombinant constructs. In case of bigger cell pel­ lets, sufficient resuspension and mixing is required for an efficient penetration.
The standard autoclave process
The standard process for autoclaving cultures and re­ sidual media (waste) or for sterilizing solutions, respec­ tively, employs the following parameters: autoclave for a minimum of 15 minutes at a temperature of 121 °C and a pressure of approximately 2 bar (or 200 kPa). We are talking here of a solution program or “liquid pro­ gram”, which displaces air by vapor. The real steriliza­ tion temperature inside the product itself is always reached later than inside the rest of the chamber.
Therefore, the duration of the autoclave treatment and the quantity to be autoclaved have to be harmonized.
Note: Do not introduce Autoclave­ExitusPlus™ directly into the desalted water of the autoclave or onto the heating elements – residual salt depositions could be the consequence and the color indicator might show discolorations.
Which applications is Autoclave-ExitusPlus™ suited for?
Autoclave­ExitusPlus™ is suited for the removal of nu­ cleic acids from standard buffers and from suspended cells or cell residues in standard growth media. In case of big, non­suspended cell pellets, they first have to be resuspended to ensure the reagent’s access to the indi­ vidual cells.
Solutions with an alkaline pH­value (e. g., alkaline bacteria lysis) have to be neutralized first. Highly con­ centrated buffers and solutions containing salts, acids or bases can dampen the reaction or even completely prevent same. These solutions should consequently be diluted first and then show a pH­value of 4 to 8; adjust value with HCI, if required.
Solutions with high concentrations of chaotropic salts should be diluted to a concentration of 50 to 100 mM; here, the pH­value should be in the range of 4 to
8 as well or be adjusted accordingly.
Removing Autoclave-ExitusPlus™ residues
Autoclave-ExitusPlus™ residues on surfaces: to identify undesired Autoclave­ExitusPlus™ residues on surfaces, a color indicator was added. Once completely dry, the residues appear in a violet to blue color. Such residues can be simply removed by using sterilized water or a
TE buffer and a paper towel.
Disposal of solutions containing Autoclave-ExitusPlus™: since Autoclave­ExitusPlus™ consists of environmen­ tally friendly ingredients only, no particular precautions or regulations have to be observed.
Apportioning
Autoclave­ExitusPlus™ is delivered as a ready­to­use powder mixture. The pack sizes have been chosen in such a way as to ensure that their contents can be used up completely for each application. We do not recom­ mend you remove partial quantities. If stored for longer periods of time, the powder can develop a slightly brownish color. This discoloration does not affect the effectiveness in any way!
Recommendations for use: The contents of the pack are emptied into the corresponding volume of the solution to be autoclave­treated. It is, of course, possible to choose smaller volumes also. The effect of an increased concentration can only be positive. It is recommended that the powder is dissolved by stirring.
It is similarly possible to collect liquid waste in a bigger container before autoclave treatment. The pol­ luted culture containers (e. g., Erlenmeyer flasks, test tubes), but polluted centrifuge containers as well – pro­ vided they are autoclave­proofed – can be decontami­ nated simultaneously inside an autoclave bucket or a big­sized beaker, covered with water and by employing
Autoclave­ExitusPlus™ as an additive.
© 2008 AppliChem • Nucleic acid decontamination

Literature
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K. & Peter
Walter (2002) Molecular Biology of the Cell, Fourth Edition,
Garland Science Textbooks
Amyes, S.G.B. Magic Bullets Lost Horizons: The rise and fall of antibiotics. Taylor & Francis Inc., London (2001)
Balogh, M.K., Burger, J., Bender, K., Schneider, P.M. & Alt, K.W.
(2003) STR genotyping and mtDNA sequencing of latent fingerprint on paper. Forensic Sci. Int. 137 (2–3), 188–195
Becker, Y. (1999) A short introduction to the origin and molecular evolution of viruses. Virus Genes 11 (2–3), 73–77
Bensasson, D., Boore, J.L. & Nielsen, K.M. (2004) Genes without frontiers? Heredity 92 , 483–489
Bollongion, R., Edwards, C.J., Alt, K.W., Burger, J. & Bradley,
D.G. (2006) Early history of European domestic cattle as revealed by ancient DNA. Biol. Lett. 1 , 155–159
Brower, V. (1998). Naked DNA vaccines come of age. Nature
Biotechnology 16 , 1304–1305
Burns, P.A., Jack, A., Neilson, F., Haddow, S. & Balmain, A.
(1991) Transformation of mouse skin endothelial cells in vivo by direct application of plasmid DNA encoding the human T24
H-ras oncogene. Oncogene 6 (11), 1973–1978
Bush, R.M. (2004) Influenza as a model system for studying the cross-species transfer and evolution of the SARS coronavirus.
Philos. Trans. R. Soc. London B. Biol. Sci. 359 , 1067–1073
Cermakian, N., Ikeda, T.M., Cedergren, R. & Gray, M.W. (1996)
Sequences homologous to yeast mitochondrial and bacteriophage T3 and T7 RNA polymerases are widespread throughout the eukaryotic lineage. Nucleic Acids Res. 24 , 648–654
Chen, X., Li, N. & Ellington, A.D. (2007) Ribozyme catalysis of metabolism in the RNA world. Chem. Biodivers. 4 , 633–655
Cohen, M.L. (2000) Changing patterns of infectious disease.
Nature 406 , 762–767
Collins, F.S., Morgan, M. & Patrinos, A. (2003) The Human
Genome Project: Lessons from Large-Scale Biology. Science 300 ,
286–290
Croft, A.C., Antoni, A.V.D. & Terzulli, S.L. (2007) Update on the antibacterial resistance crisis. Med. Sci. Monit. 13 (6), 103–118
Davison, J. (1999) Genetic exchange between bacteria in the environment. Plasmid 42 , 73–91
Kaper, J. & Hacker, J. (Ed.) Pathogenicity islands and other mobile genetic elements. (1999) American Society for Microbiology,
ASM Press, Washington, D.C.
Demain, A.L. (2001) Molecular genetics and industrial microbiology – 30 years of marriage. J. Ind Microbiol. Biotechnol. 6 ,
352–356.
De Vries, J. & Wackernagel, W. (1998). Detection of nptII (kanamycin resistance) genes in genomes of transgenic plants by
marker-rescue transformation. Mol. Gen. Genet. 257 , 606-13
Dzidic, S. & Bedekovic, V. (2003) Horizontal gene transfer-emerging multidrug resistance in hospital bacteria. Acta Pharmacol.
Sin. 24 (6), 519–526
Elhafi, G., Naylor, C.J., Savage, C.E. & Jones, R.C. (2004) Microwave or autoclave treatments destroy the infectivity of infectious bronchitis virus and avian pneumovirus but allow detection by reverse transcriptase-polymerase chain reaction. Avian
Pathology 33 , 303–306
Evans, G.E., Murdoch, D.R., Anderson, T.P., Potter, H.C., George,
P.M. & Chambers, S.T. (2003) Contamination of Qiagen DNA extraction kits with Legionella DNA. J. Clin. Microbiol. 41 (7),
3452–3453
Fields, B.S., Benson, R.F. & Besser, R.E. (2002) Legionella and
Legionnaires' disease: 25 years of investigation. Clin. Microbiol.
Rev. 3 , 506–526
Gibbs, M.J., Armstrong, J.S. & Gibbs, A.J. (2001) Recombination in the hemagglutinin gene of the 1918 „Spanish flu“. Science
293 , 1842–1845
Green, R.E., Krause, J., Ptak, S.E., Briggs, A.W., Roman, M.T.,
Siomns, J.F., Du, L., Egholm, M., Rothberg, J.M., Paunovic,
M. & Pääbo, S. (2006) Analysis of one million base pairs of
Neanderthal DNA. Nature 444 , 330–336
Guyot, A., Barrett, S.P., Threlfall, E.J., Hampton, M.D. & Cheasty,
T. (1999) Molecular epidemiology of multi-resistant Escherichia coli. J. Hosp. Infect. 43 (1), 39–48
Ho, M.-W., Ryan, A. & Traavik, T. (2001) ISIS Report :Unregulated
Hazards ‘Naked’ and ‘Free’ Nucleic Acids. Online publication
(http://i-sis.org.uk/naked.php)
Haak, W., Forster, P., Bramanti, B., Matsumura, S., Brandt, G.,
Tänzer, M., Villems, R., Renfrew, C., Gronenborn, D., Alt, K.W.
& Burger, J. (2005) Ancient DNA from the first European farmers in 7500-year-old Neolithic sites. Science 310 (5750), 1016–1018
Haak, W., Burger, J. & Alt, K.W. (2004) ABO genotyping by
PCR-RFLP and cloning and sequencing. Anthropol. Anz. 62
(4), 397–410
Innis, M.A., Gelfand, D.H., Sninsky, J.J., & White, T.J. (eds)
(1990) PCR Protocols - A guide to methods and applications.
Academic Press, Inc., San Diego, California
Isaacs, F.J., Dwyer, D.J. & Collins, J.J. (2006) RNA synthetic biology. Nat. Biotechnol. 5 , 545–54
Kaiser, J. (2005a) Biocontainment. 1918 flu experiments spark concerns about biosafety. Science 306 (5696), 591
Kaiser, J. (2005b) Virology. Resurrected influenza virus yields secrets of deadly 1918 pandemic. Science 310 (5745), 28–29
Knobler, S. (2003) The Resistance Phenomenon in Microbes and Infectious Disease Vectors. National Academies Press,
Washington,D.C.
Levy, S.B. & Marshall, B. (2004) Antibacterial resistance worldwide: causes, challenges and responses. Nature Medicine 10
(12), 122–129.
Lorenz, M.G. & Wackernagel, W. (1994) Bacterial Gene Transfer by Natural Genetic Transformation in the Environment.
Microbiological Reviews 58 , 563–602.
Makin, T. (2005) Legionella bacteria and water systems in health care premises. Nurs Times 101 (39), 48–49
Maiden, M. (1998) Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria. Clin. Infect. Dis. 27 ,
S12–20
McCarthy, A.D., Hardie, D.G. (1984) Fatty acid synthase - an example of protein evolution by gene fusion. Trends Biochem.
Sci. 9 , 60–62
Mercer, D.K., Scott, K.P., Bruce-Johnson, W.A., Glover, L.A. &
Flint, H.J. (1999). Fate of free DNA and transformation of the oral bacterium Streptococcus gordonii DL1 by plasmid DNA in human saliva. Appl. Environ. Microbiol. 65 , 6–10
Moniz, M., Ling, M., Hung, C.F. & Wu, T.C. (2003) HPV DNA vaccines Front. Biosci. 8 , d55–68
Nucleic acid decontamination • AppliChem © 2008

info
Mulligan, C.J. (2005) Isolation and analysis of DNA from archaeological, clinical, and natural history specimens.
Methods Enzymol. 395, 87–103
Noonan, J.P., Coop, G., Kudaravalli, S., Smith, D., Krause,
J., Alessi, J., Chen, F., Platt, D., Pääbo, S., Pritchard, J.K. &
Rubin, E.M. (2006) Sequencing and analysis of Neanderthal genomic DNA. Science 314 (5802), 1113–1118
Normark, B.H. & Normark, S. (2002) Evolution and spread of antibiotic resistance. J. Int. Med. 252 , 91–106
Pace, N. (1997) A molecular view of microbial diversity and the biosphere. Science 276 , 734–739
Pääbo, S., Poinar, H., Serre, D., Jaenicke-Despres, V., Hebler,
J., Rohland, N., Kuch, M., Krause, J., Vigilant, L. & Hofreiter,
M. (2004) Genetic analyses from ancient DNA. Annual Rev.
Genet. 38 , 645–679
Peters, R.P.H., Mohammadi, T., Vandenbroucke-Grauls,
C.M.J.E., Danner, S.A., van Agtmael, M.A. & Savelkoul,
P.H.M. (2004) Detection of bacterial DNA in blood samples from febrile patients: underestimated infection or emerging contamination? FEMS Immunol. Med. Microbiol. 42 ,
249–253
Rowe-Magnus, D.A., Guerout, A.M., Ploncard, P., Dychinco,
B., Davies, J. & Mazel, D. (2001). The evolutionary history of chromosomal super-integrons provides an ancestry for multiresistant integrons. Proc. Natl. Acad. Sci. U.S.A. 98 , 652–7
Rowe-Magnus, D.A., Davies, J. & Mazel, D. (2002). Impact of integrons and transposons on the evolution of resistance and virulence. In (Hacker, J, & Kaper, J.B. eds.) Pathogenicity
Islands and the Evolution of Pathogenic Microbes Vol 2. p.167–188. Springer-Verlag
Row-Magnus, D.A. (2002) The role of integrons in antibiotic resistance gene capture. Int. J. Med. Microbiol. 292 (2),
115–25 (Review)
Sambrook, J. & Russel, D.W. (2001) „Molecular cloning: A laboratory manual“. 3rd ed. Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York
Simmon, K.E. et al. (2004) Autoclave method for rapid preparation of bacterial PCR-template DNA. J. Micobiol.
Methods 56, 143-149
Steinmoen, H., Teigen, A. & Havarstein, L.S. (2003)
Competence-induced cells of Streptococcus pneumoniae lyse competence-deficient cells of the same strain during cocultivation. J. Bacteriol. 185 , 7176–7183
Vlassov, A.V., Kazakov, S.A., Johnston, B.H. & Landweiber,
L.F. (2005) The RNA world on ice: a new scenario for the emergence of RNA information. J. Mol. Evol. 61 (2),
264–273
White, D.G. et al. (2001) Isolation of Antibiotic Resistant
Salmonella From Retail Ground Meats. NEJM 345 , 1147–
1154 (see also pp. 1155–60, 1161–6, 1202–3) van der Zee, A. Peeters, M., de Jong, C., Crielaard, J.W.,
Claas, E.C.J. & Templton, K.E. (2002). Qiagen DNA extraction kits for sample preparation for Legionella PCR are not suitable for diagnostic purposes. J. Clin. Microbiol. 40 (3),
1126.
Transfer
Membranes
Detergents www.
Take the Pink Link!
.com
Detergents
Detergents are more than just air bubbles. Read more about what to take into consideration when choosing a detergent.
Immunoassay
Buffer www.
Take the Pink Link!
.de
Transfer membranes
We supply a selection of transfer membranes developed and tested for the analysis of RNA, DNA and proteins. All product information and the protocols can be found in the “Transfer Membranes” brochure.
Biological
Buffers www.
Take the Pink Link!
.com
Immunoassay buffer
Anybody, who ever conducted an
ELISA, RIA, Blot or other immunoassay knows: Many assays cannot be evaluated, because the background is too strong. This brochure informs about this problem and the products to resolve these problems. www.
Take the Pink Link!
.de
Biological buffers
Basically no experiment exists, that does not employ any buffer substance.
The “Biological Buffers” brochure offers an overview of the characteristics, the selection criteria and useful hints regarding the use of biological buffers.
Safety First:
Banish Mycoplasma.
treatment detection prevention
Gel Electrophoresis
Size Marker
Take the Pink Link!
Take the Pink Link!
www.
.com
www.
.de
Safety First:
Mycoplasma in cell cultures?
Many cell cultures are contaminated with mycoplasma. Apart from a control kit to prove the existence of mycoplasma contamination, we also offer the antibiotics for the treatment of cell cultures and reagents for the preventive cleaning of the CO
2
incubators and water baths. lab&more
The contents: rich in information, surprising, curious, informative, thrilling, exclusive and more – the XXL-sized magazine for all who simply want to know more… service@applichem.com
Gel electrophoresis size standards
Part of our range: ready-to-use DNA and protein markers and – in addition
– lyophilized DNA markers.
Read all about it in our brochure
“Gel electrophoresis Size Marker”.
;gdbHX^Zci^hihidHX^Zci^hih
^c+*8djcig^Zh
&$%,
;gdbHX^Zci^hihidHX^Zci^hih^c+
*8djcig^Zh
'$%,
D[[^X^VaBZY^VEVgicZg
6^YhYgVbVVabdhiV[VXi
?d^cjh
###
BVYZ^c<ZgbVcn

A72