Connexin 26 Exon 1 Primers Homo sapiens connexin 26 gene, exon 1. ACCESSION AF144321 VERSION AF144321.1 GI:5019930 CX26-Exon1F 5'- GGCGACACCACAAACCTC -3' CX26-Exon1R 5'- CCTCCGTAACTTTCCCAGTC -3' PCR 30 ul Reaction 1X PCR Mix 15 Primer F (10mM) 2 Primer R(10mM) 2 DNA 1 H2O 9 DMSO 1 (Program: T.D. 55-45 HASHEM) Cx26-Exon1 mutation WT 540 base pairs Table by enzyme name Table by Enzyme Name Enzyme name BspMI No. Positions cuts of sites 1 309 Recognition sequence acctgc Enzymatic digestion with BspMI BspMI: 10X Buffers 3: D.D. H2O: PCR product 1.5 l 2.0 l 12.5 l 4.0 l We multiply each portion by the number of samples that we are doing. Add a known heterozygote to the digestion reaction, for control. Tubes are incubated at 37 oC for 8 hours. We load 5 l of digested reaction on a 2% agarose gel. Expected Fragments More info Wildtype Heterozygote Homozygote 540 540 309 309 231 231