Chapter 16 *Lecture Outline *See separate FlexArt PowerPoint slides for all figures and tables pre-inserted into PowerPoint without notes. Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. INTRODUCTION • The term mutation refers to a heritable change in the genetic material • Mutations provide allelic variations – On the positive side, mutations are the foundation for evolutionary change needed for a species to adapt to changes in the environment – On the negative side, new mutations are much more likely to be harmful than beneficial to the individual and often are the cause of diseases • Understanding the molecular nature of mutations is a deeply compelling area of research. • Since mutations can be quite harmful, organisms have developed ways to repair damaged DNA Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-2 16.1 CONSEQUENCES OF MUTATIONS • Mutations can be divided into three main types – 1. Chromosome mutations • Changes in chromosome structure – 2. Genome mutations • Changes in chromosome number – 3. Gene mutations • Relatively small change in DNA structure that affects a single gene – Types 1 and 2 were discussed in chapter 8 – Type 3 will be discussed in this chapter Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-3 Gene Mutations Change the Sequence n DNA A point mutation is a change in a single base pair n 5 3 n n n It can involve a base substitution AACGCTAGATC 3 TTGCGATCTAG 5 5 3 AACGCGAGATC 3 TTGCGCTCTAG 5 A transition is a change of a pyrimidine (C, T) to another pyrimidine or a purine (A, G) to another purine A transversion is a change of a pyrimidine to a purine or vice versa Transitions are more common than transversions Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-4 Gene Mutations Change the Sequence n 5 3 DNA Mutations may also involve the addition or deletion of short sequences of DNA AACGCTAGATC 3 TTGCGATCTAG 5 5 3 AACGCTC 3 TTGCGAG 5 Deletion of four base pairs 5 3 AACGCTAGATC 3 TTGCGATCTAG 5 5 3 AACAGTCGCTAGATC 3 TTGTCAGCGATCTAG 5 Addition of four base pairs Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-5 Gene Mutations Can Alter the Coding Sequence Within a Gene n Mutations in the coding sequence of a structural gene can have various effects on the polypeptide n Silent mutations are those base substitutions that do not alter the amino acid sequence of the polypeptide n n Due to the degeneracy of the genetic code Missense mutations are those base substitutions in which an amino acid change does occur n n Example: Sickle-cell anemia (Refer to Figure 16.1) If the substituted amino acid has no detectable effect on protein function, the mutation is said to be neutral. This can occur if the new amino acid has similar chemistry to the amino acid it replaced Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-6 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. © Phototake/Alamy Normal red blood cells © Phototake/Alamy 10 µm" Sickled red blood cells 10 µm" (a) Micrographs of red blood cells NORMAL : NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – GLUTAMIC ACID – GLUTAMIC ACID... SICKLE" CELL " : NH2 – VALINE – HISTIDINE – LEUCINE – THREONINE – PROLINE – VALINE– GLUTAMIC ACID... (b) A comparison of the amino acid sequence between normal β-globin and sickle-cell β-globin Figure 16.1 16-7 Gene Mutations Can Alter the Coding Sequence Within a Gene n Mutations in the coding sequence of a structural gene can have various effects on the polypeptide n n Nonsense mutations are those base substitutions that change a normal codon to a stop codon Frameshift mutations involve the addition or deletion of a number of nucleotides that is not divisible by three n n This shifts the reading frame so that translation of the mRNA results in a completely different amino acid sequence downstream of the mutation Table 16.1 describes all of the above mutations Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-8 16-9 Gene Mutations outside of coding sequences can still affect phenotype n n Mutations in the core promoter can change levels of gene expression n Up mutations increase expression. Down mutations decrease expression Other important non-coding mutations are in Table 16.2 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-10 Gene Mutations and Their Effects on Genotype and Phenotype n n n In a natural population, the wild-type is the relatively prevalent genotype. Genes with multiple alleles may have two or more wild-types. A forward mutation changes the wild-type genotype into some new variation A reverse mutation changes a mutant allele back to the wild-type n It is also termed a reversion Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-11 n n Mutations can also be described based on their effects on the wild-type phenotype They are often characterized by their differential ability to survive n Deleterious mutations decrease the chances of survival n n n n The most extreme are lethal mutations Beneficial mutations enhance the survival or reproductive success of an organism The environment can affect whether a given mutation is deleterious or beneficial Some mutations are conditional n n They affect the phenotype only under a defined set of conditions An example is a temperature-sensitive mutation Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-12 n n n A second mutation will sometimes counteract the effects of a first mutation These second-site mutations are called suppressor mutations or simply suppressors Suppressor mutations are classified into two types n Intragenic suppressors n n Intergenic suppressors n n The second mutant site is within the same gene as the first mutation The second mutant site is in a different gene from the first mutation Examples of suppressor mutations-Table 16.3 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-13 16-14 Changes in Chromosome Structure Can Affect Gene Expression n n A chromosomal rearrangement may affect a gene because the chromosomal breakpoint occurs within the gene A gene may be left intact, but its expression may be altered because of its new location n n This is termed a position effect There are two common reasons for position effects: n 1. Movement to a position next to regulatory sequences n n Refer to Figure 16.2a 2. Movement to a heterochromatic region n Refer to Figure 16.2b AND 16.3 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-15 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. B A Coding" sequence Core" promoter B Gene B Regulatory" sequence Coding" sequence Core" promoter Regulatory sequences are often bidirectional A Inversion Gene A Core promoter" for gene A is" moved next to" regulatory" sequence of" gene B. (a) Position effect due to regulatory sequences Active" gene Gene" is now" inactive. Translocation Heterochromatic" chromosome" (more compacted) Euchromatic" chromosome Translocated" heterochromatic" chromosome Shortened euchromatic" chromosome (b) Position effect due to translocation to a heterochromatic! chromosome Figure 16.2 16-16 Mutations Can Occur in Germ-Line or Somatic Cells n Geneticists classify animal cells into two types n Germ-line cells n n Somatic cells n n All other cells Germ-line mutations are those that occur directly in a sperm or egg cell, or in one of their precursor cells n n Cells that give rise to gametes such as eggs and sperm Refer to Figure 16.4a Somatic mutations are those that occur directly in a body cell, or in one of its precursor cells n Refer to Figure 16.4b AND 16.5 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-17 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Germ-line" mutation Gametes Embryo Somatic" mutation The size of the patch will depend on the timing of the mutation The earlier the mutation, the larger the patch Therefore, the mutation can be passed on to future generations Mutation is" found" throughout" the entire" body. Mature" individual An individual who has somatic regions that are genotypically different from each other is called a genetic mosaic Therefore, the mutation cannot be passed on to future generations Half of" the gametes" carry the" mutation. Figure 16.4 Patch of" affected" area (a) Germ-line mutation None of" the gametes" carry the" mutation. (b) Somatic cell mutation 16-18 16.2 OCCURRENCE AND CAUSES OF MUTATION • Mutations can occur spontaneously or be induced • Spontaneous mutations – Result from abnormalities in cellular/biological processes • Errors in DNA replication, for example – Underlying cause originates within the cell • Induced mutations – Caused by environmental agents – Agents that are known to alter DNA structure are termed mutagens • These can be chemical or physical agents • Refer to Table 16.4 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-19 16-20 Spontaneous Mutations Are Random Events n Are mutations spontaneous occurrences or causally related to environmental conditions? n n This is a question that biologists have asked themselves for a long time Jean Baptiste Lamarck n n Proposed that physiological events (e.g. use and disuse) determine whether traits are passed along to offspring Charles Darwin n Proposed that genetic variation occurs by chance n Natural selection results in better-adapted organisms Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-21 Mutation Rates and Frequencies n The term mutation rate is the likelihood that a gene will be altered by a new mutation n n n The mutation rate for a given gene is not constant n n It is commonly expressed as the number of new mutations in a given gene per cell generation It is in the range of 10-5 to 10-9 per generation It can be increased by the presence of mutagens Mutation rates vary substantially between species and even within different strains of the same species Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-26 Mutation Rates and Frequencies n Within the same individual, some genes mutate at a much higher rate than other genes n Some genes are larger than others n n Some genes have locations within the chromosome that make them more susceptible to mutation n n This provides a greater chance for mutation These are termed hot spots Note: Hot spots can be also found within a single gene n Specific bases or regions that are more likely to be the site of a mutation within a gene Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-27 Mutation Rates and Frequencies n The mutation frequency for a gene is the number of mutant genes divided by the total number of genes in a population n n If 1 million bacteria were plated and 10 were mutant -5 n The mutation frequency would be 1 in 100,000 or 10 The mutation frequency depends not only on the mutation rate, but also on the n n Timing of the mutation Likelihood that the mutation will be passed on to future generations Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-28 Causes of Spontaneous Mutations n Spontaneous mutations can arise by three types of chemical changes n 1. Depurination n 2. Deamination n 3. Tautomeric shift The most common Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-29 Causes of Spontaneous Mutations n Depurination involves the removal of a purine (guanine or adenine) from the DNA n The covalent bond between deoxyribose and a purine base is somewhat unstable n It occasionally undergoes a spontaneous reaction with water that releases the base from the sugar n This is termed an apurinic site n Fortunately, apurinic sites can be repaired n However, if the repair system fails, a mutation may result during subsequent rounds of DNA replication Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-30 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 3′ 5′ C G A T T A C G G C C G A T T A C G C Depurination 5′ 3′ 3′ Apurinic site 3′ 5′ 5′ 3′ (a) Depurination 3′ 5′ C G A T T A C G C 3′ DNA replication 3′ 5′ 5 3′ C G A T T A X G C 5′ (b) Replication over an apurinic site Figure 16.8 Three out of four (A, T and G) are the incorrect nucleotide C G A T T A C G G C 3′ Spontaneous depurination There s a 75% chance of a mutation X could be" A, T, G, or C 5′ 16-31 n Deamination involves the removal of an amino group from the cytosine base n The other bases are not readily deaminated Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. NH2 H H N O O + N H 2O H H N O + N Sugar Sugar Cytosine Uracil NH3 H Figure 16.9 (a) Deamination of cytosine n DNA repair enzymes can recognize uracil as an inappropriate base in DNA and remove it n However, if the repair system fails, a C-G to A-T mutation will result during subsequent rounds of DNA replication Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-32 n Deamination of 5-methyl cytosine can also occur Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. NH2 H CH3 N O O + N H 2O H Sugar 5-methylcytosine CH3 N + O N NH3 H Sugar Thymine Figure 16.9 (b) Deamination of 5-methylcytosine n n Thymine is a normal constituent of DNA This poses a problem for repair enzymes n n They cannot determine which of the two bases on the two DNA strands is the incorrect base For this reason, methylated cytosine bases tend to create hot spots for mutation Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-33 n A tautomeric shift involves a temporary change in base structure (Figure 16.10a) n The common, stable form of thymine and guanine is the keto form n n The common, stable form of adenine and cytosine is the amino form n n At a low rate, A and C can interconvert to an imino form These rare forms promote AC and GT base pairs n n At a low rate, T and G can interconvert to an enol form Refer to Figure 16.10b For a tautomeric shift to cause a mutation it must occur immediately prior to DNA replication n Refer to Figure 16.10c Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-34 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Common O H Rare OH N N Tautomeric shift N N H H 2N N N H Guanine H 2N N N Sugar Sugar Keto form Enol form N NH N N Tautomeric shift H H H N N Adenine Sugar Amino form N N H H N Sugar Imino form Common Rare O H N Common O OH CH3 Tautomeric shift H Thymine N O N Sugar Sugar Keto form Enol form N H Rare NH H N Figure 16.10 CH3 N NH2 O N H Tautomeric shift Cytosine H H N O N Sugar Sugar Amino form Imino form H (a) Tautomeric shifts that occur in the 4 bases found in DNA 16-35 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. H H 3C H H O N N Sugar H N O N N O H Thymine (enol) H N Sugar N H Guanine (keto) H N H N H N Sugar N N N N N O Cytosine (imino) H Sugar H Adenine (amino) (b) Mis–base pairing due to tautomeric shifts Figure 16.10 16-36 Temporary tautomeric shift Shifted back to its normal fom Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ Base" mismatch 3′ 5′ A thymine base" undergoes a" tautomeric shift prior" to DNA replication. 5′ 3′ 5′ T G 3′ 5′ 5′ 3′ 5′ 5′ 3′ T A 3′ 5′ 3′ 3′ 5′ T A 3′ Mutation C G A second round" 3′ of DNA replication" 5′ occurs. T A 3′ T A 3′ 5′ 3′ 5′ T A 5′ 3′ DNA molecules found" in 4 daughter cells (c) Tautomeric shifts and DNA replication can cause mutation Figure 16.10 16-37 Mutations Due to Trinucleotide Repeats n Several human genetic diseases are caused by an unusual form of mutation called trinucleotide repeat expansion (TNRE) n n These diseases include n n n The term refers to the phenomenon that a sequence of 3 nucleotides can increase from one generation to the next Huntington disease (HD) Fragile X syndrome (FRAXA) Refer to Table 16.5 for these and other examples Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-38 16-39 n Certain regions of the chromosome contain trinucleotide sequences repeated in tandem n n In normal individuals, these sequences are transmitted from parent to offspring without mutation However, in persons with TNRE disorders, the length of a trinucleotide repeat has increased above a certain critical size n n n Disease symptoms occur In some diseases, it also becomes prone to expansion This phenomenon is shown here with the trinucleotide repeat CAG CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 11 CAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG n = 18 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-40 n In some cases, the expansion is within the coding sequence of the gene n n Typically the trinucleotide expansion is CAG (glutamine) Therefore, the encoded protein will contain long tracks of glutamine n n n This causes the proteins to aggregate with each other This aggregation is correlated with the progression of the disease In other cases, the expansions are located in noncoding regions of genes n n Some of these expansions are hypothesized to cause abnormal changes in RNA structure Some produce methylated CpG islands which may silence the gene Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-41 n There are two particularly unusual features that some TNRE disorders have in common n 1. The severity of the disease tends to worsen in future generations n n This phenomenon is called anticipation 2. Anticipation usually depends on whether the disease is inherited from the father or mother n n n In Huntington disease, the TNRE is more likely to occur if inherited from the father In myotonic muscular dystrophy, the TNRE is more likely to occur if inherited from the mother This suggests that TNRE can occur more frequently during oogenesis or spermatogenesis, depending on the gene involved. Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-42 n The DNA cause of TNRE is not fully understood n TNREs contain at least one C and one G n n This allows formation of a hairpin During DNA replication, a hairpin can lead to an increase or decrease in the length of the DNA n n n Polymerase can slip off DNA Hairpin forms and pulls strand back DNA polymerase hops back on n n n See Figure 16.12 for details These changes can occur during gamete formation n n Begins synthesis from new location offspring will have very different numbers of repeats Can also increase repeats in somatic cells n This can increase severity of the disease with age Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-43 TNRE sequences can form hairpins Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. One DNA strand with a trinucleotide repeat sequence T G C C A A G C A T T C T G C T G C T G C T G C T G C T G T C A A A G C A T T Trinucleotide (CTG) repeat Hairpin formation T C A A A G C A T T Hairpin with CG base pairing T T C T G C T G C T G C T G T G C C A A G C A T T (a) Formation of a hairpin with a trinucleotide (CTG) repeat sequence Figure 16.12a Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-44 Mechanisms of trinucleotide repeat expansion or deletion One DNA template strand prior to DNA replication One DNA template strand prior to DNA replication TNRE TNRE DNA replication begins" and goes just past the TNRE. Hairpin forms in template strand" prior to DNA replication. DNA" polymerase DNA polymerase slips off" the template strand and a" hairpin forms. DNA replication occurs and" DNA polymerase slips over" the hairpin. DNA polymerase resumes" DNA replication. DNA repair occurs. DNA repair occurs. TNRE is longer. TNRE is shorter. OR TNRE is the same length. (b) Mechanism of trinucleotide repeat expansion Figure 16.12b and c OR TNRE is the same length. (c) Mechanism of trinucleotide repeat deletion Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-45 Experiment 16A: X-Rays, the First Mutagens • In 1927, Hermann Müller devised an approach to show that X-rays can induce mutations in Drosophila melanogaster – Muller reasoned that a mutagenic agent might cause some genes to be defective – His experimental approach focused on the ability of a mutagen to cause defects in X-linked genes that result in a recessive lethal phenotype Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-46 • Müller used a strain of fruit flies that enabled him to detect X-linked recessive lethal mutations – He set up his crosses in such a way that a female that inherited a new X-linked recessive lethal allele would not be able to produce any male offspring – Müller reasoned that if X-rays were indeed mutagens • Then exposure to X-rays would increase the number of females unable to produce sons Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-47 Types of Mutagens n n An enormous array of agents can act as mutagens that permanently alter the structure of DNA The public is concerned about mutagens for two main reasons: n n n 1. Mutagens are often involved in the development of human cancers 2. Mutagens can cause gene mutations that may have harmful effects in future generations Mutagenic agents are usually classified as chemical or physical mutagens n Refer to Table 16.6 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-55 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-56 Mutagens Alter DNA Structure in Different Ways n Chemical mutagens come into three main types n 1. Base modifiers n 2. Intercalating agents n 3. Base analogues Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-57 n Base modifiers covalently modify the structure of a nucleotide n n For example, nitrous acid, replaces amino groups with keto groups (–NH2 to =O) This can change cytosine to uracil and adenine to hypoxanthine n n n These modified bases do not pair with the appropriate nucleotides in the daughter strand during DNA replication Refer to Figure 16.15 Some chemical mutagens disrupt the appropriate pairing between nucleotides by alkylating bases within the DNA n Examples: Nitrogen mustards and ethyl methanesulfonate (EMS) Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-58 Template strand H After replication H NH2 N H O HNO2 N N N Sugar O Sugar Cytosine H N N H N N H Sugar N O H Uracil These mispairings create mutations in the newly replicated strand Adenine H N H N H NH2 O H H N HNO2 N N Sugar N Sugar N N H H N N H Adenine N H Hypoxanthine O Sugar Cytosine Figure 16.15 Mispairing of modified bases Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-59 n Intercalating agents contain flat planar structures that intercalate themselves into the double helix n n n This distorts the helical structure When DNA containing these mutagens is replicated, the daughter strands may contain single-nucleotide additions and/or deletions resulting in frameshifts Examples: n n Acridine dyes Proflavin Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-60 n Base analogues become incorporated into daughter strands during DNA replication n For example, 5-bromouracil is a thymine analogue n It can be incorporated into DNA instead of thymine Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. H Br O N N Sugar H H N N N 5-bromouracil" (keto form) Figure 16.16 N Sugar Sugar H This tautomeric shift occurs at a relatively high rate H H N O O H H N N N 5-bromouracil" (enol form) Adenine Normal pairing O N N N O Br H Sugar N H Guanine Mispairing (a) Base pairing of 5BU with adenine or guanine Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-61 In this way, 5-bromouracil can promote a change of an AT base pair into a GC base pair Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 5′ 3′" A 5BU 3′ 3′ A T DNA" replication 3′ 5′ 5′ 5′ 5′ 3′ G 5BU 3′ 5′ 3′ G C DNA" replication 3′ 5′ 5′ 3′ G or A 5BU 3′ 5′ (b) How 5BU causes a mutation in a base pair during DNA replication Figure 16.16 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-62 n Physical mutagens come into two main types n n n 1. Ionizing radiation 2. Nonionizing radiation Ionizing radiation n n n n n Includes X-rays and gamma rays Has short wavelength and high energy Can penetrate deeply into biological molecules Creates chemically reactive molecules termed free radicals Can cause n n n n n Base deletions Oxidized bases Single nicks in DNA strands Cross-linking Chromosomal breaks Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-63 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. H O n Nonionizing radiation n n n n n Includes UV light Has less energy Cannot penetrate deeply into biological molecules Causes the formation of cross-linked thymine dimers Thymine dimers may cause mutations when that DNA strand is replicated O P O CH2 O– H H H N CH3 H H Thymine CH3 O O P O CH2 O– H H O O H H N N H H O Thymine H Ultraviolet" light O O P O O H O CH2 O– H H N O O O H H N H CH3 H H CH3 O O P O CH2 O– Figure 16.17 N O H H H O O H H Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display N H N H O Thymine dimer 16-64 16.3 DNA REPAIR • Since most mutations are deleterious, DNA repair systems are vital to the survival of all organisms – Living cells contain several DNA repair systems that can fix different type of DNA alterations • In most cases, DNA repair is a multi-step process – 1. An irregularity in DNA structure is detected – 2. The abnormal DNA is removed – 3. Normal DNA is synthesized • Refer to Table 16.7 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-67 16-68 Damaged Bases Can Be Directly Repaired n In a few cases, the covalent modifications of nucleotides can be reversed by specific enzymes n Photolyase can repair thymine dimers n n n n It splits the dimers restoring the DNA to its original condition Uses energy of visible light Refer to Figure 16.19a O6-alkylguanine alkyltransferase repairs alkylated bases n It transfers the methyl or ethyl group from the base to a cysteine side chain within the alkyltransferase protein n n Surprisingly, this permanently inactivates alkyltransferase! Refer to Figure 16.19b Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-69 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. O H Thymine dimer CH3 N O H 3C O6-methylguanine N H O CH3 SH CH2 N N H O N H DNA" backbone H H 3C N NH2 N Alkyltransferase Alkyltransferase catalyzes" the removal of the methyl" group onto itself. CH3 O CH3 N N DNA" backbone DNA photolyase" cleaves the 2" bonds between" the thymine dimer. O H O N Guanine H O H N N CH2 H O N H H N O The normal structure of the 2 thymines is restored. (a) Direct repair of a thymine dimer N N S NH2 The normal structure of guanine is restored. (b) Direct repair of a methylated base Figure 16.19 Direct repair of damaged bases in DNA 16-70 Base Excision Repair Removes a Damaged DNA n Base excision repair (BER) involves a category of enzymes known as DNA N-glycosylases n n Depending on the species, this repair system can eliminate abnormal bases such as n n n These enzymes can recognize an abnormal base and cleave the bond between it and the sugar in the DNA Uracil; Thymine dimers 3-methyladenine; 7-methylguanine Refer to Figure 16.20 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-71 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 3′ C T C C C C C T G A A G A G A C G A G T U G C T G C T G G A 3′ 5′ U N-glycosylase recognizes an abnormal" base and cleaves the bond between the" base and the sugar. 5′ 3′ C T C C C C C T G A A G A G A G A G G G G G A C T C T C T 3′ 5′ Apyrimidinic" nucleotide AP endonuclease recognizes a missing" base and cleaves the DNA backbone on" the 5′ side of the missing base. 5′ 3′ C T C C C C C T G A A G A G A G A G G G G G A C T C T C T Depending on whether a purine or pyrimidine is removed, this creates an apurinic and an apyrimidinic site, respectively 3′ 5′ Nick In E. coli, DNA polymerase I uses its 5′ 3′" exonuclease activity to remove the damaged" region and then fills in the region with normal" DNA. DNA ligase seals the region. 5′ 3′ G C T C A A C G A C G A C C T G A G G G G G A C T T C T C T 3′ 5′ Nick-translated region In eukaryotes such as humans, DNA" polymerase β can remove the apyrimidinic" nucleotide and replace it with the correct" nucleotide. DNA ligase seals the region. 5′ 3′ C T C C C C C T G A A G A G A G A G G G G G A C T T C T C T 5′ 3′ In eukaryotes such as humans," DNA polymerase δ or ε can" synthesize a short segment of" DNA, which generates a flap. 5′ 3′ C T C C C C C T G A A G A G A G A G G G G G A C T T C T C T 3′ Flap 5′ Flap is removed by flap" endonuclease. DNA ligase" seals the region. 5′ 3′ G C T C A A C G A C G A C C T G A G G G G G A C T T C T C T Figure 16.20 Base Excision Repair 3′ 5′ 16-72 Nucleotide Excision Repair Removes Damaged DNA Segments n n An important general process for DNA repair is nucleotide excision repair (NER) This type of system can repair many types of DNA damage, including n n n Thymine dimers and chemically modified bases missing bases, some types of crosslinks NER is found in all eukaryotes and prokaryotes n However, its molecular mechanism is better understood in prokaryotes Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-73 Nucleotide Excision Repair Removes Damaged DNA Segments n In E. coli, the NER system requires four key proteins n These are designated UvrA, UvrB, UvrC and UvrD n Named as such because they are involved in Ultraviolet light repair of pyrimidine dimers n n They are also important in repairing chemically damaged DNA UvrA, B, C, and D recognize and remove a short segment of damaged DNA n DNA polymerase and ligase finish the repair job n Refer to Figure 16.21 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-74 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Thymine dimer 5′ 3′ A 3′ T T A 5′ B The UvrA/UvrB complex tracks along the" DNA in search of damaged DNA. 5′ 3′ A T T 3′ A B 5′ After damage is detected, UvrA" is released, and UvrC binds. 5′ 3′ T T 3′ B 5′ UvrC UvrC makes cuts on both" sides of the thymine dimer. Figure 16.21 16-75 Typically, the cuts are 4-5 nucleotides from the 3 end of the damage, and 8 nucleotides from the 5 end Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Cut Cut 5′ 3′ T T 3′ B 5′ UvrC UvrD, which is a helicase, removes" the damaged region. UvrB and" UvrC are also released. 5′ 3′ 3′ 5′ DNA polymerase fills in the gap," and DNA ligase seals the gap. No thymine dimer Figure 16.21 5′ 3′ 3′ 5′ 16-76 Nucleotide Excision Repair Removes Damaged DNA Segments n Several human diseases have been shown to involve inherited defects in genes involved in NER n These include xeroderma pigmentosum (XP), Cockayne syndrome (CS) and PIBIDS n n n A common characteristic of all three syndromes is an increased sensitivity to sunlight Figure 16.22 shows an individual affected with XP Xeroderma pigmentosum can be caused by defects in seven different NER genes Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-77 Mismatch Repair Systems Detect and Correct A Base Pair Mismatch n n A base mismatch is another type of abnormality in DNA The structure of the DNA double helix obeys the AT/ GC rule of base pairing n n However, during DNA replication an incorrect base may be added to the growing strand by mistake DNA polymerases have a 3 to 5 proofreading ability that can detect base mismatches and fix them Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-78 Mismatch Repair Systems Detect and Correct A Base Pair Mismatch n n n If proofreading fails, the mismatch repair system comes to the rescue Mismatch repair systems are found in all species An important aspect of these systems is that they are specific to the newly made strand Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-79 Mismatch Repair Systems Detect and Correct A Base Pair Mismatch n The molecular mechanism of mismatch repair has been studied extensively in E. coli n Three proteins, MutL, MutH and MutS detect the mismatch and direct its removal from the newly made strand n n The proteins are named Mut because their absence leads to a much higher mutation rate than normal A key characteristic of MutH is that it can distinguish between the parental strand and the daughter strand n n Prior to replication, both strands are methylated Immediately after replication, the parental strand is methylated whereas the daughter is not! Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-80 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. The MutS protein finds a mismatch. The MutS/MutL complex binds" to MutH, which is already bound to a hemimethylated sequence. m GAT C C TAG Parental" strand MutH Newly" made" strand MutL Acts as a linker between MutS and MutH MutS T G Incorrect" base MutH makes a cut in the" nonmethylated strand. MutU" separates the DNA strands at the" cleavage site and an exonuclease" digests the nonmethylated strand" just beyond the base mismatch. m T C GA MutH cleavage site G Figure 16.23 Methyl-directed mismatch repair in E. coli 16-81 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. m T C GA MutH cleavage site G DNA polymerase fills in" the vacant region. DNA" ligase seals the ends. m GATC C TAG The mismatch has been" repaired correctly. C G Figure 16.23 Methyl-directed mismatch repair in E. coli 16-82 Double-Strand Breaks in DNA Can Be Repaired by Recombination n DNA Double-Strand Breaks are very dangerous n n Breakage of chromosomes into pieces Caused by ionizing radiation and chemical mutagens n n n n Also caused by reactive oxygen species which are the byproducts of cellular metabolism 10-100 breaks occur each day in a typical human cell Breaks can cause chromosomal rearrangements and deficiencies They may be repaired by two systems known as homologous recombination repair (HRR) and nonhomologous end joining (NHEJ) n Refer to Figures 16.24 and 16.25 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-83 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Double-strand break 5′ 3′ 3′ An identical" 3′ region" between" sister" 5′ chromatids 5′ 5′ 3′ End processing 5′ 3′ 3′ 5′ 3′ 5′ 5′ 3′ Strand exchange Figure 16.24 5′ 3′ 3′ 5′ 3′ 5′ 5′ 3′ 16-81 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. 5′ 3′ 3′ 5′ 3′ 5′ 5′ 3′ DNA synthesis 5′ 3′ 3′ 5′ 3′ 5′ 5′ 3′ Resolution and ligation Figure 16.24 5′ 3′ 3′ 5′ 3′ 5′ 5′ 3′ 16-85 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Double-strand break End binding End-binding proteins End bridging Protein cross-bridge Recruitment of additional" proteins and end processing Proteins for DNA processing Gap filling and ligation Figure 16.25 16-86 Repair of Actively Transcribed DNA n Not all DNA is repaired at the same rate n n Actively transcribed genes in eukaryotes and prokaryotes are more efficiently repaired than is nontranscribed DNA The targeting of DNA repair enzymes to actively transcribing genes has several biological advantages n Active genes are more loosely packed n n n May be more vulnerable to DNA damage Transcription may make DNA more susceptible to damage DNA regions that contain active genes are more likely to be important for survival than nontranscribed regions Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-87 Repair of Actively Transcribed DNA n In E. coli, a protein known as transcription-repair coupling factor (TRCF) mediates transcription coupled DNA repair n n It targets the NER system to actively transcribed genes with damaged DNA Refer to Figure 16.26 Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-88 Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. RNA polymerase Thymine dimer T T A thymine dimer has" caused RNA polymerase" to stall during transcription. TRCF functions as a helicase" and removes RNA polymerase" from the damaged region. TRCF" (contains a" binding site" for UvrA) RNA" polymerase The UvrA/UvrB complex is" recruited to the damaged" region. TRCF is released. A A B TRCF Figure 16.26 The region is repaired as described in Figure 16.21. 16-89 n n In E. coli, translesion synthesis occurs under extreme conditions that promote damage to DNA This is termed the SOS response n n It results in the up-regulation of several genes that repair DNA, restore replication and prevent premature division The damaged DNA that has not been repaired is replicated by DNA polymerases II, IV and V Copyright ©The McGraw-Hill Companies, Inc. Permission required for reproduction or display 16-93