Tom Pickett
Ian Hazlewood
Amy Yu
Biology Honour Specialist Unit Plan Assignment (Part B):
(EAQ2020-Y-Y-60)
Biology, Grade 12 (University Preparation) SBI4U: Molecular Genetics Unit
Prerequisite Knowledge and Skills (before starting unit):
The following are samples of specific expectations from Ontario’s Grades 9 to 11 curriculum that
relate to Unit 2. (See the Ontario Guidelines for full details.)
Understanding Basic Concepts
Identify and describe the structure and function of important biochemical compounds,
including carbohydrates, proteins, lipids, and nucleic acids.
Demonstrate an understanding of the process and importance of mitosis.
Explain how the concepts of DNA, genes, chromosomes, and meiosis account for the
transmission of hereditary characteristics from generation to generation.
Describe and explain the process of discovery that led Mendel to formulate his laws of
heredity.
Explain the process of meiosis in terms of replication and movement of chromosomes.
Describe genetic disorders in terms of the chromosomes affected, physical effects, and
treatment.
Compare and contrast the structure and function of different types of prokaryotic and
eukaryotic cells.
Compare the structure and properties of the genetic material of viruses and bacteria with
those of eukaryotic cells.
Describe the role of viruses and bacteria in genetic manipulation, using their knowledge of
DNA.
Describe cell division, including mitosis, as part of the cell cycle, including the roles of the
nucleus, cell membrane, and organelles.
Explain how the cell nucleus determines cellular processes and contains genetic material, and
why DNA replication is important to organism survival.
Key Inquiry and Communication Skills
As students begin this unit, they should
formulate scientific questions;
communicate the procedures and results of investigations and research for specific purposes
using data tables and laboratory reports;
state scientific questions in a testable form, identifying the relationships among the variables;
select and integrate information from various sources, including electronic and print
resources, and personally collected data, to answer the questions chosen;
gather, organize, and record qualitative and quantitative date using an appropriate format;
analyze qualitative and quantitative data and explain how the evidence gathered supports or
refutes an initial hypothesis;
communicate scientific ideas, procedures, results, and conclusions using appropriate SI units,
language and formats, and evaluate the processes used in planning, problem solving, decision
making, and completing the task;
defend orally a given position on an issue or problem based on their findings;
plan ways to model and/or simulate an answer to the questions chosen;
demonstrate the skills required to plan and conduct an inquiry;
analyze data and information and evaluate evidence and sources of information, identifying
flaws such as errors and bias;
select and use appropriate vocabulary and numeric, symbolic, graphic, and linguistic modes
of representation to communicate scientific ideas, plans, results, and conclusions;
work independently or as part of a team.
Key Technical and Safety Skills
As students begin this unit, they should
select appropriate instruments and use them effectively and accurately in collecting
observations and data;
demonstrate an understanding of safety practices consistent with Workplace Hazardous
Materials Information System (WHMIS) legislation by selecting and applying appropriate
techniques for handling, storing, and disposing of laboratory materials.
Making Connections
As students progress through this unit, they should
explain the roles of evidence and theories in the development of scientific knowledge about
genetics;
describe, and explain the implications of, the principal elements of Canadian regulations on
biotechnological products;
identify, investigate, and describe science- and technology-based careers that require an
understanding of molecular genetics;
describe some of the theoretical issues surrounding scientific research into genetic continuity;
describe the general impact and philosophical implications of the knowledge gained through
molecular genetic research on society;
provide and describe examples of industrial, medical, and agricultural applications of
recombinant DNA technology in society and their impact.
BACKGROUND INFORMATION
Students should be familiar with the concepts presented in this section. As early as Grade 8,
students have covered cell structure, with a possible review conducted in Grade 9. In addition,
cell structure and function is revisited in detail during the Grade 11 Biology course. In Grade 9
Science and Grade 11 Biology, students have covered the topics of meiosis and mitosis
extensively. The concept of deoxyribonucleic acid has also been introduced in both of these
grades to various extents. Grade 11 Chemistry addresses the concept of covalent bonding. Finally
some of the societal issues with respect to molecular genetics have been discussed in previous
grades.
The “Are You Ready” section provides an opportunity for the teacher to diagnose the
level of students’ knowledge and understanding of concepts introduced in lower grades that relate
to the molecular genetics unit. Teachers need to assess students’ knowledge and understanding
and if necessary provide review material for students who require it.
Finally, the last question of the section illustrates to the student the widespread societal
impact of molecular genetics and its application.
( Nelson Biology 12 Teacher Resource Manual, 2005, pgs. 151-152)
The Ontario Curriculum, Grades 11 and 12, Science (2008):
Big Ideas:
D. Molecular Genetics
 DNA contains all the genetic information for any living organism.
 Proteins control a wide variety of cellular processes.
 Genetic research and biotechnology have social, legal, and ethical implications.
(The Ontario Curriculum, Grade 11 and 12 Science, 2008, p.74).
OVERALL EXPECTATIONS: by the end of this course, students will:
D1. analyse some of the social, ethical, and legal issues associated with genetic research
and biotechnology;
D2. investigate, through laboratory activities, the structures of cell components and their
roles in processes that occur within the cell;
D3. demonstrate an understanding of concepts of related to molecular genetics, and how
genetic modification is applied in industry and agriculture.
(The Ontario Curriculum, Grade 11 and 12 Science, 2008, p.82).
Planning notes:








Using the Nelson Grade 12 Biology textbook.
Using the Nelson Grade 12 Biology Teachers Resource Manual.
Each period is 75 minutes.
Unit will take approximately 22 classes (approx. 4 weeks).
Formulative assessments: on-line self quizzes from Nelson available for students
to do at home after reading each chapter.
Instructional videos available for download from subscription sites:
www.discoveryeducation or www.360learning.
Prep of labs before unit begins is strongly recommended.
Book computer lab time for implementation of Gizmos, research time for poster,
STSE assignment, and biotech presentations.
DI strategies:

visual: videos available on www.discoveryeducation.com or
www.360learning.com.
 Gizmo computer simulations: www.explorelearning.com
 SMART board Presentations.
 visual models: large plastic DNA molecule, board magnetic DNA demonstration
kit.
 Use Bloom's Taxonomy for planning lessons.
 Plan field trips or have guest speakers.
 Encourage webbing, brainstorming, and concept mapping.
 Promote peer mentorship and peer marking.
 variety of ways for evaluation: poster presentations, portfolios, puzzles
(source: http://www.ualberta.ca/~jpdasddc/incl/difinst.htm)
Accommodations for Special Needs Students:
Instructional Accommodations:
 buddy/peer tutoring
 note-taking assistance
 duplicated notes
 assistive technology
 graphic organizers
 time-management aids
 extra time for assignments
 extra time for processing
 computer options
 repetition/review materials
Environmental Accommodations:
 alternate work space
 strategic seating
 proximity to instructor
 study carrel
Assessment Accommodations:
 extended time limits
 extended time for processing
 reduction in the number of tasks used to assess a concept or skill
(source: http://www.edu.gov.on.ca/eng/general/elemsec/speced/iep/iep.html)
Enriched Learning Suggestions:
 have them mentor students.
 have them research different genetic diseases (esp. rare ones).
 assign them projects conducive to their talents according to Multiple Intelligences
(Gardner Theory).
 utilize The Enrichment Triad (Renzulli, 1977): General exploratory activities,
Group training activities, and Individual or small-group investigations
(source: Special Education in Ontario Schools (6ed.) (2008) pgs. 133-139)
UNIT#2: Molecular Genetics: Planning Pathway
TOPICS
PERIOD
LEARNING GOALS
Chapter 4: DNA:
Molecular Basis of Life
(Chapter 4 Opener)
1
-understand advancements
in DNA technology last
150 years; Human
Genome Project
DNA: The Hereditary
Material (4.1)
2
Lab: Isolation and
Quantification of DNA
(Investigation 4.1.1)
3
-identify experiments by
early researchers to
determine structure and
function of DNA
-to be able to isolate and
quantify extracted DNA
DNA Structure (4.2)
4
- figure out chemical
composition of DNA
EXPECTATION
CODES
TEACHING/
LEARNING
STRATEGIES
-have students answer
"reflect on your
learning questions in
groups on chart paper.
-answer questions
together via class
discussion.
-ask students to explain
the possible
consequences of
genetic engineering.
-implement Try This
Activity-The Size of
the Genome.
-content lends itself to
a jigsaw activity.
ASSESSMENTS
&
EVALUATIONS
-Exit cards are an
excellent formative
method at the end
of each lecture
--STSE assignment
=summative
--Scientist Poster
(summative)
D 3.7
A 2.2
A 1.3
-this lab allows
students to understand
the historical
significance of DNA
research.
-use transparencies to
allow students to
understand 5' to 3'
notion.
-have students make
paper models of DNA.
-use plastic DNA
model to explain
-lab=summative
assessment
D 2.3
A 1.2
A 1.4
A 1.11
D 2.1
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
D 3.7
A 2.1
A 2.2
-understand step-by-step
semi conservative
replication DNA
concepts.
-review the
significance of
hydrogen bonding.
-stress importance of
proof reading DNA
DNA Replication and
Repair (4.3)
5
Chapter 4 Quiz
6
Chapter 5 Opener
7
-deciphering of DNA;
introduction to
biotechnology
One Gene-One
Polypeptide Hypothesis;
Protein synthesis: An
Overview (5.1) (5.2)
8
-understand one gene-one
polypeptide hypothesis
Transcription (5.3)
9
-state the central dogma of
molecular genetics; be
able to identify different
types of RNA
Translation (5.4)
10
-able to state the step-bystep process of
translation; understand
HIV as a reverse
transcriptase virus
Control Mechanisms: Lab
Exercise: Synthesis of
Insulin: A Simulation of
Protein Synthesis
(5.5)
11
-explain gene regulation
via operons in prokaryotes
Lab: Protein Synthesis an
Inactivation of Antibiotic
Mutations
(5.6) (Investigation 5.4.1)
12
-understand the types and
causes of genetic
mutations
-have students review
concepts of mutations
and that not all
mutations are bad.
Key Differences Between
Prokaryotes and
Eukaryotes: Gene
Organization and
Chromosome Structure;
13
-determine the differences
between prokaryotes and
eukaryotes with respect to
protein synthesis and gene
regulation
-have students
brainstorm
difference/similarities
between prokaryotes
and eukaryotes.
-answer Reflect on you
Learning in groups
again with chart paper.
-use internet to show
animations and
research on micro
array technology.
-review enzymes.
-use transparencies to
show Beadle and
Tatum's experiment.
-have students work in
pairs to decode DNA
into proteins.
-use videos to review
concepts.
-process of
transcription is very
abstract use text art
image bank from
CDROM.
-show video
animations to outline
this process.
-have students work in
groups to produce
charts summarizing the
events of translation
from DNA.
-have students
brainstorm ideas they
have about genetic
diseases.
-use internet to outline
various genetic
diseases.
D 3.1
-quiz=summative
assessment
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
D 3.5
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
D 3.3
-Genetic code
Gizmo=formative
assessment
-Cell Component
Gizmo
D 3.2
-4 Corners
Activity=formative
assessment
transcription/transla
tion
activity=formative
D 3.2
-lab=summative
assessment
D 3.3
A 1.7
A 1.8
-Mutation
Worksheet
=summative
-lab=summative
assessment
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
D. 3.4
A 1.8
A.10
D 3.3
Chapter 5 Review
(5.7) (5.8)
-have students look up
DNA sequences for
genes and SINEs,
LINEs in the Human
Genome.
-to illustrate the
prevalence scan
newspapers/magazines
for articles to discuss
with students.
-if time permitting, use
videos illustrating
biotechnology.
-concepts used are
complex, use lots of
visuals, and videos to
demonstrate them.
Chapter 5 Quiz
Chapter 6 Opener
14
-understand the
application of molecular
genetics in biotechnology
Biological Tools and
Techniques (6.1)
15
-explain commonly used
tools and techniques in
molecular genetics
Lab: Restriction Enzyme
Digest of Bacteriophage
DNA: Planned Maps
(Investigation 6.1.1.)
16
-give demonstration of
how to properly use
electrophoresis.
Lab: Restriction Enzyme
Digest of Bacteriophage
DNA; Genetic
Engineering (6.2)
(Investigation 6.1.1.)
Culminating Task
17
-understand how
bacteriophage lamba
DNA is digested by
restriction endonucleases
and fragments separated
using gel electrophoresis
-state the significance of
genetic engineering and
discuss techniques used in
the production of HGH
-field trip
Advanced Molecular
Biological Techniques
(6.3) (6.4)
19
Chapter 6 Review
20
-understand DNA
extraction,
electrophoresis, and DNA
fingerprinting
-discuss the PCR, RFLPs,
and DNA sequencing
-explain current
applications of
biotechnology in the
fields of medicine,
agriculture, and forensics
-review all concepts
taught in Chapter 6 to be
included in Unit Test
Unit 2 Review
21
Unit Test
22
18
-review all concepts
taught in Unit 2
-review exons/introns.
-if time permits, allow
students to research
HGH on the internet.
-illustrate concepts in
biotechnology using
animations.
-have students engage
in an ethical debate
surrounding
biotechnology.
-quiz=summative
assessment
D 3.6
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
-lab=summative
assessment
D 3.6
D 2.4
A 1.1
A 1.12
A 1.13
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
-summative
assessment
D 1.2
-formative
assessment=biotech
nology
presentations
D 3.5
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
-homework
questions.
-on line quizzes.
-diagnostic black
board questions.
-summative
assessment
D 2.4
SBI 4U Course Evaluation Plan
30% Final Evaluations
Task
Final Written Exam
Lab Based Performance Task
Achievement Chart Focus
Weighting
K/U, T/I, C, A
T/I, C
20%
10%
70% course Work
Unit : Molecular Genetics
Summative Assessments:
Unit Test
Culminating Task*
STSE Case Study
DNA Labs*
Quizzes
Mutation Worksheet
Scientist Poster
Formative Assessments
Genetic Code Gizmo*
Cell Components Gizmo
4 Corners Activity*
Transcription/Translation Activity
Exit Cards
Home work questions
Online Nelson Quizzes
Diagnostic Review Questions on board
before class for students to answer
Biotech Presentations*
13% of the entire course
Weighting in
Achievement Chart Focus
Category?
K/U, T/I, C
23% (3% of total)
K/U, T/I, C, A
23% (3% of total)
C, A
15% (2% of total)
T/I, C
15% (2% of total)
K/U, C
8% (1% of total)
K/U, T/I, C, A
8% (1% of total)
K/U, C, A
8% (1% of total)
Achievement Chart Focus
K/U, T/I, A
K/U, T/I, A
K/U, C, A
K/U, C
K/U
K/U, C
K/U – Knowledge and Understanding; T/I – Thinking and Investigation; C – Communication; A Application
*opportunities to monitor learning skills
Appendix
table of contents
summative assignments:
I. Unit Test
II. Culminating Task
III. STSE Case Study
IV. DNA Labs – Taken from Nelson 12
V. Quizzes
VI. Mutation Worksheet
VII. Scientists Poster
formative assessments:
VIII. Genetic Code Gizmo
IX. Cell Components Gizmo
X. 4 Corners Activity
XI. Transcription/Translation Activity
XII. Exit Cards
XIII. Biotech Presentations
I. Unit Test
II. Culminating Task
III. STSE Case Study
IV. DNA Labs – Taken from Nelson 12
V. Quizzes
VI. Mutation Worksheet
K ____
I _____
C _____
A _____
Name: ________________________
Date: _______________________
SBI4U – Molecular Genetics Unit
Mutations Worksheet
Part A
Transcribe and translate the following DNA sequence into the appropriate
Protein chain.
GCCTTACCCTTCTGTAGGGCGAAATCTCCAAACCCGTACTAGGC
Part B
For each of the following sequences, highlight the section of the DNA sequence
that has been mutated. Name the group of mutations to which this type of mutation
belongs. Transcribe and translate each DNA sequence to identify the resultant effect on
the protein produced.
GCCTTACCCTTCTATGGGGCGAAATCTCCAAACCCGTACTAGGC
GCCTTACCCTTCTATGGGGCGAAATTCCAAACCCGTACTAGGC
VII. Scientists Poster
K _____
C _____
A ______
Name: _________________________
Date: _______________________
SBI4U – Molecular Genetics Unit
Scientists Poster
Students will choose a scientist or pair of scientists from the list below. Students
will research the scientist(s) of their choice and create a poster outlining reasons as to
why their scientist(s) is important to the study of genetics. The poster should include:
 A picture of the scientist(s)
 the scientist’s contribution to molecular genetics
 attempts to sell their scientist(s) as the most important (as though making the
scientist(s) case in front of a panel selecting Nobel prize winners)
Frederick Griffith
Erwin Chargaff
Reiji Okazaki
Marshall Nirenberg
& J.H. Matthaei
Oswald T. Avery
Francis Crick
& James Watson
George Beadle
& Edward Tatum
Fredieric Sanger
VIII. Genetic Code Gizmo
DNA replication – explorelearning.com
IX. Cell Components Gizmo
RNA and Protein Synthesis – explorelearning.com
Alfred Hershey
& Martha Chase
Matthew Meselson
& Franklin Stahl
Howard Temin
& David Baltimore
X. 4 Corners Activity
(Assuming a class of 30)
Divide the class into 5 groups of six. There needs to be at least 6 members in
each group. (It is possible to have fewer groups with larger numbers of students) Similar
to a four corners activity, set up 6 (or more) stations around the room at which one (1)
member from each group will go to. Each station will look at a specific enzyme involved
in DNA replication (teacher created short document) and:
 determine its role in replication
 when it acts in replication (what enzyme acts before it, after it)
After 5 – 10 minutes have the original groups reform. Students will now piece together a
stepwise action to figure out how a strand of DNA is replicated, taking turns explaining
to the rest of their group what their enzyme does and how it affects DNA. Teacher walks
around the classroom observing groups and asking leading questions to help groups
through the process. It’s also a good opportunity to observe learning skills in the
classroom.
Helicase
Exonuclease
RNA primase
DNA ligase
DNA Polymerase 
Nucleases
DNA Polymerase 
Okazaki fragments
XI. Transcription/Translation Activity
Divide class in half. One half of the class will be the Transcribers. They will be
responsible for summarizing the process of Transcription. They take a section of DNA
and transcribe that section into a piece of tRNA. Each student will transcribe their own
section of DNA, which upon completion of their section, they will pass to a partner on
the translation side of the classroom. The Translators will take the section of tRNA from
one of the transcribers and translate
XII. Exit Cards
After any lecture type lesson (or other lessons) have students answer single question exit
cards to allow for a formative assessment of what they have gained
XIII. Biotech Presentations
Students will be given a list of Biotech topics that they will choose from in
partners. The goal of the project is for the students to present their researched
technological invention to the class, making sure to include where and when it was first
used and what its function is.