Eur. J. Biochern. 244, 700-705 (1997)
0 FEBS 1997
Cloning, expression, purification and characterization
of triosephosphate isomerase from Trypanosoma cruzi
I,
Pedro OSTOA-SALOMA ', Geogina GARZA-RAMOS', Jorge RAMiREZ Ingeborg BECKER ', Myriam BERZUNZA3,
Abraham LANDA', Armando COMEZ-PUYOU', Marietta TUENA DE GOMEZ-PUYOU' and Ruy PEREZ-MONTFORT'
' Departamento de Microbiologia, Instituto de Fisiologia Celular, Universidad Nacional Autonoma de MCxico, Mexico
' Departamento de BioenergCtica, Instituto de Fisiologid Celular, Universidad Nacional Aut6noma de MCxico, Mtxico
' Departamento de Medicina Experimental, Facultad de Medicina, Universidad Nacional Aut6noma de Mexico, Mtxico
"
Departamento de Microbiologia y Parasitologia, Facultad de Medicina, Universidad Nacional Autonoma de Mexico, MCxico
(Received 28 October 1996/15 January 1997)
~
EJB 96 158714
The gene that encodes for triosephosphate isomerase froin Trypanosoma cruzi was cloned and sequenced. In 7: cruzi, there is only one gene for triosephosphate isomerase. The enzyme has an identity
of 12% and 68 5% with triosephosphate isomerase from Trypanosoma brucei and Leishmania mexicanu,
respectively. The active site residues are conserved: out of the 32 residues that conform the interface of
dimeric triosephosphate isomerase from 7: brucei, 29 are conserved in the 7: cruzi enzyme. The enzyme
was expressed in Escherichia coli and purified to homogeneity. Data from electrophoretic analysis under
denaturing techniques and filtration techniques showed that triosephosphate isomerase from 7: cruzi is a
homodimer. Some of its structural and kinetic features were determined and compared to those of the
purified enzymes from 7: brucei and L. mexicana. Its circular dichroism spectrum was almost identical
to that of triosephosphate isomerase from 7: brucei. Its kinetic properties and pH optima were similar to
those of 'I: brucei and L. mexicana, although the latter exhibited a higher V,,,, with glyceraldehyde 3phosphate as substrate. The sensitivity of the three enzymes to the sulfhydryl reagent methylmethane
thiosulfonate (MeS0,-SMe) was determined; the sensitivity of the 7: cruzi enzyme was about 40 times
and 200 times higher than that of the enzymes from 7: brucei and L. mexicana, respectively. Triosephosphate isomerase from 7: cruzi and L. mexicana have the three cysteine residues that exist in the 'I: brucei
enzyme (positiuns 14, 39, 126, using the numbering of the 7: brucei enzyme); however, they also have
an additional residue (position 1 1 7). These data suggest that regardless of the high identity of the three
trypanosomatid enzymes, there are structural differences in the disposition of their cysteine residues
that account for their different sensitivity to the sulthydryl reagent. The disposition of the cysteine in
triosephosphate isomerase from 7: cr~17iappears to make it unique for inhibition by modification of its
cysteine.
Keywords: triosephosphate isomerase; Trypanosoma cruzi ; sequence ; purification ; characterization.
Extensive studies are being made on the function and structure of enzymes from parasites. These studies have shown that
some parasites possess systems that differ from other organisms
L1,2]. In contrast, it has been observed that some of the enzymes
from parasites are markedly similar to those of other organisms.
The purpose in many of these studies is to gain insight into
systems that have particular evolutionary advantages [3] and
also to design drugs that can be used in the treatment of parasitic
diseases 11, 2 , 41. The two objectives require detailed knowledge
of the primary structure of the proteins and their arrangement
into a three-dimensional functionally active structure. In the
Correspoiiderzcr to P. Ostoa-Saloma, Departamento de Microbiologia, Instituto de Fisiologia Celular, Universidad Nacional Autonoma de Mexico, Apartado Postal 70242, MEX-04510 Mexico D.F.
MCxico
Fax: f S 2 5 6225630.
Ahhueviuficin. MeSO,-SMe, methylmcthane thiosulfonate.
Enzymes. Triosephosphate isomerase (EC 5.3.1.1) : glycerol-3-phosphate dehydrogenase (EC 1.1.1.18).
Note. The nucleotide sequence data reported in this paper have been
deposited in the GenBank data base and are available under the accession number U53867.
context of drug design, it is known that trypanosomes rely
heavily on glycolysis as an energy source [ 5 ] .Thus, several of
the enzymes of the glycolytic pathway of Trpano.wma brucei,
the parasite that produces sleeping sickness in humans and nagana in cattle in Africa, have been extensively studied in both
function and structure [4, 6-91. The metabolic pathways that
operate in Trypnosoma cruzi, which produces Chagas disease,
have also been investigated [lo], but less is known of the structure of these enzymes. In this work, we describe the sequence
of the gene that encodes for triosephosphate isomerase from 7:
cruzi. We also describe the expression of the cloned gene in
Escherichia coli, the purification of the recombinant enzyme,
and some of the structural and kinetic properties of the pure
enzyme.
One of our interests in triosephosphate isomerase from 7:
cruzi arose from observations that indicate that triosephosphate
isomerase from 7: brucei can b e inhibited by covalent modification of Cysl4 [ I l l , i.e. derivatization of this cysteine triggers
structural alterations that lead to abolition of catalysis. Since
many triosephosphate isomerases, including the human enzyme
(for references of the amino acid sequence of triosephosphate
isomerases from 28 species, see [I l]), lack this cysteine, Cysl4
Ostoa-Saloina et al. (ELL,:J. Biochem. 244)
represents an excellent target for achieving species-specific inhibition of enzyme action. Using the numbering system of the
enzyme from 7: bruceijt was found that triosephosphate isomerase from 7: cruzi has the three cysteine residues of the 7: hrucei enzyme (14, 39, and 126); however, it has an additional
cysteine at position 117. The enzyme from L. rnexicanu [12] has
the four cysteine residues of triosephosphate isomerase from 7:
cruzi in identical positions. Thus, the effect of methylmethane
thiosulfonate (MeS0,-SMe) was determined in the three trypanosomatid enzymes. The three triosephosphate isomerases were
inhibited, but it was found that despite of their high identity, the
sensitivity of triosephosphate isomerase from 7: cruzi to MeS0,SMe was several-fold higher than that of 7: brucei triosephosphate isomerase, which in turn was higher than that of the leishmania1 enzyme.
MATERIALS AND METHODS
Trypanosome DNA and cDNA preparations. 7: cruzi
strain Ninoa, which was obtained from a patient with acute Chagas disease in the state of Oaxaca, MCxico, was a kind gift of
Dr B. Espinoza (Instituto de Investigaciones BiomCdicas, Universidad Nacional Aut6noma de MCxico). Parasite cells were
cultured in RPMI medium containing 10% (by vol.) fetal bovine
serum at 30°C.
Epimastigotes were washed in 15 mM potassium phosphate,
pH 7.4, containing 184 mM NaCl and lysed overnight at 50°C in
a digestion solution containing 10 mM TrislHCI, pH 8, 100 mM
NaCl, 25 mM EDTA, 0.5% SDS, and 0.1 mg/ml proteinase K.
DNA was obtained following standard procedures.
Total RNA from 7: cruzi was obtained with TRIzol (Gibco
BRL) according to the manufacturer's instructions. cDNA was
prepared with a Moloney murine leukemia virus ribonuclease
H minus reverse transcriptase kit (Promega) according to the
manufacturer's instructions.
Polymerase chain reaction. Polymerase chain reactions
were performed using 2 U Taq polymerase, except for the amplification of the complete gene (see below). The optimal magnesium concentration was established in each case by using concentrations in the range 0-9 mM. Two oligonucleotides of conserved regions were constructed based on alignments of known
sequences of triosephosphate isomerase [I I] and the reported
use of codons by 7: cruzi [13]. The sequences for the sense
oligonucleotide and the antisense oligonucleotide are 5'-CCSATYGCNGCNGCNGACTGGAAGTGCGAC-3' and 5'-RAAYTCSGGCTTMAGRCTNGCRCCMAC-3', respectively (where
Y=T/C, R=G/A, S=C/G, M=C/A, N=A/C/G/T). Genomic
DNA was used as template under the following conditions. Reagents were previously incubated at 95°C for 5 min, PCR was
performed for 50 cycles at 95°C for 2 min, 55°C for 1 min,
72°C for 1 rnin 30 s, and incubating at 72°C for 10 min. The
amplified fragment contained more than 90% of the gene and
was used to obtain the complete gene.
Determination of the sequences of the 5' and 3' ends of
the gene. A cDNA of 7: cruzi was used as a template with
anchored PCR. The internal oligonucleotides were designed
using the partial sequence of the amplified fragment. It has been
reported that in the maturation process of 7: cruzi mRNA, a very
conserved sequence of 35 nucleotides is added to the 5'-end of
the gene 1141. Hence, the sequences 5'-TGATACAGTTTCTGTACTATATTG-3' and 5'-ATCTGCAGAGACAGTTCCCCCGTGAAAGCG-3' were designed as sense and antisense ohgonucleotides, respectively, to amplify the 5'-end of the gene. For the
amplification of the 3'-end of the gene, an oligo(dA) complementary to the oligo(dT) of the cDNA was used. The sense oli-
701
gonucleotide was 5'-CAAATTGGGCACTGAC-3' and the antisense oligonucleotide was 5'-oligo(dA) ,8-3'. The conditions for
the first-round PCR were 95 "C for 3 min, 50 OC for 2 min, 72 "C
for 3 min, one cycle. Subsequent PCR was performed for 25
cycles at 95°C for 1 min, 50°C for 2 min, and 72°C for 3 min.
The reaction was terminated by incubating at 95°C for 1 min,
50°C for 5 rnin and 72°C for 10 min.
Amplification of the complete gene that encodes triosephosphate isomerase in T cruzi. From the previous amplifications, the sequences that flank the gene for triosephosphate isomerase in genomic DNA were determined. From those sequences, the sense and anti-sense oligonucleotides 5'TATATGGCATCGAAGCCT-3' and 5'-GGATCCGCCAATCCCCTCTCCT-3' were synthesized. Genomic DNA was used as a template
for the PCR reaction, which consisted of a prior incubation at
95 "C for 5 rnin and 20 cycles at 95 "C for 2 min, 55 "C for 1 rnin
and 72°C for 1 rnin 30 s ending at 72°C 10 min and cooling to
4°C. The complete gene was amplified using the Expand High
Fidelity PCR system (Boehringer).
Cloning of the gene and sequence analysis. The amplified
gene was ligated to the pCR I1 vector using a TA cloning kit
(Invitrogen) and competent E. coli cells (TG1 strain) were transformed. Sequencing was performed using the Sequenase version
2.0 DNA sequencing kit (US Biochemical) by the dideoxynucleotide chain-termination method. Plasmid purification,
transfer and hybridization of nucleic acids were carried out by
reported procedures [ 151. Sequence analysis was performed
using the GCG program package (Genetics Computer Group,
Madison, Wisconsin).
Southern blot analysis. Genomic DNA isolated from 7:
cruzi was digested with HueIII, HincII, PstI, and PvuII, enzymes
that have a restriction site within the gene sequence, and with
EcnRI, EcoRV, NcoI, XhoI, and ClaI, enzymes which do not
have such a site (BRL). Southern blot analysis was performed
according to described procedures [I 5 ) .
Expression of triosephosphate isomerase from T. cruzi.
The pCR I1 vector containing the gene was treated with Ndel
and BamHI and the released gene was ligated to the PET vector
(Novagen). Expression of the triosephosphate isomerase from 7:
cruzi was accomplished in E. coli cells strain BL23 (DE3) pLysS
following the PET system manual instructions (Novagen). Expression was induced in bacterial cultures at A,,, 0.6. by adding
0.4 mM isopropyl thio-P-D-galactoside and culturing the cells
for an additional 3 h. After this incubation, cells were harvested
by centrifugation and processed immediately or frozen at 70°C until used.
Purification of recombinant triosephosphate isomerase
from T. cruzi. Cells from a 1-1 culture were collected by centrifugation and suspended in 40 ml 25 mM Mes, 1 mM EDTA,
1 mM dithiothreitol, and 0.2 mM phenylmethylsulfonyl fluoride,
pH 6.5. The suspension was passed three times through a French
press. The suspension was centrifuged at 15000 rpm for 15 rnin
and the supernatant centrifuged at 40000 rpm in a Beckman 60
Ti rotor for 60 min. Ammonium sulfate to a concentration of
45 % saturation was added to that latter supernatant; the suspension was allowed to stand overnight at 4°C and thereafter centrifuged at 15000 rpm for 20 min. The pellet was discarded and
the concentration of ammonium sulfate in the supernatant was
increased to 75% saturation and allowed to stand for 15-20 h
at 4°C. The suspension was centrifuged at 15000rpm for
15 min and the precipitate dissolved in 2 ml 25 mM triethanolamine, 2 mM EDTA, 1 mM azide, and 0.5 mM dithiothreitol,
pH 8.0 (buffer A). The dissolved enzyme was applied to an ACA
34 A (3 cmX80 cm) column equilibrated with buffer A; it was
eluted with the same buffer at a flow rate of 15 ml/h.
Triosephosphate isomerase activity appeared after about 300 ml
702
Ostoa-Saloma et al. ( E m J. Biochem. 244)
buffer A had passed through the column. Fractions with activity
were pooled, and concentrated in Amicon filters (P5) to a volume of about 5 ml. The enzyme solution was applied to a
1.5 cmX 14 cm carboxymethyl-Sepharose column, (Fast flow,
Pharmacia) equilibrated with buffer A. About 60 ml buffer A
were passed through the column; some activity eluted in this
fraction. Subsequently, buffer A that contained 150 mM NaCl
was passed through the column. Fractions of 1 ml were collected; most of the activity appeared in fractions 18-23. The
fractions that exhibited a high level of activity were also analyzed in SDS gels. Only those fractions that exhibited a single
protein band were pooled. The enzyme was stored at 4°C as a
70% ammonium sulfate suspension. No changes in its catalytic
properties have been noted in three months of storage.
For the purification of recombinant triosephosphate isomerase from 7: brucei the protocol described by Borchert et al.
1161 was followed. The enzyme from L. mexicana was purified
as described by Kohl et al. [12].
For the experiments, the enzymes were previously dialyzed
against 100 mM triethanolamine and 10 mM EDTA, pH 7.4. For
determination of the CD spectra, the enzymes were dialyzed
against 20 mM sodium phosphate, pH 7.4.
Activity assays. Enzyme activity was determined at 25°C in
a mixture that contained 100 mM triethanolamine and 10 mM
EDTA, pH 7.4, 1 mM glyceraldehyde 3-phosphate (except when
the K,,, for this substrate was determined), 0.2 mM NADH and
0.9 U sn-glycerol 3-phosphate dehydrogenase [I 11. Activity was
monitored by following the decrease in absorbance at 340 nm.
When the effect of MeS0,-SMe on the activities of
triosephosphate isomerase from 7: cruzi, 7: brucei, and L. mexicana was determined, the enzymes were incubated at a concentration of 5 pglml of 100 mM triethanolamine and 10 mM
EDTA, pH 7.4, for 2 h at 25°C. MeS0,-SMe was included at
the concentrations indicated in the Results section. At this time,
an aliquot was withdrawn and diluted to assay enzyme activity.
In the preincubation period, no loss of activity occurred in the
control enzymes.
Other assays. The molecular mass of triosephosphate isomerase from 7: cruzi was determined by filtration of a solution of
the enzyme (0.1 ml) at a concentration of 2.4 mg/ml through a
column of Sephacryl S 300 (1 cmX30 cm), with final elution
by 0.1 M K,HPO,, pH 7.0. The standards were as follows: thyroglobulin, immunoglobulin G, ovoalbumin and myoglobin.
CD spectra were recorded on an Aviv 62 HDS spectropolarimeter at 25OC. Each spectrum was the average of ten repetitive
scans and was corrected by subtracting the average spectrum of
the buffer. Spectra in the far-ultraviolet region were recorded in
a 0.1-cm cell with 1-nm intervals and 2.5 s dwell time; ellipticities are reported as mean residual ellipticity using mean residue
molecular masses of 108.5 Da and 107.7 Da for triosephosphate
isomerase from 7: cruzi and 7: brucei, respectively. Before determination of the spectra, the samples were filtered through a
Millipore membrane with a pore size of 0.45 pm.
Electrophoresis under denaturing conditions was carried out
in 12.5% acrylamide gels containing SDS as described by
Laemmli 1171; the gels were stained for protein with Coomassie
brilliant blue R-250.
For determination of protein, the method of Bradford [ 181
was used in the various steps of purification of triosephosphate
isomerase from 7: cruzi. For the pure enzymes of 7: cruzi, 7:
brucei, and L. rnexicana, protein was determined from their absorbance at 280 nm. The molecular coefficients of the enzymes
were calculated according to Pace et al. [19]; these were F ~ ~
36440, 34950 and 36440 M-' cm-' for 7: cruzi, 7: brucei, and
L. mexicona, respectively.
aatcgtacttacattca
gaccaatattttatacattacattacattaaaaaaagaqgcagaaatttgcgacgacacg
ATGGCATCGAAGCCTCAACCCATCGCCGCCGCAAACTGG~GTGCAACGGCTCCGAGAGT
1
---------+---------+---------+---------+---------+---------+
60
120
180
240
300
360
420
480
540
600
660
aggagaggqgattqgcncngggaaacgagaaaagcaaccatcaggcccaaaatatatngc
gatgatgtaaacaacc
Fig. 1. Nucleotide sequence and predicted amino acid sequence of
triosephosphate isomerase from T. cruzi. Nucleotides are numbered
from the transcription initiation site (position 1). The deduced amino
acid sequence is shown in one-letter code in bold characters below the
DNA. *, stop codon.
RESULTS
The 909-nucleotide sequence containing the gene for
triosephosphate isomerase of genomic DNA of 7: cruzi has an
open reading frame for a protein of 251 amino acids with a
calculated molecular mass of 27 244 Da (Fig. 1). Triosephosphate isomerase from L. rnexicana also has 251 residues [12].
whereas the 7: brucei enzyme has 250. The difference is due to
the presence of an amino acid at position 2 in the 7: cruzi and
leishmania1 enzymes which is absent in triosephosphate isomerase from 7: brucei. Throughout the manuscript, the numbering
of the amino acid sequence of triosephosphate isomerase from
7: brucei will be used.
Southern blot analysis. Our results of digestion of DNA from
7: cruzi with nine restriction enzymes were consistent with the
presence of a single copy of the gene in the genome of this
parasite (data not shown).
,
Sequence analysis. The comparison of the amino acid sequence
of triosephosphate isomerase from 7: cruzi, I: brucei [20] and
L. mexicana [12] is shown in Fig. 2. The positional identities of
~the
, 7: cruzi enzyme with triosephosphate isomerase from I: brucei and L. mexicanu were 72.80% and 68.13%, respectively.
Between 7: brucei and L. mexicana, the identity is 68% [12].
Ostoa-Saloma et al. (Eur: J. Biochem. 244)
1
Thrucei
Tcruzi
Lmexican
50
H.SKFQPIAA A " G S Q Q
SLSELIDLFN STSINHDVQC WASTFVHLA
MASKFQPuv\ A " G S E S
LLVPLIETW AATFDHDVM: WAPTFLHIP
MsAKFQPIAA ALIWKCNGTTA SIEKLVQVFN EHTISHDVQC WAPTFVHIP
Tbrucei
Tcruzi
Lmexican
51
100
MTKERLSHPK FVIAWNAIA KSGAFTGEVS LPILKDFGVN WIVLGHSERR
MTKRRLTNPK FQIAAQNAIT RSGAFTGEVS LQILFDYGIS WWLGHSERR
LVQAKLRNPK YVISAENAIA KSGAFTGEVS MPILKDIGVH WVIlC.HSERR
Tbrucei
Tcruzi
Lmexican
101
150
AYYGETNEIV A D K V M V A S GFMYIACIGE TLQERESGRT AWVLTQIPA
LYYGETNEN AEKVAQACA?+ GFHVIVCVGE TNEEREAGAT AAVVLTQLT4A
TYYGETDEN AQKVSFACKQ GFMVIACIGE TLQQREANQT AKVVLSQTSA
151
200
T b r u c e i W-1
AKVVIAYEW WAIGTGKVAT PQQAQEAHAL IRSWVSSKIG
T c r u z i VAQKLSKEAW S R W I A Y E W WAIGTGKVAT PQQAQEVHEL LRRWVRSKLG
L m e x i c a n IAAKLTKDAW NQVVLAYEW WAIGTGKVAT PEQAQEVHLL LRKWVSENIG
201
250
Thrucei
Tcruzi
Lmexican
ADVRGELRIL YGGSVNGKNA RTLYQQRDVN GELVGGASLK PEFVDIIKAT
TDIAAQLRXL YGGSYTAKNA RTLYQMRDIN GFLVGGL5LK PEFVEIIEAT
TDVAAKLRIL YGGSVNAANA ATLYAKPDIN GFLVGGASLK PEFRDIIDAT
Thrucei
Tcruzi
Lmexican
251
Q
K
R
Fig.2. Comparison of the deduced amino acid sequences of
triosephosphate isomerases from T. cruzi, T. brucei, and L. rnexicnna.
Conserved residues are shown in bold characters and active site residues
are marked (*).
Comparison with triosephosphate isomerases from 39 other
sources showed identities in the range from 36.2-51.8%. The
calculated isoelectric point of the predicted amino acid sequence
is 8.19 with a calculated net charge of +2. The motif AYEPVWAIGTG (amino acids 165-175) is strictly identical to that in
the other trypanosomatid sequences and corresponds to the
triosephosphate isomerase signature in the PROSITE library of
sequences. The active site residues (Asnl2, Lysl4, His96 and
Glu168) are conserved.
Triosephosphate isomerase from 7: cruzi is a homodimer.
The crystal structure of triosephosphate isomerase from 7: brucei
shows that 32 amino acids of each of the two monomers conform the interface of dimeric triosephosphate isomerase [21]. Of
these residues, 29 are present in the 7: cruzi and 28 in the leishmania1 enzyme. Triosephosphate isomerase from 7: criizi and
7: brucei differ at residues 46, 49, and 86 (Val, Ala and Phe
in T brucei and Leu, Pro, and Tyr in 7: cruzi, respectively).
Triosephosphate isomerase from 7: cruzi and L. mexicana differ
in the interface residues at positions 17, 46, 65, and 86, i.e. Thr,
Val, Glu, and Ile in L. mexicana and Ser, Leu, Gln, and Tyr, in
the 7: cruzi enzyme. Kohl et al. [I21 noted that in leishmania1
triosephosphate isomerase, the highly conserved Glu65 is substituted by Gln; triosephosphate isomerase from 1: cruzi has a Glu
in this position.
With respect to the cysteine content of the three enzymes, it
is noted that the three cysteine residues (14, 39, and 126) of the
7: brucei enzyme exist in equivalent positions in triosephosphate
isomerase from 7: cruzi and L. mexicana (Fig. 2). The latter two
have also a cysteine at position 117. The only known sequences
that have a cysteine at position 117 are those of L. mexicana
and 7: cruzi.
Purification of recombinant triosephosphate isomerase from
T. cruzi. After elimination of cell debris of E. coli cells in which
triosephosphate isomerase from 7: cruzi had been expressed,
most of the activity precipitated between 45 % and 75 % ammonium sulfate (Table 1). The latter precipitate was dissolved in
buffer A and applied to an ACA 34 A column and eluted with
the same buffer. Fractions with activity were collected and concentrated using Amicon filters. At this stage, the enzyme had a
high specific activity (Table I), but an enzyme with a higher
specific activity was obtained by passing the concentrated en-
703
Table 1. Purification of recombinant triosephosphate isomerase from
T. cruzi. The enzyme was purified as described in the Materials and
Methods section. The starting material was E. cnli cells obtained from
a 1-1 culture. Gra3P, glyceraldehyde 3-phosphate.
~
Step
Total
protein
Total
activity
mg
pnol Gra3P
~
.min
Homogenate (French press)
Supernatant (40000 rpm)
Precipitate 45-75% (NH,),SO,
ACA 34 A column
Carboxymethy I-Sepharose
304
289
135
30
18
Specific
activity
~
'
135000
140000
127000
87 000
65 300
~
pol
. min ' . mg
protein-'
444
484
94s
2900
3627
zyme through a carboxymethyl-Sepharose column. After applying the enzyme, the column was first washed with buffer A.
Some activity was detected in the washing buffer, but most of
the activity eluted when buffer A with 150 mM NaCl was applied (Table 1). The fractions that exhibited a single protein band
in SDS electrophoretic gels were pooled and used for further
studies. This protocol has been followed three times; the yield
of the enzyme ranged between 18 mg/l to 25 mg/l culture.
The possibility that the enzyme was contaminated with
triosephosphate isomerase from E. coli was explored. Due to its
relatively low isoelectric point (5.89), triosephosphate isomerase
from E. coli was eluted from of the carboxymethyl-Sepharose
column with the washing buffer; some activity was detected in
these fractions (see above). The sensitivity to MeS0,-SMe of
various triosephosphate isomerases can be used to determine if
a particular triosephosphate isomerase possesses a cysteine at
position 14 [ I l , 221. For instance, triosephosphate isomerase
from E. coli that lacks Cys14 is insensitive to MeS0,-SMe [22],
whereas the activity of triosephosphate isomerases that have this
residue are completely inhibited. Triosephosphate isomerase
from 7: cruzi has this residue (Fig. 2) and its activity is totally
inhibited by MeS0,-SMe. Accordingly, the sensitivities to
100 pM MeS0,-SMe of the enzymes that eluted with the washing buffer and that eluted with NaCl were determined; the activity of the latter was completely abolished, whereas that in the
washing buffer was insensitive to MeS0,-SMe. Thus, recombinant triosephosphate isomerase from 7: cruzi was essentially free
of triosephosphate isomerase from E. coli.
Characteristics of triosephosphate isomerase from T. cruzi.
Electrophoretic gels of triosephosphate isomerase from 7: cruzi
ran under denaturing conditions exhibited a single band with a
molecular mass of 27 kDa. When the enzyme was passed
through a column of Sephacryl S 300 at a concentration of
2.4 mg/ml, it eluted as a protein with a Stokes radius that corsesponded to a protein of 50 kDa. Taken together, these findings
indicate that like all the described triosephosphate isomerases,
except that of hyperthermopilic Archaea which is a tetramer
[23], triosephosphate isomerase from 7: cruzi is a homodimer.
The CD spectra of triosephosphate isomerase from 7: cruzi and
7: brucei were almost indistinguishable.
Catalysis. In view of the high specific activity of triosephosphate isomerase, activity assays are usually carried with nanogram amounts of enzyme per ml of reaction mixture. With 5 ng
protein/ml from 7: cruzi, activity traces were linear with time
until NADH became limiting. Since triosephosphate isomerase
monomers are inactive [24-261, the data indicated that no disso-
704
Ostoa-Saloma et al. ( E M J. Biochem. 244)
Table 2. Comparison of the K , and V,,, values of triosephosphate
isomerase from I: cruzi, 7: brucei, and L. rnexicana. The activity was
determined with various concentrations of glyceraldehyde 3-phosphate
(0.065-2.0 mM) as described in the Materials and Methods section. K,,,
and V,,,,, values were calculated from Lineweaver-Burk plots. The numbers in parentheses show the number of determinations.
K,,,
Enzyme
VI,,',,
~
mM
pmol . min-'
. mg protein-'
Z cruzi (4)
Z brucei (3)
0.9 i:0.07
0.6 5 0.05
0.9 2 0.28
L. mexicana (3)
7498 t 1050
5 9 1 5 1 946
116782 472
phate isomerases from various species are exposed to the sulfhydry1 reagent MeS0,-SMe, activity is completely inhibited in
triosephosphate isomerases that have this residue [ll, 221. As
triosephosphate isomerase from 7: cruzi also has this residue, we
determined if this enzyme was also sensitive to MeS0,-SMe. In
parallel, we determined its effect on triosephosphate isomerase
from 7: brucei and L. mexicanu, which also have Cysl4 (Fig. 2).
The three enzymes were inhibited by MeS0,-SMe, but it was
found that the enzyme from 7: cruzi was several times more
sensitive to MeS0,-SMe than the enzymes from 7: brucei and
L. mexicana (Fig. 3). In view of the high level of identity between the three enzymes, it is remarkable that the sensitivity of
the T. brucei and L. mexicana enzymes to MeS0,-SMe is more
than one and two orders of magnitude lower than that of
triosephosphate isomerase from 7: cruzi; this is more noteworthy
between triocephosphate isomerase from 7: cruzi and L. mexicuna, since they have their four cysteine residues in identical
positions.
DISCUSSION
0
10
15 0
200
400
600
800
1000
[Methylmethane thiosulfonate](pM)
Fig. 3. Effect of methylmethane thiosulfonate on the activity of
triosephosphate isomerase from I: cruzi, I: brucei, and L. rnexicana.
The enzymes were incubated for 2 h at a concentration of 5 pg/ml
100 mM triethanolamine, 10 mM EDTA, pH 7.4, and the indicated concentrations of MeS0,-SMe. At this time, the samples were diluted and
their activity assayed with 5 ng 7: cruzi and 7: brucei enzymes; with the
leishmania1 enzyme, 2.5 ng was used.
ciation of the dimer occurred during recording of activity. The
K,, for glyceraldehyde 3-phosphate was determined from linear
Lineweaver-Burk plots i n a substrate range of 0.065 mM to
2.0 mM. The K,,, values for glyceraldehyde 3-phosphate were in
the same range in the three enzymes (Table 2). The K , values
of triosephosphate isomerase from 7: brucei and L. mexicana
that we obtained were 2-3 times higher than those reported
by Kohl et al. [12]. In addition, we observed that the V,,;,, of
triosephosphate isomerase from L. mexicana enzyme was significantly higher than that of the other two enzymes.
The activity of triosephosphate isomerase from 7: cruzi, 7:
hrucei and L. mexicana were determined at different pH and
fixed ionic strength. In these experiments, a higher amount of
sn-glycerol 2-phosphate dehydrogenase was used to circumvent
the possibility that activity measurements were limited by insufficient activity of the trapping enzyme. The three enzymes exhibited a bell-shaped curve with a maximum in the range of
pH 7 to pH 8.5 (data not shown); at pH 6.0 and pH 9.0, the
activities were around 60% and 50% of those observed at
pH 7.5.
Sensitivity of triosephosphate isomerase from I: cruzi, 2: brucei, and L. mexicana to MeS0,-SMe. Cysteine at position 14
is a non-conserved amino acid that exists in triosephosphate
isomerase from some parasites and some plants ; triosephosphate
isomerase from E. coli, Saccharomyces cerevisine, and mammals lack this cysteine. We have found that when triosephos-
Studies of triosephosphate isomerase from several species
have shown that the active site residues, catalytic mechanisms,
and three-dimensional structure have been conserved throughout
evolution. Triosephosphate isomerase from 7: cruzi is not an exception ; it is a homodimer whose amino acid sequence, secondary structure, and kinetics are similar to all the described
triosephosphate isomerases.
As expected, its identity with triosephosphate isomerases
from other trypanosomatids is higher than with triosephosphate
isomerases from other species. Therefore, it was rather surprising to find that the sensitivity to MeS0,-SMe, an agent that
derivatizes accessible cysteine residues to methyl disulfides
[I I], is about 40-fold and 200-fold higher in triosephosphate
isomerase from 7: cruzi than in the enzyme from 7: brucei and
L. mexicana, respectively. In this respect, it is relevant that the
three cysteine residues of triosephosphate isomerase from T.
brucei (14, 39, 126) exist in the enzymes from T cruzi and L.
mexicana, and that the latter two have an additional cysteine at
position 117.
From measurements of the effect of MeS0,-SMe on
triosephosphate isomerases from various species, it has been
shown that Cys39 and Cys126 are inaccessible to MeS0,-SMe
[I 1, 221 ; it was also described that in triosephosphate isomerase
from 7: brucei, derivatization by MeS0,-SMe of Cysl4, a residue that forms part of the dimer interface, triggers structural
alterations that lead to abolition of catalytic activity [ l l ] . In this
respect, it is relevant that Mainfroid et al. [27] reported that
substitution of Met14 of human triosephosphate isomerase by a
glutamine residue led to a decrease of enzyme stability. Therefore, the most logical candidates for inhibition of catalytic activity by MeS0,-SMe in triosephosphate isomerase from 7: cruzi
and L. mexicana are Cysl4 and/or Cysll7. With these considerations, there are several alternatives that could explain the different sensitivity of the three enzymes to MeS0,-SMe action.
If Cysl17 is the site of action of MeS0,-SMe in the 7: cruzi
and L. mexicaiza enzymes, it follows that the difference in sensitivity would be due to a higher accessibility of MeS0,-SMe to
Cysl17 of the T. cruzi enzyme. Moreover, if Cysl4 is the residue
modified by MeS0,-SMe, it would have to be concluded that in
the three enzymes, structural differences in their region of Cysl4
account for differences in MeS0,-SMe accessibility. A priori,
this last alternative would seem to be more feasible, since if
accessibility of MeS0,-SMe to Cysl4 is equal in the L. mexic a m and 7: brucei enzymes, their sensitivity to MeS0,-SMe
Ostoa-Saloma et al. (Eur: J. Biochem. 244)
would be the same, yet inhibition of leishmania1 triosephosphate
isomerase requires significantly higher concentrations. However,
it is also possible that the different response to MeS0,-SMe
could be related to differences in the magnitude of the perturbations induced by modification of a given cysteine. These various
alternatives suggest that the precise cause of the difference in
the three enzymes to MeS0,-SMe action will only be ascertained from knowledge of their three-dimensional structure.
Such studies are being carried out.
Although the cause of the high sensitivity of triosephosphate
isomerase from 7: cruzi to MeS0,-SMe has not been determined, the data indicate that among the triosephosphate isomerases that have been studied [ l l , 221, this enzyme is rather
unique in its sensitivity to MeS0,-SMe. We have proposed [I 11
that non-conserved amino acids represent excellent targets for
achieving species-specific inhibition of enzyme action. In this
context, the content and disposition of the cysteine of the 7:
cruzi enzyme, particularly those at positions 14 and 117, makes
it particularly amenable for selective inhibition. As triosephosphate isomerases from mammals lack these two cysteines, the
present findings may acquire particular relevance.
The authors thank Dr P. A. M. Michels (International Institute of
Cellular and Molecular Pathology, Brussels, Belgium) for the pETTIMl
and the pLmTIM plasmids, Dr Rafael A. Zubillaga (Departamento de
Quimica, Universidad Aut6uoma Metropolitana) for CD spectra and Dr
Guillermo Mendoza (Facultad de Medicina, Universidad Nacional Autbnoma de Mtxico) for gel-filtration experiments of purified triosephosphate isomerase from T cruzi. This work was supported by grants
400346-5-3935N from Consejo Nacional de Ciencia y Tecnologia to
A. G.-P. and IN203495 from Direccicin General de Asuntos del Personal
Acudimico, Universidad Nacional Autbnoma de Mtxico to I. B. and
R. P.-M.
REFERENCES
1. Wang, C. C. (1995) Molecular mechanisms and therapeutic approaches to the treatment of african trypanosomiasis, Annu. Rev.
Pharmacol. Toxicol. 35, 93- 127.
2. Fairlamb, A. H. & Cerami, A. (1992) Metabolism and function of
trypanothione in the kinetoplastid, Annu. Rev. Microbiol. 46,
695-729.
3. Michels, P. A. M. & Hannaert, V. (1994) The evolution of kinetoplastid glycosomes, J. Bioenerg. Biomembl: 26, 213-219.
4. Verlinde, C. L. J., Merrit, E. A., van der Akker, F., Kim, H., Feil,
I., Delboni, L. F., Mande, S. C., Sarfaty, S., Petra, P. H. & Hol,
W. G. J. (1994) Protein crystallography and infectious diseases,
Prorein Sci. 3, 1670-1686.
5. Visser, N. & Opperdoes, F. R. (1980) Glycolysis in Trypanosoma
brucei, Eur J. Biochem. 103, 623-632.
6. Wierenga, R. K., Noble, M. E. M. & Davenport, R. C. (1992) Comparison of the refined crystal structures of liganded and unliganded chicken, yeast, and trypanosoma TPI, J. Mol. Bid. 224,
1115- 1126.
7. Misset, O., Van Beeumen, J., Lambeir, A. M., Van Der Meer, R. &
Opperdoes, F. R. (1987) Glyceraldehyde-phosphate dehydrogenase from Trypanosoma brucei. Comparison of the glycosomal
and cytosolic enzymes, Eur: J. Biochem. 162, 501 -507.
8. Misset, 0. & Opperdoes, F. R. (1987) The phosphoglycerate kinases
from Trypanosoma brucei. A comparison of the glycosomal and
the cytosolic isoenzymes and their sensitivity towards suramin,
E M KJ. Biochem. 162,493-500.
9. Noble, M. E. M., Wierenga, R. W., Lambeir, A. M., Opperdoes, F.
R., Thunnisen, A. M. W. H., Kalk, K. H., Groendijk, M. & Hol,
705
W. G. .I.
(1991) The adaptability of the active site of trypanosomal
triosephosphate isomerase as observed in the crystal structures
of three different complexes, Proreins Strucf. Funct. Genet. 10.
50-69.
10. Cazzulo, J. J. (1994) Intermediate metabolism in Trypano.roma
cruzi, J. Bioenerg. Biomembl: 26, 157- 165.
11. Gbmez-Puyou, A,, Saavedra-Lira, E., Becker, I., Zubillaga, R. A.,
Rojo-Dominguez, A. & Perez-Montfort, R. (1995) Using evolutionary changes to achieve species specific inhibition of enzyme
action-studies with triose phosphate isomerase, Chemistry & Biology 2, 847-855.
12. Kohl, L., Callens, M., Wierenga, R. K., Opperdoes, F, R. & Michels,
P. A. M. (1994) Triosephosphate isomerase of Leishrnuniu mexicana. Cloning and characterization of the gene, overexpression in
Escherichia coli and analysis of the protein, Eul: J. Biochern. 220,
331-338.
13. Alonso, G., Guevara, P. & Ramirez, J. L. (1992) Trypanosomatidae
codon usage and GC distribution, Mem. lnst. Oswaldo Cruz 87,
517 -523.
14. McCarthy-Burke, C., Taylor, Z. A. & Buck, G. A. (1989) Characterization of the spliced leader genes and transcripts in Trypanosoma
cruzi, Gene (Amst.) 82, 177-189.
15. Sambrook, J . , Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning: a laboratory manual, 2nd edn, Cold Spring Harbor Laboratory, Cold Spring Harbor NY.
16. Borchert, T. V., Prett, K., Zeelen, J. P., Callens, M., Noble, M. E.
M., Opperdoes, F. R., Michels, P. A. M. & Wierenga, R. (1993)
Overexpression of trypanosomal triosephoshate isomerase in
Escherichia coli, and characterization of a dimer-interface mutant,
Eur J. Biochem. 211, 703-710.
17. Laemmli, U. K. (1970) Cleavage of structural proteins during the
assembly of the head of bacteriophage T4, Nature 227, 680-685.
18. Bradford, M. M. (1976) A rapid and sensitive method for the quantitation of protein-dye binding, And. Biochem. 72, 248 -254.
19. Pace, N. C., Vajdos, F., Fee, L., Grimsley, G. & Gray, V. (1995)
How to measure and predict the molar absorption coefficient of
a protein, Protein Sci. 4, 2411-2423.
20. Swiukels, B. W., Gibson, W. C., Osinya, K. A., Kramer, R., Veeneman, G. H., Van Boom, J. H. & Borst, P. (1986) Characterization
of the gene for the microbody (glycosomal) triosephosphate isomerase of Trypanosoma brucei, EMBO J. 5, 1291 -1298.
21. Wierenga, R. K., Noble, M. E. M., yriend, G., Nduche, S. & Hol,
W. G. J. (1991) Refined 1.83 A structure of trypanosomal
triosephosphate isomerase crystallized in the presence of 2.4 M
ammonium sulphate. A comparison with the structure of trypanosoma1 triosephosphate isomerase-glycerol-3-phosphate complex,
J. Mol. B i d . 220, 995-1015.
22. Garza-Ramos, G., PCrez-Montfort, R., Rojo-Dominguez, A,, Tuena
de Gbmez-Puyou, M. & Gbmez-Puyou, A. (1996) Species-specific inhibition of homologous enzymes by modification of nonconserved amino acids. The Cys residues of triosephosphate
isomerase, Eul: J. Biochem. 241, 114-120.
23. Kohlhoff, M., Dahm, A. & Hensel, R. (1996) Tetrameric triosephosphate isomerase from hyperthermophilic archaea, FEBS Lett. 3x3,
245-250.
24. Waley, S. G. (1973) Refolding of triosephosphate isomerase, Biochem. J. 135, 165-172.
25. Zabori, S., Rudolph, A. & Jaeuicke, R. (1980) Folding and association of triosephosphate isomerase from rabbit muscle, Z. Natur,fo~-sch.35, 999- 1004.
26. Garza-Ramos, G., Tuena de Gbmez-Puyou, M., Gbmez-Puyou, A. &
Gracy, R. W. (1992) Dimerization and reactivation of triosephosphate isomerase in reverse micelles, Eur J. Biochem. 208, 389 395.
27. Mainfroid, V., Terpstra, P., Beauregard, M., Frere, J. M., Mande, S.
C., Hol, W. G. J., Martial, J. A. & Goraj, K. (1996) Three hTIM
mutants that provide new insights on why TIM is a dimer, J. Mol.
Biol. 257, 441-456.