Name ____________________________________
Date _______________
Period _____
Semester 1 Biology Final Exam Review and Study Packet
Chapter 3: Be able to
- Describe and identify the unifying characteristics of life
- Use characteristics to distinguish five kingdoms, including prokaryotes vs eukaryotes
- Use a dichotomous key to identify an organism
Vocabulary:
- prokaryotic
- eukaryotic
- autotrophic
- heterotrophic
- unicellular
- multicellular
- sexual reproduction
- asexual reproduction
Practice:
1. List at least 5 characteristics of life that are true for all living things.
2. What is the major difference between prokaryotic and eukaryotic organisms?
3. What is the major difference between autotrophic and heterotrophic organisms?
4. Describe the major differences between sexual reproduction and asexual reproduction.
5. For each kingdom of life below tell whether it is:
Prokaryotic
Autotrophic,
Or
Heterotrophic
Eukaryotic
or Both
Archaea &
Eubacteria
Protista
Fungi
Plantae
Animalia
Single-cellular,
Multicellular
or Both
How it
reproduces
Name ____________________________________
18_______________ 19_______________
Date _______________
20________________
Period _____
21_________________
6. Use the Key to Pamishan Creatures to identify the species above
1.a. The creature has a large wide head..........................….go to 2
b. The creature has a small narrow head..........................go to 11
2.a. It has 3 eyes ..............................................……………go to 3
b. It has 2 eyes ..............................................……………go to 7
3.a. There is a star in the middle of its chest..................….go to 4
b. There is no star in the middle of its chest ................…go to 6
4.a. The creature has hair spikes ...............................……..Pamishanus woodsii
b. The creature has no hair spikes.............................……go to 5
5.a. The bottom of the creature is arch-shaped ...................Pamishanus cascadensis
b. The bottom of the creature is M-shaped ......................Pamishanus lindensteinii
6.a. The creature has an arch-shaped bottom ......................Pamishanus klokeus
b. The creature has an M-shaped bottom..........................Pamishanus woolwinii
7.a. The creature has hairy spikes ..............................…….go to 8
b. The creature has no spikes..................................………go to 10
8.a. There is a star in the middle of its body ..................….Pamishanus mcbeesus
b. The is no star in the middle of its body ...................….go to 9
9.a. The creature has an arch shaped bottom .......................Pamishanus cherniakus
b. The creature has an M shaped bottom ..........................Pamishanus mcleodii
10a. The body is symmetrical ....................................………Pamishanus crocketus
b. The body is not symmetrical.................................…….Pamishanus achensonii
11a. The creatrue has no antennae ...............................…….go to 12
b. The creature has antennae ..................................………go to 14
12a. There are spikes on the face ...............................………Pamishanus everett
b. There are no spikes on the face ............................…….go to 13
13a. The creature has no spike anywhere .........................….Pamishanus woodensis
b. There are spikes on the right leg ..........................……..Pamishanus sidenquistii
14a. The creature has 2 eyes.....................................………...go to 15
b. The creature has 1 eye......................................…………Narrowus fleckensteinii
15a. The creature has a mouth....................................……….go to 16
b. The creature has no mouth...................................………go to 17
16a. There are spikes on the left leg ...........................………Pamishanus steinkii
b. There are no spikes at all .................................…………Pamishanus bruensis
17a. The creature has spikes ....................................…………go to 18
b. The creature has no spikes .................................……….Narrowus stoddardus
18a. There are spikes on the head ...............................………go to 19
b. There are spikes on the right leg...........................………Narrowus montanian
19a. There are spikes covering the face .........................…….Pamishanus tyrrellii
b. There are spikes only on the outside edge of head .........Narrowus crimsonsis
Name ____________________________________
Date _______________
Period _____
Chapter 4: Be able to
- Describe the structure and function of cell membranes
- Describe and distinguish active and passive transport, including the roles of proteins, energy
and the concentration gradient
- Predict the effects of osmosis on cells in different concentrations of solutions
- Identify the parts of a cell and their functions: nucleus, mitochondria, chloroplast, cell
membrane, cell wall, ribosome
- Describe the major ideas of mitosis: purpose, final products, effect on DNA (not phases)
Vocabulary:
- phospholipid bilayer
- active transport
- passive transport
- membrane proteins
-
cell membrane
cell wall
mitochondria
chloroplast
- mitosis
- chromosome
- nucleus
Practice:
1. Complete the table for molecular transport in cells:
Type of
Molecular
movement
Does it always
involve a
membrane?
Move from high
to low
concentration,
or low to high?
Diffusion
Osmosis
Active transport
Passive transport
2. Label the major parts of cell membrane below:
Does it require
energy?
Does it require
membrane
proteins?
Name ____________________________________
Date _______________
3. What are the two major functions of the cell membrane?
Period _____
4. In the diagram below, consider the dots to be molecules of a solute in a water solution. The
space between the dots is water. The cell membrane is semi-permeable.
For each cell system, tell whether the outside solution is isotonic, hypertonic, or hypotonic.
A ____________________________________
B ____________________________________
C ____________________________________
For each system, draw arrows showing whether water (white) will move into the cell, out of
the cell or neither.
5. If a jellyfish is placed in distilled water, where there is a lower concentration of salt on the
outside of the cells than inside, what will happen to the jellyfish cells?
6. Describe the important function of each cell organelle listed below:
a. Nucleus ________________________________________________________________
b. Mitochondria ____________________________________________________________
c. Chloroplast ______________________________________________________________
d. Ribosome _______________________________________________________________
e. Cell wall ________________________________________________________________
7. Describe the results of mitosis, cell division. Be sure to include in your description:
Name ____________________________________
Date _______________
Period _____
- the number of cells
- the number of chromosomes compared to the original cell
- how the DNA information in the new cells compares with each other and the original cell
8. If a flea-beetle has 32 chromosomes in a body cell, how many chromosomes will be in the
cells resulting from mitosis, cell division?
9. How will the information in each of the DNA of the cells that result from mitosis compare?
Chapter 11: Be able to
- Use a punnett square to determine the probable outcome of a single trait cross
- Describe the big ideas about meiosis: purpose, final outcomes, what happens to chromosome
number, and how the genetic information in the products compares
- Describe the number of chromosomes in the body cells of a human, and where they come from
- Identify where the chromosomes in a homologous pair come from
- Explain the purpose and genetic result of fertilization
Vocabulary:
- homozygous
- heterozygous
- punnett square
- allele
- dominant
- recessive
- meiosis
- homologous
chromosomes
- haploid
-
diploid
gamete
sperm
egg
fertilization
Practice:
1. What is the role of chromosomes in cells?
2. How many chromosomes in a human body cell? _______________
3. What is the purpose of meiosis in organisms?
4. For the results of meiosis in humans. Give:
•
The number of cells that result ______________________________
•
The name of the cells that result ______________________________
•
The number of chromosomes in the resulting cells _______________
•
How the genetic information compares between the resulting cells __________________
5. What is the purpose of fertilization in organisms?
Name ____________________________________
Date _______________
Period _____
6. How many chromosomes in a human zygote (the first cell of the offspring, formed by
fertilization)? ________________
7. Where does the zygote (offspring) get its chromosomes?
8. Where do the chromosomes in a homologous pair come from?
9. What happens to the number of chromosomes per cell during meiosis?
10. What is the difference between haploid and diploid cells?
11. In cattle, Hornless (H) is dominant over horned (h). A homozygous hornless bull is mated
with a homozygous horned cow. Draw a punnett square in the space for this cross and
answer the questions below.
12. What is the percent probability that a cow from this cross will have horns? _______
13. What is the percent probability that a cow from this cross will be hornless? _______
14. Now draw a punnet square for a cross between two heterozygous horned cows.
15. What is the percent probability that a cow from this cross will have horns? ______
16. What is the percent probability that a cow from this cross will be hornless? ______
17. If these two heterozygous cows are mated several times, will their offspring have exactly
these percentages of horned versus hornless offspring? Explain why or why not.
Name ____________________________________
Date _______________
Period _____
Chapter 12: Be able to
- Describe the structure of the DNA molecule
- List the four bases used in the DNA code
- Describe how the genetic information in the DNA of cells in different parts of the body
compares, and explain how that information is used to make different cell types.
- Describe the location, mechanism, and purpose of transcription, including the role of mRNA
- Describe the location, mechanism, and purpose of translation, including the role of codons,
ribosomes and tRNA
- Explain the relationship between DNA, genes, and proteins
- Demonstrate how the relationship between DNA and proteins explains the relationship between
genotype and phenotype in organisms.
- Describe how the shape of the protein determines its function in the cell
- Describe what causes genetic mutations, and explain how mutations affect protein functions
- Be able to transcribe a DNA sequence of bases into an mRNA sequence of bases
- Be able to translate an mRNA sequence of bases into a sequence of amino acids, forming a
protein.
Vocabulary:
- DNA
- nucleotide
- base pairing
- mRNA
-
ribosome
gene
proteins
amino acid
- transcription
- translation
- codon
Practice:
1. What is the basic shape of the DNA molecule, and the parts that make it up?
2. For the sequence of DNA bases below, write the complementary DNA bases below each
one.
TACTGTAAAGGCTATATGCCGAAT
3. Describe the two main steps of DNA replication.
4. How does the genetic information coded in the DNA of a muscle cell in your arm compare to
the genetic information in the DNA of a cell in your brain?
Name ____________________________________
Date _______________
Period _____
5. What happens to allow your brain cells to take a different shape and function compared to
your arm cells?
6. What is the relationship between DNA, genes and proteins? How does this relate to
genotype and phenotype?
7. Describe three types of mutations
8. What are the possible affects of mutations?
9. What effect does a mutation in a gene have on the protein coded for?
10. Where must a mutation occur if it is going to be passed on to the next generation?
11. Where does transcription from DNA to RNA occur in the cell?
12. What is the role of mRNA in the transcription phase of making proteins?
13. Transcribe the DNA sequence of bases below in to an mRNA sequence of bases.
TACTGTAAAGGCTATATGCCGAAT
Name ____________________________________
Date _______________
Period _____
14. Where does translation from RNA to protein occur in the cell?
15. Use the mRNA sequence of bases in your answer above to write the chain of amino acids
that makes this protein below.
16. What is the main feature of a protein that gives it its function?
Inquiry: Be able to
- Analyze data from an experiment to form a logical conclusion
- Write a conclusion based on evidence that:
- answers the investigative question
- provides data that supports the answer
- explains how the data supports the conclusion
- provides a scientific explanation for the results