Li, HaoQi
Development and Optimization of a Sensitive and Specific quantitative PCR Assay for
Borrelia lonestari
HaoQi (Esther) Li
Naval Medical Research Center
Infectious Diseases Department
Rickettsial Diseases Department
Mentors: Dr. Allen Richards, Mrs. Ju Jiang
Teacher Advisors: Dr. Barbara Wood, Mr. Fred Lampazzi
Li, HaoQi
Abstract
Borrelia lonestari is a spiral-shaped bacterium recently discovered in the lone star tick,
Amblyomma americanum, located throughout the southeastern United States. This spirochete is
suspected of inducing symptoms in humans commonly associated with Lyme disease, such as
rash, fever, and fatigue. Due to these common symptoms, the diagnosis of the B. lonestari
infection becomes very challenging. Previous methods to detect B. lonestari included
polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP)
analysis. However advances in biotechnology have introduced quantitative real-time PCR
(qPCR) as a more accurate and efficient detection procedure. This study therefore reports the
development of a qPCR assay that is highly sensitive and specific for detecting B. lonestari.
Using the programs ClustalW and GeneDoc, a unique region between 594–719bp in the
B. lonestari flagellin gene was identified, allowing primers and a molecular Beacon probe to be
designed. A plasmid containing the target B. lonestari flagellin gene sequence was constructed
with a TOPO XL PCR Cloning Kit.
After calculating the copies of the cloned plasmid, a serial dilution (1010-100 copies/uL)
was made for a standard curve to quantitatively demonstrate the sensitivity of the assay. By
using various concentrations of the primers, the probe, MgCl2, and by changing the annealing
temperature, an optimal condition was established. The limit of detection of the assay was
determined to be one copy/uL. Seven related Borrelia species. and twenty-three non-related
bacterial genomic DNA were used to verify the specificity. The assay only responded positively
to B. lonestari, thus demonstrating that the assay of the study is indeed specific. Therefore, the
newly developed qPCR assay was demonstrated to be a sensitive and specific tool for detecting
B. lonestari.
2
Li, HaoQi
Introduction
Bacteria Borrelia lonestari belong to the same genus as Borrelia burgdorferi, the
causative agent of the potentially fatal Lyme disease. B. lonestari induces Southern TickAssociated Rash Illness (STARI) resembling symptoms of Lyme disease that are similar to those
of many common illnesses (Moore, Varela, Yabsley, Davidson, & Little, 2003). Found
throughout the southern and southeastern United States, STARI includes rash, fever, and
migraines (Burkot, Mullen, Anderson, Schneider, Happ, & Zeidner, 2001). The commonplace
symptoms of STARI in nature, along with the absence of a current method of diagnosis, often
make diagnosing the STARI disease extremely difficult. With the advancement of new
technology, this study successfully developed a sensitive and specific molecular assay for B.
lonestari.
Previous research has established that B. lonestari is vectored by the Lone Star tick
Amblyomma americanum. Burkot, Mullen, Anderson, Schneider, Happ, & Zeidner (2001)
conducted research using traditional polymerase chain reaction (PCR) to detect B. lonestari
bacteria in A. americanum and A. maculatum ticks from Alabama. With PCR for the flagellin
and 16s rRNA, two positive B. lonetsari samples were both found in A. americanum ticks.
Not only does B. lonestari infect humans and ticks, they are also found in other mammals
such as the white-tailed deer (Moore, Varela, Yabsley, Davidson, & Little, 2003). While
studying the presence of B. lonetsari in white-tailed deer as “the first evidence of” the bacteria in
a vertebrate other than humans, Moore, Varela, Yabsley, Davidson, & Little (2003) developed a
B. lonestari PCR assay to test the samples. However in this study, a more efficient and accurate
assay was developed, utilizing the newest technology – quantitative realtime Polymerase Chain
Reaction (qPCR).
3
Li, HaoQi
In order to study the flagellin gene sequences of various Borrelia species, Fukunaga,
Okada, Nakao, Konishi, & Sato (1996) performed phylogenetic analyses to map out the Borrelia
taxonomy and to distinguish the Lyme disease agents from related species througuh PCRRestriction Fragment Length Polymorphism (PCR-RFLP) with 580 bp fragments. The
researchers concluded that B. lonestari bacteria are also related to the New World tick-borne
relapsing fever Borreliae. The difference in gene sequences allows an assay to be produced
specifically to a certain Borrelia species, and in this experiment, an assay specific to B. lonestari
was located.
In this study, qPCR serves the crucial purpose of data collection by detecting the amount
of B. lonetsari DNA in samples through the fluorescence emitted by the newly designed assay.
This method is based on the direct proportional relationship between the amount of DNA
amplification and the intensity of the detected fluorescence. Thus, in the presence of target
DNA, the fluorescence increases logarithmically until it exceeds the traditional threshold level of
30 fluorescence units, where background fluorescence is eliminated (Jiang, Temenak, &
Richards, 2003). The number of cycles in which the fluorescence of the sample crosses the
threshold is called the Cycle of Threshold (Ct). Samples without the target DNA would not have
high logarithmic curves and should not cross the threshold level.
Fluorescence is activated by the fluorescent dye FAM Reporter on the molecular Beacon
probe during the DNA polymerase elongation process. The uniqueness of the Beacon probe is
that before the DNA polymerase elongation, the Beacon probe is curled up in a hairpin structure
made by the complimentary sequences at both ends of the targeted probe; this structure makes
the Beacon probe more effective than the linear TaqMan probe. On the 5’-end of the Beacon
probe is the FAM Reporter that naturally fluoresces. However, before elongation, the FAM
4
Li, HaoQi
Reporter is in the vicinity of the dye quencher (Black Hole Quencher was used in this study) on
the 3’-end of the probe, thus its light is extinguished. Just before elongation, the complimentary
target gene attracts the Beacon probe and breaks the complimentary handle of the molecular
hairpin as the probe anneals to the template DNA. Since the hairpin has been stretched out, the
quencher can no longer cover the fluorescence from the reporter, the FAM reporter is activated.
This activation is only possible in the presence of the targeted template DNA (Jiang, Temenak,
& Richards, 2003).
The quantitative real-time Polymerase Chain Reaction is a tool that has shown to be both
an efficient and accurate method of detecting the presence of targeted bacterial DNA by
measuring the intensity of fluorescence from the activated probe. Utilizing this tool, Jiang, Chan,
Temenak, Dasch, Ching, & Richards (2004), in a study to develop a sensitive and specific qPCR
assay for Orientia tsutsugamushi, stated the four clear advantages of qPCR: “1) faster results, 2)
potential for automation for high throughput, 3) multiplexing, and 4) quantitative information
useful for clinical monitoring of appropriate response to treatment and prognosis, and for
experimental studies.”
In another study by Jiang, Temenak, & Richards (2003) to develop qPCR assays to detect
R. prowazekii and B. recurrentis, two assays were tested in one reaction tube, in order to make a
more efficient diagnosis. Even though both R. prowazekii and B. recurrentis could be
recognized in one tube, the B. recurrentis assay detected the extraneous gene B. duttoni at
normal annealing temperature. However, this extraneous strand is absent when the annealing
temperature was raised. In this study, since there was only one bacterium of interest and the B.
lonestari assay reactions were not mixed with other assays, it was not necessary to add another
5
Li, HaoQi
probe, and the accuracy of the results were higher due to less cross-contamination between the
two assays.
This study used a simplified version of the methods described in Jiang’s research in 2004.
Since qPCR testing was sufficient and accurate enough with the four advantages for data
collecting, the study did not utilize PCR-RFLP testing as Fukunaga, et. al., did in 1996). In
Jiang’s research (2004), the sensitivity of the specific O. tsutsugamushi assay was consistent in
that 3 – 10 copies of DNA target sequence per microliter were detected.
The goal of this study was to develop a qPCR assay that is sensitive to 10copies/L and
specific for B. lonestari. To do so, genetic sequences unique to B. lonestari were first identified
and then synthesized. The designed assay incorporated both the Beacon probe and the primers.
B. lonestari-specific primers on either end of the Beacon probe aided the attachment of DNA
polymerases during the start of elongation. In order to test the sensitivity, the cloned flagellin
plasmid DNA was tested using the designed assay of different concentrations. Plotting the Cycle
of Threshold (Ct) values of each against their respective concentrations, a standard curve was
drawn, showing the sensitivity of the assay. If the assay was specific as proposed, it would only
detect B. lonestari flagellin samples and no other kinds of DNA. In this study, because thirty
non-B. lonestari DNA were tested to demonstrate the assay specificity, none of the thirty DNA
samples were expected to cross the threshold with positive Ct values.
Materials and Methods
Assay primers and probe. The core of this project was to search for the most effective assay of
B. lonestari. The assay, which included the primers and probe, was first picked out by analyzing
the most unique sequence in the B. lonestari flagellin gene. The gene sequence (accession code
6
Li, HaoQi
AY850063) was obtained from NCBI GenBank (NCBI; Bethesda, MD). NCBI’s Basic Local
Alignment Search Tool (BLAST) was used to identify 34 highly related sequences. The
sequences were aligned using ClustalW (EBI; Cambridge, UK) and the variations of the
sequences were colored-coded using GeneDoc (PSC; Pittsburgh, PA). Regions of uniqueness
were identified, and it was found that an 18bp region between 667-668bp was deleted only in the
B. lonestari flagellin gene sequence (Table 1. The Deleted Region of the Assay Probe). In
addition to this deletion, three other unique base pairs and two semi-unique base pairs were
present in the primer. Targeting around this area, the software program Beacon Designer 4.0
(Premier Biosoft; Palo Alto, CA) was used to determine the best combination of primers and
probe for qPCR analysis. The output primers also covered multiple unique base pairs: three
unique and two semi-unique base pairs in the forward primer, two unique and three semi-unique
base pairs in the reverse primer. The Beacon probe created for this study has a FAM Reporter on
the 5’ end and a Black Hole Quencher 1 (BHQ-1) on the 3’ end. Oligonucleotides of primers and
probe (Table 2. Borrelia lonestari Primers and Probe Sequences Designed. Figure 1. Developed
Primers and Probes on the 990bp B. lonestari Flagellin Gene) were synthesized by Sigma
Genosys (The Woodlands, TX).
Cloning of the B. lonestari flagellin gene. The gene was cloned to make enough copies of the
gene for future optimization tests. The entire B. lonestari flagellin gene was cloned with bacteria
rather than alternative methods, such as PCR, because the clones were stored for two weeks, and
bacteria provided better environments for the clones. Primers for the full gene sequence of B.
lonestari flagellin were designed with Beacon Designer 4.0 by choosing common regions after
alignment of similar sequences and were synthesized by MWG (High Point, NC) (Table 2.
Borrelia lonestari Primers and Probe Sequences Designed).
7
Li, HaoQi
Using this pair of primers, a 960 bp amplicon was amplified by nested PCR and verified
by agarose gel electrophoresis. QIAquick PCR Purification Kit (Qiagen; Valencia, CA) was
used to purify the PCR product according to the manufacturer’s instructions. The purified PCR
product was then cloned using TOPO XL PCR Cloning Kit (Invitrogen; Carlsbad, CA) as per the
manufacturer’s instructions. After lysing the resulting bacterial cells via boiling for 10 minutes
of 10μL culture, both qPCR and conventional PCR were employed to identify the positive
clones.
Following the manufacturer’s instructions, the QIAprep Spin Miniprep Kit (Qiagen;
Valencia, CA) was used to isolate the plasmid from two of the five positive bacterial cultures.
The concentrations of those two plasmid were measured using the Eppendorf BioPhotometer
(Eppendorf; Westbury, NY).
Optimization tests. The purpose of optimization tests was to yield the best results by balancing
the right concentrations of qPCR reactants. Optimization tests were performed with qPCR for
conditions of the assay primers (range 0.1μM – 0.7μM), assay probe (range 0.2μM – 0.7μM),
MgCl2 (ranges 3mM – 7mM and 3.5mM – 7.5mM), and annealing temperature (range 56˚C 66˚C). For each test, 101 copies/μl and 102 copies/μl of DNA templates were used. Optimal
conditions were determined based on the lowest Cycle of Threshold (CT) values of logarithmic
fluorescence using the Smart Cycler (Cepheid; Sunnyvale, CA) (Table 3. Optimal Final
Conditions for qPCR). To ensure minimal contamination, a DNA and RNA-free clean room was
used to prepare the qPCR master mixes. Three negative controls were prepared with Milli-Q
water; two negative controls were prepared in the biosafety cabinet, not in the clean room; and
the third negative control was prepared in the clean room. Thermal cycling parameters included
8
Li, HaoQi
a pre-hold of 50˚C for 2 minutes, a hold at 95˚C for 2 minutes, followed by 50 two step cycles of
94˚C/5 seconds and 60˚C/30 seconds.
Assay sensitivity and specificity. In order to verify the efficacy of the created assay, two tests
were run: one for sensitivity (i.e. the minimum level that can still be detected) and the other for
specificity (i.e. the accuracy of the assay). To determine the assay sensitivity, the plasmid with
target B. lonestari flagellin gene was chosen for use in standard dilutions based on its
concentration (~6.93x1010 copies/μL). Serial ten-fold and half-log dilutions of the plasmid were
made with Tris EDTA (TE) buffer. The specificity of the assay was tested using seven related
Borrelia species, and twenty-three non-related bacterial genomic DNA (Table 4. List of Bacteria
Sequences Tested for B. lonestari Assay Specificity).
Results and Discussion
Assay primers and probe. The synthesized primers and probe were tested on two unknown
concentrations of B. lonestari samples, and the results for both were positive, verifying the
ability of the assay to detect B. lonestari (Figure 2. Initial Testing of Assay Primers and Probe).
Cloning of the B. lonestari flagellin gene. All five bacteria cultures obtained from DNA
cloning of B. lonestari flagellin gene demonstrated positive results when assayed by B. lonestari
qPCR (Figure 3. Positive Results for All Five Transformant Bacteria Colonies) and PCR,
indicating that the plasmid transformation had been successful.
Assay sensitivity. When serial dilutions of the plasmid range from 107 to 100 copies/μL were
tested eight times, assay sensitivity demonstrated the ability to detect 100 copies/μL, and the
assay consistently detected 101 copies/μL (Ct value = 37.88). The R2 value of the standard curve
obtained was 0.986 (Figure 4. Standard Curve, FAM Log, and FAM Ct for Assay Sensitivity).
9
Li, HaoQi
Assay specificity. All seven Borrelia related and twenty-three unrelated genomic DNA samples
were shown to be negative (Table 4. List of Bacteria Sequences Tested for B. lonestari Assay
Specificity), which meant that the assay was indeed specific to B. lonestari.
Conclusion
In this experiment, primers and probe were developed to create a specific and sensitive B.
lonestari qPCR assay. Through qPCR, the sensitivity threshold of the assay was shown to be 1
copy/μL, and the assay consistently detected 10copies/L of B. lonestari target DNA. Testing
against 30 related and unrelated bacterial sequences producing negative results, verifying the
specificity of assay.
Future research should include testing of clinical samples by B. lonestari qPCR in order
to further support conclusions made in this study. Utilizing this qPCR assay should reduce
diagnosis time and increase diagnosis accuracy of B. lonestari infection in STARI patients,
expediting proper treatment process.
10
Li, HaoQi
References
Burkot, T. R., Mullen, G. R., Anderson, R., Schneider, B. S., Happ, C. M., & Zeidner, N. S.
(2001, May/June). Borrelia lonestari DNA in adult Amlyomma americanum ticks,
Alabama. Emerging Infectious Diseases, 7(3), 471-473.
Fukunaga, M., Okada, K., Nakao, M., Konishi, T., & Sato, Y. (1996, October). Phylogenetic
analysis of Borrelia species based on flagellin gene sequences and its application for
molecular typing of lyme disease Borreliae. International Journal of Systematic
Bacteriology, 46(4), 898-905.
Jiang, J., Chan, T.-C., Temenak, J. J., Dasch, G. A., Ching, W.-M., & Richards, A. L. (2004).
Development of a Quantitative Real-Time Polymerase Chain Reaction assay specific for
Orientia tsutsugamushi. American Society of Tropical Medicine and Hygiene, 70(4), 351356.
Jiang, J., Temenak, J. J., & Richards, A. L. (2003). Real-time PCR duplex assay for Rickettsia
prowazekii and Borrelia recurrentis. In K. E. Hechemy, T. Avsic-Zupanc, J. E. Childs, &
D. A. Raoult (Eds.), Rickettsiology present and future directions (pp. 302-310). New
York: New York Academy of Sciences. From Rickettsiology Present and Future
Directions.
Moore IV, V. A., Varela, A. S., Yabsley, M. J., Davidson, W. R., & Little, S. E. (2003, January).
Detection of Borrelia lonestari, putative agent of southern tick-associated rash illness, in
white-tailed deer (Odocoileus virginianus) from the southeastern United States. Journal
of Clinical Microbiology, 41(1), 424-427.
11
Li, HaoQi
Acknowledgements
Dr. Allen L. Richards, Navy Medical Research Center
Dr. Ju Jiang, Navy Medical Research Center
Dr. Wood, Research Advisor, TJHSST
Mr. Pearce, Mentorship Director, TJHSST
Science & Engineering Apprentice Program, NMRC
TJHSST Mentorship Program
12
Li, HaoQi
Appendix
Table 1. The Deleted Region of the Assay Probe
Gene
Sequence (5’ – 3’) starting from 655 base pair
Borrelia species
GCAGCTCCAGCTCCAGCAGCAGCTCCAGCTCAAGGTGGAGTTAA
Borrelia lonestari CCAGCTCCAGCTC
AAGGTGGGATTAG
Table 2. Borrelia lonestari Primers and Probe Sequences Designed.
Oligonucleotide Name
Purpose
Sequence (5’ – 3’)
B. lon-655FAM
Assay Beacon
[FAM]-CGC GAC CAG CTC CAG CTC AAG
probe
GTG GGA TTA GTC GCG-[BHQ1]*
B. lon-594F
Assay forward
TGG TGG AGA AGG TGT TCA AG
primer
B. lon-719R
Assay reverse
GCA TTA GCA TCA ATA GCA GTT G
primer
B. lon-11F
Full-gene forward ATC ATA ATA CGT CAG CTA TAA ATG C
primer
B. lon-970R
Full-gene reverse
ATA CAT ATT GAG GCA CTT GAT TTG
primer
* The bolded FAM base pairs are complimentary sequences in the Beacon hairpin structure.
Table 3. Optimal Final Conditions for qPCR
Reagent
Volume or Concentration
Volume Template
1μl
Volume Reaction
25μl
B. lon 594 Forward Primer
0.4μM
B. lon 719 Reverse Primer
0.4μM
FAM Probe
0.3μM
DNTP (contained in supermix)
0.2mM
MgCl2 (3mM also in supermix)
4.5mM
Platinum Taq (contained in supermix)
0.75 U
The 2X Super Mix-UDG with no ROX and H2O were used but optimization was not needed
13
Li, HaoQi
Table 4. List of Bacteria Sequences Tested for B. lonestari Assay Specificity
No.
Borrelia Bacterial DNA
Non-Borrelia Bacterial DNA
1B. recurrentis
R. prowazekii Breinl
2B. coriaceae*
R. typhi W
3B. burgdorferi
R. canada
4B. afzelii
R. rickettsii VR 891
5B. hermsii
R. conorii
6B. garinii
R. parkeri
7B. duttoni
R. montana
8
R. slovaca
9
R. sibirica
10
R. japanica
11
R. akari
12
Escherichia coli
13
Proteus mirabilis OXK
14
Salmonella enterica
15
Legionella pneumophila
16
Francisella persica
17
Bartonella quintana
18
Bartonella vinsonii
19
Neorickettsia sennetsu
20
Neorickettsia riticii
21
Orientia tsutsugamushi
22
Staphylococcus aureus
23
Corynebacterium sp
All tested negative
*B. coriaceae showed a weak reaction at the annealing temperature of 60˚C, however at 66˚C the
results were negative.
14
Li, HaoQi
Figure 1. Developed Primers and Probes on the 990bp B. lonestari Flagellin Gene
5'
3'
11F Primer
594F Primer 655 FAM 719R Primer 970R Primer
Figure 2. Initial Testing of Assay Primers and Probe
Figure 3. Positive Results for All Five Transformant Bacteria Colonies .
B1, B4, and B5 showed a decrease in fluorescence after crossing over the threshold, caused by
over-abundance in amplification.
15
Li, HaoQi
Figure 4. Standard Curve, FAM Log, and FAM Ct for Assay Sensitivity
Sample ID are exponents of 10
16