DNA & RNA
Unit 4: DNA & RNA
Chapter 12-1
Nucleic Acids
• DNA and RNA are nucleic
acids (polymer) made up of
many nucleotides
(monomer) put together.
• DNA’s main purpose is to
code for proteins.
Learning Goals
•  1. What is the main job of DNA? Why are
genes important?
•  2. Describe the structure of DNA. (Include
the 3 parts of a nucleotide)
•  3. Explain the base pairing rules.
•  4. Describe the parts of a DNA double helix
•  5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.
DNA: deoxyribonucleic acid
• Genes are made up of DNA
– 1. Genes carry information from
one generation to the next.
– 2. Genes determine inherited
traits.
– 3. Genes are easily copied.
– Proteins express our genes!
1
Structure of DNA
• Made up of nucleotides (3 parts):
– 1) Deoxyribose: sugar
– 2) Phosphate group: connects the sugars
– 3) Nitrogenous base: 4 bases in DNA
• Bases in DNA:
•  Purines = adenine(A) & guanine(G)
•  Pyrimidines = cytosine(C) & thymine (T)
Base Pairing Rules
• Hydrogen bonds can only form
between certain base pairs:
1)  adenine only bonds to
thymine (Aunt = Tía)
2)  guanine only bonds to
cytosine (Cat = Gato)
2
Practice pairing the bases to
complete the DNA
• ATCGGCTCAATCGATTACCA
• TAGC
The Human Genome Project
3
The Human Genome Project
Discovery of DNA
•  Rosalind Franklin used X-ray
diffraction to get information
about the structure of DNA.
• She aimed an X-ray beam at
concentrated DNA samples and
recorded the scattering pattern of
the X-rays on film.
4
The Double Helix – Using clues from Franklin’s
pattern, James Watson and
Francis Crick built a model
that explained how DNA
carried information and could
be copied.
• Shape of DNA: Double Helix
Double helix:
Double (2)
stranded,
twisted ladder
5
•  Rails of the ladder
(sides) – formed by
the “sugarphosphate
backbone”
– repeating
deoxyribose sugar
and phosphates
•  Steps of the ladder
(middle) - formed by
nitrogenous base
pairs (A, T, G, C)
– two strands of the
ladder are
“complimentary”.
(they go together)
RNA: ribonucleic acid
• The two DNA strands are “antiparallel” meaning that they
run in opposite directions.
– One strand is upside down
compared to the other strand
•  RNA is used to take
DNA info outside the
nucleus.
–  Structure
•  RNA is a single strand
•  RNA has ribose sugar
instead of deoxyribose
sugar
•  RNA uses Uracil
instead of Thymine
6
Learning Goals
•  1. What is the main job of DNA? Why are
genes important?
•  2. Describe the structure of DNA. (Include
the 3 parts of a nucleotide)
•  3. Explain the base pairing rules.
•  4. Describe the parts of a DNA double helix
•  5. Compare & Contrast DNA & RNA (Give
at least 2 similarities & 2 differences.
7