Journal of Cell Science 109, 1497-1507 (1996)
Printed in Great Britain © The Company of Biologists Limited 1996
JCS7050
1497
Blackjack, a novel protein associated with microtubules in embryonic
neurons
Karen R. Zachow* and David Bentley
Neurobiology Division, Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720, USA
*Author for correspondence
SUMMARY
Microtubule-associated proteins can influence the organization, stability and dynamics of microtubules. We characterize a novel protein that associates with microtubules as
assessed by immunofluorescence, immunoelectron
microscopy, and co-sedimentation. The protein is
expressed heavily in embryonic neurons and, to a lesser
extent, in epithelial and mesodermal cells. The cDNA
sequence predicts a protein of 1,547 amino acids and
approximately 170 kDa. Immunoblot of embryo lysate
demonstrates bands of approximately 240 and 260 kDa.
The predicted amino acid sequence contains 77 potential
serine/threonine phosphorylation sites. A distinctive
feature is a predicted α-helical central domain comprising
21 identical repeats of an 11 amino acid sequence
(PLEELRKDAAE). The protein is thermostable and has
two major charge-domains: the amino-terminal 80% has
an estimated pI of 4.0 and the carboxy-terminal 20%, a pI
of 12.2. The protein shares several general biochemical and
molecular features of MAPs, but its sequence is not similar
to that of any described MAP.
INTRODUCTION
and tau were expressed in non-neuronal cells (Knops et al.,
1991; Chen et al., 1992). The microtubule organization in these
MAP-induced processes indicates that the projection domains
of the MAPs seem likely to be key determinants of spacing
between microtubules in axons and dendrites (Lewis et al.,
1989; Chen et al., 1992). MAP2 and tau, but not MAP1b, cause
microtubule bundling in fibroblasts and other cell types (Lewis
et al., 1989; Kanai et al., 1992). In vitro, microtubule dynamics
can be influenced by neuronal MAPs (Drechsel et al., 1992;
Pryer et al., 1992). The enrichment of MAP1b at the distal end
of the axon suggests a role for it in assembly dynamics of microtubules at the growth cone (Black et al., 1994).
The in situ behavior of microtubules during axon outgrowth
and growth cone steering in response to guidance cues has been
observed in grasshopper neurons (Sabry et al., 1991). Selective
invasion of branches of the growth cone by microtubules, or
the selective retention of microtubules in specific branches,
underlies directional changes of growth cones in response to
in situ guidance cues. In the course of screening for antigens
heavily expressed in neurons during axon outgrowth, we identified a novel microtubule associated protein. This protein is
named blackjack to highlight a distinctive feature of the
sequence: 21 identical repeats.
In neurons, microtubules underlie the essential processes that
establish cellular polarity, axonal transport, and growth cone
steering. The organization of microtubules, with other components of the neuronal cytoskeleton, is a determinant of the
elaborate shapes of neurons (Craig and Banker, 1994). Microtubules facilitate the targeted transport and delivery of
organelles, vesicles, and specific mRNAs in axons (Okabe and
Hirokawa, 1989; Litman et al., 1994). Microtubules are
essential for neurite elongation and axon outgrowth, and
microtubule dynamics in the axonal growth cone are critical
elements of directional movement and axon elongation (Lin
and Forscher, 1993; Tanaka et al., 1995).
Microtubule-associated proteins (MAPs) include a variety of
proteins that function through their interaction with the microtubule cytoskeleton to support many of these cellular tasks.
MAPs have been postulated to influence differentiation and
neurite outgrowth through a role in microtubule organization
and their effects on microtubule dynamics. The cytoplasmic
microtubule-associated motor proteins kinesin and dynein are
responsible for anterograde and retrograde vesicle and organelle
transport (Walker and Sheetz, 1993). MAP1b, most strongly
expressed in growing axons (Riederer et al., 1986), plays a role
in axon elongation that is dependent upon its state of phosphorylation (Brugg et al., 1993; Ulloa et al., 1993). Suppression of
MAP2 and tau expression also results in a decrease in neurite
and axon formation and outgrowth (Caceres et al., 1991, 1992).
Additionally, their role in neurite outgrowth was supported by
the formation of long processes resembling axons when MAP2
Key words: Microtubule-associated protein, Neuron, Axon
MATERIALS AND METHODS
Monoclonal antibodies
Schistocerca americana embryos were dissected from eggs and staged
according to percentage of development time completed (Bentley et
al., 1979). Balb/c mice were immunized with homogenate prepared
1498 K. R. Zachow and D. Bentley
from thoraxes of 35% embryos in PBS. Each injection included 250
to 1,000 µg of protein with either Freund’s complete or incomplete
adjuvant. The immunization schedule, myeloma fusion, and
hybridoma cell plating followed standard protocols. Hybridoma
supernatants were screened for antibody production on fixed, 35% S.
americana embryos by immunocytochemistry with fluorescently
labeled secondary antibodies as described below. mAb 27D9 was
investigated because it labeled extending axons.
Immunocytochemistry
Embryos were dissected into grasshopper saline (Bentley et al., 1979),
rinsed with PBS, and fixed for 30 minutes in 3.7% formaldehyde in
PEM (100 mM Pipes, 2 mM EGTA, 1 mM MgSO4, pH 6.9). After
three rinses in PBS and permeabilization in PBT (PBS with 0.5% BSA
and 0.5% Triton X-100), the embryos were incubated in primary
antibody diluted in PBT overnight at 4°C. After a PBT wash at room
temperature (rt), embryos were incubated in secondary antibody for
4 hours, washed in PBT, mounted in Hanker-Yates medium, and
examined on a Nikon epifluorescence microscope or a Bio-Rad MRC
600 confocal microscope.
mAb 27D9 was used at a concentration of 1:1, rabbit anti-horseradish peroxidase (anti-HRP) antiserum (Cappel, Organon Teknika
Corp.) was diluted 1:2,000, and mouse anti-microtubule mAb (gift of
D. Asai) was diluted 1:500. Secondary antibodies included: TRITCconjugated goat anti-mouse IgG (Jackson Laboratories, Inc.) used at
1:1,500 dilution, FITC-conjugated goat anti-rabbit IgG (United States
Biochemical) used at 1:1,000 dilution in PBT, and Cy3-conjugated
donkey anti-mouse (Jackson Laboratories, Inc.), used at 1:1,000.
For cell culture, eggs were sterilized in 0.02% benzothonium
chloride. The ventral nerve cord and underlying epithelium were
dissected from 40% embryos and incubated 1 hour at 31°C in 0.5%
elastase (Sigma). After rinses in saline containing 5 mM EGTA and
0.1% BSA, the tissue was triturated with a fire-polished pipette until
the cells were dissociated. Cells were plated onto chambered microscope slides and incubated in supplemented RPMI medium (Sabry et
al., 1991) for 4 hours at 31°C under 5% CO2 atmosphere. Cells were
rinsed with PBS, fixed in methanol on dry-ice for 5 minutes, rehydrated with PBS, and stained with mAb 27D9 as above (Fig. 2A,B),
or (Fig. 2C,D) lysed in H2O (with 5 µg/ml taxol)‚ permeabilized with
0.5% Triton X-100, 1 mM EGTA, 80 mM Pipes-KOH (pH 6.8), 1
mM MgCl2, 5 µM taxol, and 10% glycerol, then fixed in methanol as
above.
Immunoelectron microscopy
Limb buds of 34% embryos were cut along the long axis of the limb,
unrolled flat, and the mesodermal cells from the lumen of the limb
removed by a suction pipette. This dissection exposes the Ti1 neurons
on the basal surface of the anterior limb epithelium (Sabry et al., 1991).
The tissue was permeabilized by a 12 second incubation with 0.1%
Triton X-100 in 80 mM Pipes-KOH, pH 6.8, 1 mM MgCl2, 1 mM
EGTA, and fixed for 45 minutes in 3.7% formaldehyde and 0.1% glutaraldehyde in PEM. After three 10 minute washes in PBS, two 30
minute washes in PBT, and one 30 minute wash in PBT + 0.5% normal
goat serum (NGS), the tissue was incubated at 4°C overnight in a 1:1
dilution of the mAb 27D9 in PBT + 0.5% NGS. Following extensive
washing in PBT, the tissue was bathed in blocking buffer (PBS, 1.0%
BSA, 0.1% cold water fish gelatin, 1.0% Tween-20, pH 6.0) for 30
minutes and then incubated for 4 hours in anti-mouse IgG conjugated to
10 nm gold (Ted Pella, Inc.) diluted 1:20 in blocking buffer. After a 20
minute wash in PBT, the tissue was post-fixed with 2% glutaraldehyde
in PBT for 45 minutes and then washed with PBT and with PBS. The
tissue was embedded in Lowicryl HM20 resin (Electron Microscopy
Sciences) and 70 nm sections were counter-stained and viewed with a
JEOL 100C electron microscope operating at 80 kV.
Protein analysis
Embryos were dissected from eggs, rinsed with PBS, and homoge-
nized in lysis buffer (150 mM NaCl, 10 mM triethanolamine, 2%
Nonident-P40, 0.5% deoxycholate, pH 8.2) containing 1 mM PMSF
and protease inhibitors (1 µg/ml of antipain, chymostatin, leupeptin,
pepstatin A, Nα-p-tosyl-L-lysine chloromethyl ketone and N-tosyl-Lphenylalanine chloromethyl ketone). The homogenate was rocked at
4°C for 1 hour and the insoluble material was removed by centrifugation. Protein samples were separated by SDS-PAGE and transferred
to nitrocellulose. Blots were blocked in blot buffer (PBS containing
10% bovine serum and 0.05% Triton X-100) and incubated overnight
at 4°C in a 1:4 dilution of mAb 27D9 in blot buffer. Blots were
washed with several changes of buffer over 30 minutes and then
incubated with a 1:1,000 dilution of goat anti-mouse IgG conjugated
to alkaline phosphatase (AP) (Boehringer-Mannheim). After two 10
minute washes in PBS, 0.05% Triton X-100 and one wash with PBS,
the blots were developed with 350 µg/ml nitro blue tetrazolium (NBT)
and 175 µg/ml 5-bromo-4-cholor-3-indolyl phosphate (BCIP) in 100
mM Tris-HCl, pH 9.5, 100 mM NaCl, 50 mM MgCl2.
Microtubule pelleting assay
Embryos (45%) were dissected from eggs, washed with PBS and
collected by a brief centrifugation. A volume of BRB80 buffer (80
mM Pipes-KOH, pH 6.8, 1 mM MgCl2, 1 mM EGTA, 1 mM PMSF,
10 µM benzamidine, 1 µg/ml phenanthroline, 10 µg/ml aprotinin,
leupeptin, pepstatin A; Kellogg et al., 1989) equal to that of the
embryo pellet was added and the embryos were homogenized into a
smooth suspension. After the preparation was cleared at 13,000 g, the
supernatant was centrifuged 1 hour at 100,000 g at 4°C. The high
speed supernatant was supplemented with DTT (0.5 mM), GTP (1
mM) and taxol (10 µM) and incubated at 32°C for 5 minutes and on
ice for 15 minutes. The reaction was centrifuged 10 minutes over a
2× volume cushion of 50% glycerol in BRB80X (BRB80, 0.5 mM
DTT, 1 mM GTP, 5 µM taxol) at 100,000 g at 4°C. The supernatant
was recovered, the cushion discarded and the pellet washed with rt
BRB80X and then resuspended in sample buffer. Equal samples of
pellet and supernatant were run on SDS gels and immunoblots were
processed as described above. In some experiments, the high speed
supernatant was supplemented with 20 µM taxol and purified bovine
brain tubulin (Cytoskeleton, Denver, CO) to amounts indicated (Fig.
5).
cDNA and RNA analysis
DNA manipulations were by standard methods (Sambrook et al.,
1989) unless noted. A λgt11 cDNA expression library, constructed
from RNA isolated from 50% grasshopper embryos, was screened
with mAb 27D9 using standard procedures. A λZAPII cDNA library,
generated from 40% grasshopper embryo nerve cord RNA, was
screened by hybridization with the 5′ most section of cDNA clone 9
isolated from the λgt11 library to find clones containing the 5′ end of
the cDNA. cDNA inserts were subcloned into plasmids and, for
sequencing, overlapping DNA fragments were subcloned and exonuclease III reactions were used to generate nested deletions (Henikoff,
1987). The nucleotide sequence was determined using Sequenase
reagents (United States Biochemical). To determine the number of 33
bp repeats in the blackjack gene, the region was amplified from
grasshopper genomic DNA with PCR. The oligonucleotide primers
used in the PCR were 5′ of the repeat [GTGCATGAAACACGTTCAGATCTCATG] and 3′ of the repeat [GTCCAACTTCTCCACTTTTGTATCTCC]. The PCR product was cut at
internal BamHI and StyI sites and the sequence was determined using
exonuclease III nested deletions through the repeat region. The size,
and thus repeat number, was determined by electrophoresis through
a variety of gels. Sequence data was compiled and analyzed using
software packages from IntelliGenetics and from the University of
Wisconsin Genetics Computer Group (GCG). Data base homology
searches were performed at the National Center for Biotechnology
Information using the BLAST network service (Altschul et al., 1990).
Total RNA was isolated from 40% embryos using the method of
Novel MAP in embryonic neurons 1499
Chomczynski and Sacchi (1987), electrophoresed through a 6%
formaldehyde-1% agarose gel and transferred to nitrocellulose. The
filter was hybridized with 32P-labeled blackjack clone 10 cDNA using
standard conditions and was exposed to Kodak XAR-5 film in conjunction with an intensifying screen.
For whole mount in situ hybridization, dissected 35% S. americana
embryos were fixed for 45 minutes in 4% paraformaldehyde in 0.1 M
Hepes, pH 6.9, 2 mM MgSO4, 1 mM EGTA, and washed three times,
5 minutes each, in PBS, 0.1% Tween-20 (PTw). After incubation in
50 µg/ml proteinase K for 4 minutes and two washes in PTw, the
embryos were post-fixed for 20 minutes in the paraformaldehyde
solution and washed again in PTw for 30 minutes. Sense and antisense RNA probes labeled with digoxigenin-11-UTP (BoehringerMannheim Biochemicals) were made from blackjack cDNA clone 10
using T3 or T7 RNA polymerase. Hybridization reactions, modifications of Kopczynski and Muskavitch (1992), were performed and the
probe was detected using an anti-digoxigenin antibody conjugated to
AP and visualized with NBT/BCIP.
COS cell transfection
The full-length λ cDNA clone 9C-13 was subcloned into a modified
pCDM8 expression vector. All DNA for transfection was purified on
a CsCl gradient and dissolved in Dulbecco’s Ca2+-Mg2+-free PBS
(CMFPBS). COS-1 cells were maintained at 37°C in DME supplemented with 10% heat-inactivated FCS and 50 µg/ml gentamycin
(DME-FCS) (Gibco-BRL). At 20 hours before transfection, COS-1
cells were plated onto collagen-coated chambered microscope slides
in DME containing 10% Nu-serum (Collaborative Biomedical Prod.)
and 50 µg/ml gentamycin (DME-Nu). Transfection medium,
composed of DNA, 0.4 mg/ml DEAE-dextran and 0.1 mM chloroquine phosphate in DME-Nu, was added to the cells using 2 µg DNA
and 1 ml/slide. After 3 hours of incubation, the transfection medium
was removed and replaced with 1 ml of 10% DMSO in CMFPBS for
4 minutes. The DMSO/PBS was aspirated and the cells were
incubated in DME-FCS for 48 hours, 3 ml/slide. Cells were fixed with
3.7% formaldehyde in PEM for 15 minutes at rt and labeled for
immunofluorescence as described above. After the final PBT washes,
the cells were labeled with 0.1 mg/ml Hoechst 33258 (Sigma
Chemical Co.) in PBT for 15 minutes and then washed with PBT
before the application of mounting medium.
RESULTS
Expression of 27D9 antigen
Using homogenized 35% grasshopper embryos as immunogen,
a panel of mouse monoclonal antibodies (mAbs) was
generated. The hybridoma supernatants were screened by
immunocytochemistry on fixed embryos for the ability to
recognize antigens expressed during initial axon outgrowth.
The mAb designated 27D9 labeled axons and was used to characterize the antigen.
The 27D9 antigen is heavily expressed in axons of the
central (CNS) and peripheral (PNS) nervous system. Doublelabeling of embryonic neurons with antibodies that recognize
membrane-associated antigens (Fig. 1A; Jan and Jan, 1982),
and with mAb 27D9 (Fig. 1B), reveals that the 27D9 antigen
is found in the cytoplasm of the cell body, axon, and growth
cone, but not in filopodia. These are the regions within which
microtubules are confined in these neurons (Sabry et al., 1991).
The epitope recognized by mAb 27D9 appears to be intracellular, as live, unfixed cells are not labeled with the mAb (data
not shown). In epithelial and mesodermal cells, the antigen is
expressed at a lower level (Fig. 1).
Fig. 1. Expression of 27D9 antigen in neurons in situ. A 34%
embryo was labeled with a neuron-selective antibody (anti-HRP; A)
and with mAb 27D9 (B) and imaged with confocal microscopy.
From the cell bodies (left) through the growth cones (right), 27D9
antigen fills the cytoplasm of the pair of Ti1 afferent pioneer
neurons. In the growth cone, it is present in branches (arrowhead,
A,B) and in lamellipodia (arrow, A,B), but not in filopodia. Note the
relatively reduced labeling of the underlying epithelium. Bar, 20 µm.
Consistent with its presence in epithelial cells, 27D9 antigen
can be detected in differentiating neurons, such as the Ti1
afferent pioneer neurons, at the time they delaminate from the
epithelium. The change in intensity of immunolabeling
indicates that the antigen is strongly upregulated as the nascent
neurons differentiate and initiate axonogenesis. The axons
become the most strongly labeled component of the limb (Fig.
1). Axons of the CNS are also strongly labeled with mAb 27D9
and this label persists in axons at least until the time of
hatching. Thus, expression of the antigen in neurons does not
appear to undergo much temporal variation during embryogenesis.
Intracellular location of 27D9 antigen
To investigate the intracellular location of the antigen, cells
from the ventral nerve cord, primarily neurons, were dissociated, cultured, labeled with mAb 27D9, and examined with
epifluorescence. The 27D9 mAb stains discreet, linear structures in the cytoplasm, axon and growth cones of permeabilized cells (Fig. 2A,B). Since insect cells do not have cytoplasmic microfilaments, we conclude that the labeled structures
are microtubules (cf Fig. 2C). 27D9 labeling of microtubules
1500 K. R. Zachow and D. Bentley
Fig. 2. Expression of 27D9 antigen in dissociated
neurons. In methanol fixed cells from the embryonic
CNS, mAb 27D9 labels microtubules in non-neuronal
cell bodies (A), and in neuronal processes and growth
cones (B). In CNS neurons that have been lysed with
H2O, then detergent-solubilized and extracted,
microtubules remain (C, labeled with anti-microtubule
mAb), and 27D9 labeling also remains (D).
(A,B) Optical photomicrographs; (C,D) confocal images.
Bars: (in B for A,B) 25 µm; (in D for C,D) 10 µm.
persists following cell lysing, detergent solubilization, and
extraction (Fig. 2D), indicating a strong association of the
27D9 antigen with polymerized tubulin.
The association of the antigen with the microtubules was
examined by immunoelectron microscopy (Fig. 3).
Embryonic limb buds were dissected so that the basal surface
of the limb epithelium and the Ti1 afferent neurons were
exposed. The tissue was labeled with 27D9 and a secondary
antibody conjugated to 10 nm gold. In cross sections of the
epithelium, the Ti1 afferent axons were located and
examined. Gold particles, indicating the location of 27D9
antigen, were in close association with microtubules, seen in
both cross and longitudinal sections (Fig. 3). Very few gold
particles were seen at other sites in the axoplasm, and
particles were not consistently associated with any structures
other than microtubules.
Immunoblot and co-sedimentation with
microtubules
The mAb 27D9 detects two bands of high molecular mass on
an immunoblot of protein lysate from 40% embryos (Fig. 4A).
The bands are approximately 240 and 260 kDa. The same
result was obtained whether the lysate was or was not reduced
with β-mercaptoethanol before the electrophoresis. Antigen
remained in solution after the lysate was heated to 100°C and
the denatured proteins pelleted by centrifugation indicating
that the 27D9 antigen is thermostable. The two forms of the
27D9 antigen (240/260 kDa) may be due to variations in posttranslational modifications and/or alternate mRNA splicing.
The ability of this antigen to associate with microtubules
was tested in a microtubule co-sedimentation assay (Fig. 4B).
A concentrated cytoplasmic extract was prepared from 40%
embryos. After taxol was added to polymerize endogenous
tubulin, the microtubules and associated proteins were
Fig. 3. Immunoelectron microscopy of mAb 27D9 labeled
microtubules. The limb epithelium of a 34% embryo was labeled
with mAb 27D9, and then a 10 nm gold-conjugated secondary
antibody. Representative cross sections and longitudinal sections of
microtubules in the axons of the Ti1 afferent neurons are shown.
Gold particles were found almost exclusively in association with
microtubules. Bar, 100 nm.
Novel MAP in embryonic neurons 1501
Fig. 4. (A) Total protein lysate, prepared from 40% embryos, was
separated on a 7% SDS-polyacrylamide gel, blotted and probed with
mAb 27D9. The mAb detects two bands of approximately 260 and
240 kDa (molecular mass standards in kDa on left). (B) The antigen
recognized by mAb 27D9 associates with taxol-stabilized
microtubules in a co-sedimentation assay. Cytoplasmic extract was
incubated in the absence (1) or presence (2) of taxol followed by
centrifugation. Equal amounts of each pellet (P) and supernatant (S)
were separated on an 8% SDS polyacrylamide gel and blotted. The
immunoblot of microtubule pelleting assays was probed with mAb
27D9 and an anti-tubulin mAb. Tubulin is the faster migrating band
near the bottom of the blot.
fragments were isolated as well as several full-length clones
(Fig. 6A, 9C-13 and 9C-80).
The 27D9 antigen cDNA recognized mRNA in grasshopper
embryos. When an isolated cDNA (clone 10) was used to probe
a blot of total RNA from 40% embryos, a prominent band of
6.9 kb was detected (Fig. 6B). A minor band of approximately
8 kb is also detected. The relationship between these two bands
is not known.
In situ hybridization with a digoxigenin-labeled anti-sense
RNA probe made from the cDNA clone 10 confirmed that the
putative 27D9 antigen mRNA was expressed in the same cells
that were recognized by mAb 27D9. In the 35% embryo limb,
the Ti1 neurons, which are the cells most intensely labeled by
27D9 mAb, had the strongest hybridization (Fig. 7A). The
27D9 antigen transcript is seen in the thin layer of cytoplasm
surrounding the nuclei of the Ti1 cells and in the axon hillock
(Fig. 7B). No hybridization was seen when a sense strand
probe was used or when the secondary antibody was used alone
(data not shown). The in situ hybridization results also confirm
the antibody finding that there is a much higher level of
expression in the neuronal cells than in the surrounding epithelium.
To further confirm that the cDNA isolated codes for the
protein recognized by the mAb, a full-length 27D9 antigen
cDNA was cloned into an expression vector and transiently
transfected into COS cells. Two days after transfection, the
cells were fixed and double-labeled with Hoechst stain and
collected by centrifugation. An immunoblot of the supernatant
and the pelleted material was probed with mAb 27D9 and an
anti-tubulin mAb. When taxol was added to the extract,
roughly equal amounts of 27D9 antigen were found in the
microtubule pellet and in the supernatant (Fig. 4B, compare
lanes 2P and 2S). Without taxol, neither 27D9 antigen nor
tubulin was found in the pellet, and both were present in the
supernatant (Fig. 4B, compare lanes 1P and 1S). This demonstrates that 27D9 antigen can associate with microtubules.
Bovine tubulin has been shown to incorporate into grasshopper microtubules (Sabry et al., 1991). The addition of purified
(bovine) tubulin to the embryo extract prior to polymerization
resulted in co-sedimentation of additional 27D9 antigen with
the microtubules (Fig. 5). Increased amounts of supplemental
tubulin resulted in increased co-sedimentation of 27D9
antigen. Thus, most or all of the 27D9 antigen is competent to
associate with microtubules, and the incomplete co-sedimentation of the antigen with microtubules in the extract alone
probably reflects an insufficient amount of tubulin in the
extract. Since the assay was done with embryo cytoplasmic
extract and not purified components, it does not show that the
interaction between 27D9 antigen and microtubules is direct.
Cloning and sequence analysis of 27D9 antigen
cDNA
A λgt11 cDNA expression library generated from the mRNA
of 50% grasshopper CNS was screened with mAb 27D9. Eight
cDNA inserts were mapped, partially sequenced, and found to
be overlapping. A second cDNA library, made in λZAPII from
50% grasshopper CNS, was screened with the 5′ most 500 bp
of λgt11 clone 9 (Fig. 6A) to isolate cDNAs containing the 5′
end of the 27D9 antigen cDNA. Many overlapping cDNA
Fig. 5. Microtubule co-sedimentation assay in the presence of
exogenous tubulin. Embryo extract was supplemented with 0, 30, or
60 µg/ml purified bovine tubulin (reactions 1, 2, and 3, respectively)
before the co-sedimentation assay. Equal amounts of each
supernatant (S) and pellet (P) were separated on a 7% SDSpolyacrylamide gel and blotted. The addition of tubulin diminished
the amount of 27D9 remaining in the supernatant, relative to the
pellet; 60 µg/ml of tubulin was sufficient to remove almost all of the
27D9 from the supernatant. Ponceau staining of the blot shows that
most of the extract proteins remain in the supernatant. Tubulin is the
faster migrating band at the bottom of the blot.
1502 K. R. Zachow and D. Bentley
Fig. 6. (A) Diagram of the full-length
cDNA encoding the 27D9 antigen and
some of the λ cDNA clones used in the
analysis. The coding region of the cDNA
is indicated by the raised bar and the
repeat domain by the striped area. The λ
clones span the regions indicated. Clones
9C-13 and 9C-80 are both full-length but
have two different 5′ ends. (B) 27D9
antigen cDNA clone detects mRNA: a blot
containing total RNA from 40% embryos
was probed with 32P-labeled λ clone 10
and reveals a prominent mRNA species of
6.9 kb and a secondary band at 8.0 kb. The
RNA size standards are in kilobases.
(C) Variation at the 5′ end of blackjack
mRNA: the sequences of 2 λ cDNA
clones, 9C-13 and 9C-80, diverge 104 bp
upstream of the first ATG (in bold and
underlined). 9C-80 has a shorter 5′ end
with a total of 137 bp before the ATG
whereas 9C-13 has 233 bp of 5′ end before
the ATG.
mAb 27D9 (Fig. 8A,B, respectively). Roughly 25% of the cells
treated with the cDNA were immunopositive with mAb 27D9.
The Hoechst DNA label was used to locate both transfected
and untransfected cells. Only in cultures that received the 27D9
antigen cDNA did cells stain with the mAb. COS cells transfected with the vector without a cDNA insert were not recognized by mAb 27D9 (data not shown). The results from the
COS cell transfections and the in situ hybridizations combine
to show that the isolated cDNA codes for the protein recognized by the 27D9 mAb.
The nucleotide sequence was determined from overlapping
fragments and nested deletions of a number of cDNA clones
(Fig. 6A and others not shown). The full-length nucleotide
sequence is 6,180 bp and contains one long open reading frame
that is predicted to code for a 1,547 amino acid protein when
the first methionine following an in-frame stop codon is used
as the translation start site (Fig. 9). The predicted translation
start site is similar to the Drosophila consensus start site
(Cavener, 1987) and the nucleotide sequence contains a
consensus polyadenylation signal sequence at the 3′ end. Data
Fig. 7. In situ hybridization demonstrates that 27D9
antigen mRNA is expressed in Ti1 afferent neurons.
(A) 27D9 antigen mRNA, detected in a 35%
embryo limb after in situ hybridization with a
digoxigenin-labeled blackjack cDNA, was most
strongly expressed in the Ti1 cells (arrowhead). Bar,
50 µm. (B) A higher magnification of the Ti1 cell
bodies from a different embryo also shows the large
amount of mRNA in the cytoplasm (arrowhead) and
axon hillock of these cells. Bar, 25 µm.
base comparisons of nucleotide and amino acid sequences
using BLAST programs (Altschul et al., 1990) indicated that
27D9 antigen has no significant sequence similarity to known
proteins. Pairwise comparisons using the BestFit analysis of
the GCG software package demonstrated no homology
between 27D9 antigen and known MAPs in the databases. The
molecular mass calculated from the amino acid sequence is
169,320 Da, about 30% less than that seen on the immunoblot
(Fig. 4A). We term this novel protein blackjack after a distinctive feature of the sequence, the 21 internal repeats (see
below).
Two different 5′ ends have been found on blackjack mRNAs
(Fig. 6C). The two 5′ ends diverge from each other 104
nucleotides upstream of the translation start site. Eight independent cDNA clones were isolated possessing the short, 33
bp 5′ end (e.g. 9C-80) and 2 clones with the long, 129 bp 5′
end (e.g. 9C-13). The nucleotide numbering in Fig. 9 reflects
the longer 5′ end. In primer extension reactions, the band representing the shorter 5′ end was more abundant than the band
of the longer 5′ end just as was seen with the recovery of 5′
Novel MAP in embryonic neurons 1503
acids 861-1,195) have predicted pI values of 4.0, 4.1 and 3.9,
respectively. After a short stretch of hydrophobic amino acids
(amino acids 1,196-1,216), the pI abruptly changes to 12.2 for
the COOH-terminal section (amino acids 1,217-1,547). With
77% of the protein highly acidic, the overall predicted pI is
4.36.
This protein contains 77 potential serine/threonine phosphorylation sites, none of which are in the repeat domain. The
COOH-terminal basic domain is 33% serine and threonine.
There are 35 potential protein kinase C sites, (S/T)X(R/K)
(Woodgett et al., 1986), and 3 potential cAMP- and cGMPdependent protein kinase sites as defined by (R/K)(R/K)X(S/T)
(Glass et al., 1986). Casein kinase II may potentially phosphorylate 35 sites at (S/T)XX(D/E) (Pinna, 1990) and
blackjack may also be a substrate for p34cdc2 as it has 4
(S/T)PX(R/K) consensus sites (Moreno and Nurse, 1990). The
phosphorylation state of blackjack in vivo is unknown.
DISCUSSION
Fig. 8. COS cells transfected with 27D9 antigen cDNA become
immunoreactive to 27D9 mAb. A field of COS-1 cells after
transfection with a full-length 27D9 antigen cDNA is shown with
Hoechst-stained nuclei (A) and with 27D9 mAb (B). The Hoechst
stain reveals all cells in the field both transfected and untransfected.
The mAb 27D9 recognizes cells only in cultures that have been
transfected with the 27D9 antigen cDNA. The arrowheads are
directed at the same nuclei in both A and B. Bar, 100 µm.
end cDNA clones (data not shown). The existence of mRNAs
with the longer 5′ end was supported by 5′-RACE reactions in
which sequences corresponding to the longer end were
recovered.
A striking feature of the nucleotide sequence is the twentyone 33 bp perfect repeats (Fig. 9, double underline of amino
acids). A nested set of deletions were generated from each end
of the repeat domain in order to sequence through it. All of the
33 bp repeats were found to be identical. Although most of the
λ clones recovered appeared to have the same number of 33
bp repeats, the size of the entire repeat domain varied in several
clones. In order to determine the correct number of 33 bp
repeats, a PCR reaction was performed to amplify the repeat
domain from genomic DNA. The recovered DNA fragment
was found to contain 21 perfect 33 bp repeats, consistent in
size with the majority of the λ cDNA clones, and no nucleotide
pairs characteristic of introns. Thus, the variation in the size of
the repeat domain among the λ clones was probably generated
during the cloning process. The 33 bp repeats of the DNA
sequence translate into 21 perfect 11 amino acid repeats of
PLEELRKDAAE. Found in the middle of the protein, the 21
repeats account for 15% of the molecular mass of blackjack.
Secondary structure prediction programs suggest that the
repeat domain and regions just NH2-terminal and COOHterminal to it should form α-helixes (Fig. 10). No other
structure is strongly predicted.
Another notable feature of blackjack is the segregated
charge distribution (Fig. 10). The NH2-terminal segment
(amino acids 1-629), the repeat domain (amino acids 630-860),
and the segment just COOH-terminal to the repeat (amino
We have presented the identification of a novel protein, named
blackjack, that co-localizes with microtubules during axon
outgrowth. The association of this protein with microtubules
was assessed through the distribution of antibodies after
labeling of embryonic CNS cells, including lysed, solubilized
and extracted cells, immunoelectron microscopy analysis of
the microtubules from the Ti1 axons, and the co-sedimentation
of blackjack with taxol-stabilized microtubules. A mAb was
first used to identify this molecule and then to isolate the cDNA
from an expression library. In support of the cDNA actually
coding for the protein recognized by the mAb, the cells in the
embryo that express blackjack mRNA parallel those cells
stained by the blackjack mAb, and nonexpressing cells become
immunoreactive when transfected with the cDNA. The
apparent molecular mass, as determined by SDS-polyacrylamide gel electrophoresis, is approximately 240 and 260 kDa,
whereas the predicted amino acid sequence would suggest a
protein of 170 kDa. The amino acid sequence of blackjack is
distinguished by its 21 perfect repeats of an 11 amino acid
motif and its extremely segregated charged domains. In
grasshopper embryos, blackjack is expressed in epithelial and
mesodermal cells but is most strongly expressed in neurons.
Although the primary sequence is novel, blackjack shares biochemical and molecular characteristics that are common
among many nonmotor MAPs.
Like the thermostable MAP2, MAP4, tau and the 205K
MAP (Olmsted, 1986), blackjack remained soluble after
boiling. Blackjack is divided into two charged domains with
the NH2-terminal 80% of the protein acidic and the COOHterminal 20% basic. This charge profile is similar to that of
MAP2 (Lewis et al., 1988), MAP4 (West et al., 1991) and the
Drosophila 205K MAP (Irminger-Finger et al., 1990) with the
exception that blackjack has no short COOH-terminal acidic
domain. Blackjack has a short hydrophobic stretch at the
boundary between the acidic and basic domains. Segregated
charged domains are also found in MAP1a (Langkopf et al.,
1992), MAP1b (Noble et al., 1989), CLIP-170 (Pierre et al.,
1992) and EMAP (Li and Suprenant, 1994).
If blackjack binds directly to microtubules, its binding
domain is likely to be located in a positively charged region,
1504 K. R. Zachow and D. Bentley
Fig. 9. Nucleotide and predicted amino acid sequences of blackjack. The nucleotide sequence numbers from 1-6,180 and the amino acid
sequence from 1-1,547, are on the right. The nucleotides corresponding to the translation consensus start site and to the polyadenylation
addition signal are indicated by a single underline. The predicted translation termination codon is indicated by the asterisk. From amino
acids 630-860, there are 21 perfect repeats of the 11 amino acid sequence PLEELRKDAAE (each double-underlined). The nucleotide
sequence is also a perfect repeat through this region. These sequence data are available from GenBank/EMBL/DDBJ under the accession
number L76606.
Novel MAP in embryonic neurons 1505
Fig. 10. Analysis of the blackjack amino acid sequence. The schematic diagram of the primary structure of blackjack includes the repeat
domain (striped) and the short hydrophobic region (shaded). The charge profile indicates the pI values of each section as determined by the
IntelliGenetics program pI. Secondary structure predictions were performed by the GCG programs PeptideStructure and PlotStructure. Shown
are the hydrophilicity predictions according to Kyte-Doolittle and the secondary structure analysis by the Garnier-Osguthorpe-Robson (GOR)
method.
in this case in the COOH-terminal domain. This would be consistent with the proposed electrostatic interaction between
MAPs and microtubules (Paschal et al., 1989), and with the
positively charged binding domains of MAP1b, MAP2, MAP4,
tau (Lee et al., 1989), Drosophila 205K MAP, E-MAP-115
(Masson and Kreis, 1993), and CLIP-170.
The COS cell transfections were not useful for further
analysis of microtubule binding of blackjack. Despite a clear
colocalization of blackjack with microtubules in the embryonic
grasshopper cells, with or without detergent extraction before
fixation, methanol fixation preceded by permeabilization with
a microtubule-stabilizing buffer and nonionic detergents
resulted in a loss of most of the anti-blackjack label in the
transfected COS cells. This fixation protocol was necessary for
successful labeling of microtubules with a polyclonal antitubulin antiserum. Methanol fixation alone did not yield good
microtubule label in these cells. Fixation of the cells with
formaldehyde resulted in anti-blackjack label throughout the
cytoplasm obscuring any that may have been associated with
microtubules. The apparent lack or instability of microtubule
association of blackjack in the transfected mammalian cells
could be due to the absence of an additional polypeptide or
cofactor necessary for blackjack to associate with microtubules, or to a difference in post-translational modification of
blackjack. MAP1a and MAP1b associate with microtubules in
a multisubunit complex involving the light chains LC1, 2, and
3 and LC1 and 3, respectively (Schoenfeld et al., 1989). LC3
copurifies with brain microtubules and can bind to microtubules in vitro in the presence or absence of MAP1 heavy
chains (Mann and Hammarback, 1994). The light chains are
therefore postulated to regulate MAP1a and MAP1b microtubule binding activity (Mann and Hammarback, 1994;
Schoenfeld et al., 1989). Immunolabeling of MAP1b in transfected nonneuronal cells is dependent on the fixation conditions such that MAP1b was observed bound to microtubules
only when the cells were fixed directly in methanol (Noble et
al., 1989). No MAP1b was found when the cells were preextracted with detergent and, when they were fixed directly in
paraformaldehyde, the cytoplasmic MAP1b obscured what
may have been bound to microtubules (Noble et al., 1989).
Blackjack runs as ~250 kDa protein on SDS-acrylamide
gels, ~30% larger than the predicted molecular mass of 170
kDa. MAP1a, MAP1b, MAP2, MAP4, Drosophila 205K
MAP, and E-MAP-115 all display this anomalous migration
behavior. This may be due to the presumed elongated, filamentous structure of these molecules and/or post-translational
modifications.
A notable feature of blackjack is the repeat of the 11 amino
acid motif: PLEELRKDAAE. Repeated sequences have
been identified in other MAPs. MAP 4 has a series of degenerate 14mer repeats that span roughly one third of the
protein. The consensus sequence of the motif is
KD(M/V)X(L/P)(P/L)XETEVALA and it is repeated 18,
19, and 26 times in the bovine, mouse and human protein,
respectively (Aizawa et al., 1990; West et al., 1991). It is
proposed to form a long filamentous structure with a high
degree of flexibility and has been postulated to make up
the projection domain (Aizawa et al., 1991). MAP1b has a
degenerate repeated 15 amino acid sequence of
YSYET(S/T)E(R/K)TT(R/K)(S/T)P(E/D)(E/D) found in the
carboxy third of the molecule. Each repeat is separated by two
nonconserved amino acids and this domain is predicted to form
a series of turns in the protein (Noble et al., 1989). EMAP, the
major MAP of sea urchins and other echinoderms, contains 10
degenerate 43 amino acid repeats that belong to the WD-40
motif found in the β-transducin family of proteins (Li and
Suprenant, 1994). These extensive repeat domains of these
MAPs differ from that of blackjack in sequence and because
they are degenerate. If the repeat region of blackjack did form
an extension or projection domain it could serve to separate
and properly space the microtubules. Alternatively, it could
serve as a site of protein-protein interaction such that blackjack
1506 K. R. Zachow and D. Bentley
could interact with another molecule or with an organelle or
vesicle.
The phosphorylation of many MAPs appears to modulate
their interaction with microtubules. In growing axons, the
amount of phosphorylated MAP1b increases in a proximal-todistal manner, as does the total amount of MAP1b assembled
into microtubules (Black et al., 1994). The importance of this
phosphorylation was demonstrated when the depletion of
casein kinase II, and the accompanied site-specific dephosphorylation of MAP1b, blocked neuritogenesis from neuroblastoma cells (Ulloa et al., 1993). The specific site of phosphorylation on MAP2 and tau can determine the microtubule
binding activity of these proteins (Brugg and Matus, 1991;
Biernat et al., 1993). The MAP4 associated with the mitotic
spindle undergoes a cycle of phosphorylation and dephosphorylation during mitosis (Vandre et al., 1991). This phosphorylation can reduce the microtubule stabilizing activity of MAP4
potentially changing the dynamics of the mitotic microtubules.
A search of the blackjack amino acid sequence for characterized kinase motifs finds 77 potential phosphorylation sites,
including those for casein kinase II and p34cdc2 kinase. Since
phosphorylation of MAP4 can alter its electrophoretic mobility
(Vandre et al., 1991), differences in the phosphorylation level
of blackjack molecules could produce the two blackjack bands
seen on the immunoblot.
Two different 5′ ends were found for blackjack mRNA. The
nucleotide difference is found upstream of the predicted translation start site and does not alter the protein sequence. The
sequence presented in Fig. 9 represents the very abundant
mRNA band seen on the northern blot. A much less abundant
mRNA of ~8 kb is also seen on the blot but the difference
between these two mRNA species is unknown. The source of
RNA for all of these studies was a mixed population of cells
so the identification of multiple mRNAs may reflect cellspecific regulation of transcription and splicing. Alternatively
spliced transcripts are seen with other MAPs including tau (Lee
et al., 1988), MAP2 (Papandrikopoulou et al., 1989) and
Drosophila 205K MAP (Irminger-Finger et al., 1990). MAP4
has been found to have multiple transcripts each with two
different polyadenylation addition sites (Code and Olmsted,
1992).
At present, we do not know the function of blackjack in
embryogenesis. Its expression in early embryo development
and axonogenesis and its presence in the growth cone of an
extending axon might result from a role in microtubule
elongation, tubulin polymer transport, or microtubule spacing
and consolidation. Alternatively, this protein could be involved
in targeted protein and organelle transport, even as a microtubule-based cytoplasmic motor molecule (although no known
motor domains or nucleotide binding domains were identified
by homology searches of the sequence). If the basic COOHterminal domain is involved in microtubule binding, the
remainder of the protein is well-positioned to produce a long
projection domain that could participate in any of these activities.
Support for this work was provided by grants NIH F32GM14695
(K.R.Z.), NIH NS09074 and NSF 20904 (D.B.). We thank Pia
Esbensen for running the gel experiment shown in Fig. 5, for plating
and labeling the cells in Fig. 2C,D, and for general technical assistance; Wes Chang and Luke Ouyang for their participation in isolation
of mAb 27D9 and preparation of cloned DNA, respectively; Kent
McDonald (UCB EM Lab) for electron microscopy; Michael Bastiani
and Kai Zinn for cDNA libraries, and Michael Ignatius for suggestion of the blackjack name.
REFERENCES
Aizawa, H., Emori, Y., Murofushi, H., Kawasaki, H., Sakai, H. and Suzuki,
K. (1990). Molecular cloning of a ubiquitously distributed microtubuleassociated protein with Mr 190,000. J. Biol. Chem. 265, 13849-13855.
Aizawa, H., Emori, Y., Mori, A., Murofushi, H., Sakai, H. and Suzuki, K.
(1991). Functional analyses of the domain structure of microtubuleassociated protein-4 (MAP-U). J. Biol. Chem. 266, 9841-9846.
Altschul, S. F., Gish, W., Miller, W., Myers, E. W. and Lipman, D. J.
(1990). Basic local alignment search tool. J. Mol. Biol. 215, 403-410.
Bentley, D., Keshishian, H., Shankland, M. and Toroian-Raymond, A.
(1979). Quantitative staging of embryonic development of the grasshopper,
Schistocerca nitens. J. Embryol. Exp. Morphol. 54, 47-74.
Biernat, J., Gustke, N., Drewes, G., Mandelkow, E. M. and Mandelkow, E.
(1993). Phosphorylation of Ser262 strongly reduces binding of tau to
microtubules: distinction between PHF-like immunoreactivity and
microtubule binding. Neuron 11, 153-163.
Black, M. M., Slaughter, T. and Fischer, I. (1994). Microtubule-associated
protein 1b (MAP1b) is concentrated in the distal region of growing axons. J.
Neurosci. 14, 857-870.
Brugg, B. and Matus, A. (1991). Phosphorylation determines the binding of
microtubule-associated protein 2 (MAP2) to microtubules in living cells. J.
Cell Biol. 114, 735-743.
Brugg, B., Reddy, D. and Matus, A. (1993). Attenuation of microtubuleassociated protein 1B expression by antisense oligodeoxynucleotides
inhibits initiation of neurite outgrowth. Neuroscience 52, 489-496.
Caceres, A., Potrebic, S. and Kosik. K. S. (1991). The effect of tau antisense
oligonucleotides on neurite formation of cultured cerebellar macroneurons.
J. Neurosci. 11, 1515-1523.
Caceres, A., Mautino, J. and Kosik, K. S. (1992). Suppression of MAP2 in
cultured cerebellar macroneurons inhibits minor neurite formation. Neuron
9, 607-618.
Cavener, D. R. (1987). Comparison of the consensus sequence flanking
translational start sites in Drosophila and vertebrates. Nucl. Acids Res. 15,
1353-1361.
Chen, J., Kanai, Y., Cowan, N. J. and Hirokawa, N. (1992). Projection
domains of MAP2 and tau determine spacings between microtubules in
dendrites and axons. Nature 360, 674-677.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal.
Biochem. 162, 156-159.
Code, R. J. and Olmsted, J. B. (1992). Mouse microtubule-associated protein
4 (MAP4) transcript diversity generated by alternative polyadenylation.
Gene 122, 367-370.
Craig, A. M. and Banker, G. (1994). Neuronal polarity. Annu. Rev. Neurosci.
17, 267-310.
Drechsel, D. N., Hyman, A. A., Cobb, M. H. and Kirschner, M. W. (1992).
Modulation of the dynamic instability of tubulin assembly by the
microtubule-associated protein tau. Mol. Biol. Cell. 3, 1141-1154.
Glass, D. B., El-Maghrabi, M. R. and Pilkis, S. J. (1986). Synthetic peptides
corresponding to the site phosphorylated in 6-phosphofructo-2-kinase/
fructose-2,6-bisphosphatase as substrates of cyclic nucleotide-dependent
protein kinases. J. Biol. Chem. 261, 2987-2993.
Henikoff, S. (1987). Unidirectional digestion with exonuclease III in DNA
sequence analysis. Meth. Enzymol. 155, 156-165.
Irminger-Finger, I., Laymon, R. A. and Goldstein, L. S. B. (1990). Analysis
of the primary sequence and microtubule-binding region of the Drosophila
205K MAP. J. Cell Biol. 111, 2563-2572.
Jan, L. Y. and Jan, Y. N. (1982). Antibodies to horseradish peroxidase as
specific neuronal markers in Drosophila and in grasshopper embryos. Proc.
Nat. Acad. Sci. USA 79, 2700-2704.
Kanai, Y., Chen, J. and Hirokawa, N. (1992). Microtubule bundling by tau
proteins in vivo: analysis of functional domains. EMBO J. 11, 3953-3961.
Kellogg, D. R., Field, C. M. and Alberts, B. M. (1989). Identification of
microtubule-associated proteins in the centrosome, spindle, and kinetochore
of the early Drosophila embryo. J. Cell Biol. 109, 2977-2991.
Knops, J., Kosik, K. S., Lee, G., Pardee, J. D., Cohen-Gould, L. and
Novel MAP in embryonic neurons 1507
McConlogue, L. (1991). Overexpression of tau in a nonneuronal cell
induces long cellular processes. J. Cell Biol. 114, 725-733.
Kopczynski, C. C. and Muskavitch, M. A. (1992). Introns excised from the
Delta primary transcript are localized near sites of Delta transcription. J. Cell
Biol. 119, 503-512.
Langkopf, A., Hammarback, J. A., Muller, R., Vallee, R. B. and Garner, C.
C. (1992). Microtubule-associated proteins 1A and LC2. Two proteins
encoded in one messenger RNA. J. Biol. Chem. 267, 16561-16566.
Lee, G., Cowan, N. and Kirschner, M. (1988). The primary structure and
heterogeneity of tau protein from mouse brain. Science 239, 285-288.
Lee, G., Neve, R. L. and Kosik, K. S. (1989). The microtubule binding domain
of tau protein. Neuron 2, 1615-1624.
Lewis, S. A., Wang, D. and Cowan, N. J. (1988). Microtubule-associated
protein MAP2 shares a microtubule binding motif with tau protein. Science
242, 936-939.
Lewis, S. A., Ivanov, I. E., Lee, G.-H. and Cowan, N. J. (1989). Organization
of microtubules in dendrites and axons is determined by a short hydrophobic
zipper in microtubule-associated proteins MAP2 and tau. Nature 342, 498505.
Li, Q. and Suprenant, K. A. (1994). Molecular characterization of the 77-kDa
echinoderm microtubule-associated protein. J. Biol. Chem. 269, 3177731784.
Lin, C.-H. and Forscher, P. (1993). Cytoskeletal remodeling during growth
cone-target interactions. J. Cell Biol. 121, 1369-1383.
Litman, P., Barg, J. and Ginzburg, I. (1994). Microtubules are involved in
the localization of tau mRNA in primary neuronal cell cultures. Neuron 13,
1463-1474.
Mann, S. S. and Hammarback, J. A. (1994). Molecular characterization of
light chain 3. A microtubule binding subunit of MAP1A and MAP1B. J. Biol.
Chem. 269, 11492-11497.
Masson, D. and Kreis, T. E. (1993). Identification and molecular
characterization of E-MAP-115, a novel microtubule-associated protein
predominantly expressed in epithelial cells. J. Cell Biol. 123, 357-371.
Moreno, S. and Nurse, P. (1990). Substrates for p34cdc2: In vivo veritas? Cell
61, 549-551.
Noble, M., Lewis, S. A. and Cowan, N. J. (1989). The microtubule binding
domain of microtubule-associated protein MAP1B contains a repeated
sequence motif unrelated to that of MAP2 and tau. J. Cell Biol. 109, 33673376.
Okabe, S. and Hirokawa, N. (1989). Axonal transport. Curr. Opin. Cell Biol.
1, 91-97.
Olmsted, J. B. (1986). Microtubule-associated proteins. Annu. Rev. Cell Biol.
2, 421-457.
Papandrikopoulou, A., Doll, T., Tucker, R. P., Garner, C. C. and Matus, A.
(1989). Embryonic MAP2 lacks the cross-linking sidearm sequences and
dendritic targeting signal of adult MAP2. Nature 340, 650-652.
Paschal, B. M., Obar, R. A. and Vallee, R. B. (1989). Interaction of brain
cytoplasmic dynein and MAP2 with a common sequence at the C terminus of
tubulin. Nature 342, 569-572.
Pierre, P., Scheel, J., Rickard, J. E. and Kreis, T. E. (1992). CLIP-170 links
endocytic vesicles to microtubules. Cell 70, 887-900.
Pinna, L. A. (1990). Casein kinase 2: an ‘eminence grise’ in cellular
regulation? Biochim. Biophys. Acta 1054, 267-284.
Pryer, N. K., Walker, R. A., Skeen, V. P., Bourns, B. D., Soboeiro, M. F.
and Salmon, E. D. (1992). Brain microtubule-associated proteins modulate
microtubule dynamic instability in vitro. Real-time observations using video
microscopy. J. Cell Sci. 103, 965-976.
Riederer, B., Cohen, R. and Matus, A. (1986). MAP5: a novel brain
microtubule-associated protein under strong developmental regulation. J.
Neurocytol. 15, 763-775.
Sabry, J. H., O’Connor, T. P., Evans, L., Toroian-Raymond, A., Kirschner,
M. and Bentley, D. (1991). Microtubule behavior during guidance of
pioneer neuron growth cones in situ. J. Cell Biol. 115, 381-395.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
Schoenfeld, T. A., McKerracher, L., Obar, R. and Vallee, R. B. (1989).
MAP 1A and MAP 1B are structurally related microtubule associated
proteins with distinct developmental patterns in the CNS. J. Neurosci. 9,
1712-1730.
Tanaka, E., Ho, T. and Kirschner, M. W. (1995). The role of microtubule
dynamics in growth cone motility and axonal growth. J. Cell Biol. 128, 139155.
Ulloa, L., Díaz-Nido, J. and Avila, J. (1993). Depletion of casein kinase II by
antisense oligonucleotide prevents neuritogenesis in neuroblastoma cells.
EMBO J. 12, 1633-1640.
Vandre, D. D., Centonze, V. E., Peloquin, J., Tombes, R. M. and Borisy, G.
G. (1991). Proteins of the mammalian mitotic spindle:
phosphorylation/dephosphorylation of MAP-4 during mitosis. J. Cell Sci. 98,
577-588.
Walker, R. A. and Sheetz, M. P. (1993). Cytoplasmic microtubule-associated
motors. Annu. Rev. Biochem. 62, 429-451.
West, R. R., Tenbarge, K. M. and Olmsted, J. B. (1991). A model for
microtubule-associated protein 4 structure. J. Biol. Chem. 266, 21886-21896.
Woodgett, J. R., Gould, K. L. and Hunter, T. (1986). Substrate specificity of
protein kinase C. Use of synthetic peptides corresponding to physiological
sites as probes for substrate recognition requirements. Eur. J. Biochem. 161,
177-184.
(Received 10 October 1995 - Accepted 19 March 1996)