DNA STRUCTURE
1. What do the letters DNA stand for?____________________________________________
2. Two scientists are given credit for discovering the structure of DNA. What is the name of
those two scientists.
a. ___________________________
b. ___________________________
3. DNA is a polymer, which means that is
made up of many repeating subunits
(monomers). What are the repeating
subunits of DNA called?_________________
4. The siderail backbone of the DNA
molecule is made up of two components,
what are these?
a. ____________________________
b. ____________________________
5. There are four different nucleotides (their
nitrogen bases make them different) that can
be hooked together in millions of different
sequences
What are the names of those bases?
a. _______________________________
b. _______________________________
c. _______________________________
d. _______________________________
6. Chargoff’s rule states that the DNA of any species contains equal amounts of
__________________ and________________ and also equal amounts of
__________________and ________________.
7. Based on this information, scientist could predict that the base ___________________
always pairs with_____________________and the base _______________________
always pairs with _______________________ in the formation of the double stranded DNA
molecule.These is called complementary base pairs.
8. The bases are paired by _______________________ bonds along the axis of the
molecule.
9. Draw the basic structure of a nucleotide with its three parts in the box.
10. Write the complementary sequence to following DNA strand:
AATTCGCCGGTATTAGACGTT
| | | | | | | | | | | | | | | | | | | | |
11. Use the image at the right to complete the follow:
Circle a nucleotide.
Label the sugar and phosphate.
Label the bases that are not already labeled