BIOL 3301
Genetics
EXAM 4
Thursday, April 26, 5.30-7.00 pm
________________________________________________________________________
Name:
SSN:
________________________________________________________________________
True-false statements (write True or False in front of the statement)
(2 points each).
1. The TATA-box is located at position –10 in the eukaryotic promoter. F
2. The blue-white screen for recombinant plasmids involves the tetracyclin-resistance
gene. F
3. Southern blotting is used for the analysis of total RNA. F
4. A forward mutation is any change back to the wildtype allele. F
5. Cytosine deamination leads to a GC -> AT transition. T
6. The Streisinger model explains the appearance of transversions. F
7. Gain-of-function mutations are dominant over wild-type. T
8. Alkyltransferase is required for direct reversal of photodimers. F
9. A mutation that leads to the overexpression of a normal protein can lead to a dominant
oncogenic mutation. T
10. The normal activity of the RB protein is to negatively regulate the progression from
G1 to S of the cell cycle. T
Multiple choice (circle the correct answer) (2 points each).
1. Which of the following is not involved with initiation of transcription in human genes
?
a. TATA-binding protein
b. RNA polymerase
c. DNA polymerase
d. activators
e. coactivators
2. Enhancers:
a. are position-independent
b. can act at long-distances
c. are bound by transcription factors
d. all of the above
3. The TATA-box is bound by:
a. RNA polymerase II
b. TFIIF
c. TBP
d. TAFs
e. None of the above
4. In a wild-type strain of Drosophila the size of a gene from the start to stop codon is
calculated to be 2000 nucleotide pairs. However, the size of the mRNA molecule
transcribed from this gene is estimated at 1200 nucleotides. The most likely
explanation for this discrepancy in size would invoke the existence of:
a. A new stop codon introduced by mutation
b. A frameshift muation
c. mRNA degradation
d. DNA degradation
e. The presence of one or more introns
5. The recognition sequence for the restriction site EcoRI is:
a. GGATCC
b. GAATTC
c. GGGCCC
d. AGATCT
e. TCTAGA
6. A plasmid vector is cut in one place and a poly(G)tail is added to the 3’ ends. For
effective cloning, the donor DNA should have
a. poly(G) at the 3’ ends
b. poly(G) at the 5’ ends
c. poly(C) at the 3’ ends
d. poly(C) at the5’ ends
e. poly(G) at the 5’ ends and poly(C) at the 3’ends
7. In the dideoxy sequencing method the use of dideoxy adenosine triphosphate stops
nucleotide polymerization
a. opposite A´s in the template strand
b. opposite T´s in the template strand
c. opposite G´s in the template strand
d. opposite C´s in the template strand
e. opposite any base selected randomly in the template strand
8. First strand cDNA is synthesized from mRNA by means of:
a. DNA polymerase
b. RNA polymerase
c. DNA ligase
d. S1 nuclease
e. None of the above
9. To date, the type of enzyme used in the PCR reaction is:
a. DNA polymerase I
b. Klenow fragment
c. a heat-stable DNA polymerase
d. DNA ligase
e. topoisomerase
10. GC->CG mutation is called
a. nonsense
b. missense
c. frameshift
d. transition
e. transversion
11. People who develop the hereditary form of retinoblastoma inherit
a. A single dominant allele causing retinoblastoma
b. A single recessive allele causing retinoblastoma
c. A pair of dominant alleles causing retinoblastoma
d. A pair of recessive alleles causing retinoblastoma
e. A pair of normal (nonretinoblastoma) alleles
12. An individual cell homozygous for a mutant allele of the gene for the human enzyme
phenylalanine hydroxylase contains no detectable activity for that enzyme. The mutation
is best described as:
a. dominant
b. recessive
c. prototrophic
d. gain of function
e. null
13. A mutation results in an abnormally short protein. The mutation was most likely of a
type called:
a. missense
b. nonsense
c. antisense
d. frameshift
e. deletion
14. In E. coli a region of a gene with repeats of the sequence CTGG will be prone to
a. reversion
b. missense mutation
c. nonsense mutation
d. frameshift mutation
e. amber mutation
15. The DNA glycosylase pathway is a specific excision pathway that removes
a. heteroduplex DNA
b. apurinic sites
c. damaged bases
d. damaged deoxyribose
e. photoadducts
Fill in (3 points each).
1. A critical feature of cloning plasmids is the presence of a selectable marker such as
antibiotic (or ampicillin or …) resistance.
2. Northern blotting is a technique in which RNA is fractionated on a gel, and transferred
to a membrane. The RNA attached to the membrane is incubated with a labeled probe,
and an autoradiogram is used to identify any band that matches the probe.
3. Ultraviolet light induces the formation of T-T adducts . As a consequence, specific
pairing is lost. The defect can be repaired by the enzyme photolyase in combination with
white light.
4. Zinc fingers and helix-turn-helix motifs are DNA-binding domains.
5. A targeted gene mutation in mouse is generated via homologous recombination. The
mutant ES cells are selected for neomycin resistance on G418, and on gancyclovir against
the presence of the TK (thymidylate kinase) gene.
Homework (10 points).
1. a. Read the following sequencing gel (27 bp) and write down the sequence from 5’ to
3’ (The positive pole of the electric field used to generate the band pattern is indicated).
A
C
G
T
5' gaattctctagagaattcgcggccgct 3'
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
__
+ pole
b. Write the double-stranded sequence.
gaattctctagagaattcgcggccgct
cttaagagatctcttaagcgccggcga
c. Determine if there are any of the following restriction sites in the sequence (indicate
Yes or No behind the restriction site sequence and also indicate the number of sites you
have encountered):
RsaI: GTAC
EcoRI: GAATTC
NotI: GCGGCCGC
0 sites
2 sites
1 site
d. How many fragments do you obtain if the DNA is circular and you cut with:
RsaI:
EcoRI:
NotI:
0 fragments (you keep the circular plasmid)
2 fragments
1 fragment (i.e. linearized plasmid)
Open question (25 points).
Maximum of 2 pages !
Transcription in eukaryotes.
a. List the eukaryotic RNA polymerases and indicate which RNA they synthesize !
b. Describe and discuss two DNA-binding domains !
c. Describe and discuss all types of eukaryotic cis-regulatory sequences !
d. Describe transcription initiation and indicate the key difference with prokaryotic
transcription inititiation !
e. Describe the processing of mRNA and give for each step the appropriate details !
NOTE: SPECIFIC INSTRUCTIONS WILL FOLLOW CONCERNING THE OPEN
QUESTION CATEGORY.