1. Genotyping methods:
DNA was isolated from leucocytes using the GenElute Blood Genomic DNA Kit (SigmaAldrich; Oakville). Single Nucleotide Polymorphisms (SNP) associated with the drug
metabolizing enzyme CYP3A5 and the drug transporters P-gp (ABCB1 3435 C→T) and BCRP
(ABCG2 421 C→A) were determined by PCR using genomic DNA.
For CYP3A5*3 (rs776746), PCR reactions were performed in a total volume of 25 µL with
100 ng of genomic DNA, 0.8µM of each primer (sense 5’-CATGACTTAGTAGACAGATGA
and antisense 5’-GGTCCAAACAGGGAAGAAATA), 0.2µM of dNTP, 1.5mM of MgCl2, 0.25
µL of 0,1% gelatin, 1X PCR buffer and 1 µl of Taq polymerase (Invitrogen, Carlsbad, CA). The
cycling conditions were as follows: an initial denaturation step at 95°C for 7 minutes followed by
amplification for 35 cycles with denaturation at 95°C for 60s, annealing at 55°C for 60s and
extension at 72°C for 60s with a final extension step at 72°C for 7 minutes. The PCR fragments
(293bp) were digested with 5 IU of Ssp I for 16 hours at 37°C. PCR fragments were performed
with 2720 Thermal Cycler (ABS, Burlington). Digested products were size-separated by
electrophoresis on a 4% agarose gel. Genotypes were determined as follows: wild-type alleles
were digested into 3 bands of 148, 125 and 20 bp, while mutant alleles were digested into 2 bands
of 168 and 125 bp.
Genotyping for ABCB1 3435 C→T (rs1045642) was performed based on previously
published work where a 248 bp fragment is amplified by PCR.(23) PCR reactions were
performed in a total volume of 25 µL with 100 ng of genomic DNA, 0.8µM of each primers
(sense
5’-GATCTGTGAACTCTTGTTTTCA
and
antisense
5’-
GAAGAGAGACTTACATTAGGC), 0.2µM of dNTP, 1.5mM of MgCl2, 1X PCR buffer and 1
µl of Taq polymerase (Invitrogen). The cycling conditions were as follows: an initial denaturation
step at 94°C for 2 minutes followed by amplification for 35 cycles with denaturation at 94°C for
30s, annealing at 62°C for 30s and extension at 72°C for 60s with a final extension step at 72°C
for 10 minutes. The PCR fragments were then digested overnight with 1IU of MboI and were
separated on a 4% agarose gel. MboI digestion of wildtype DNA yields fragments of 172 bp, 60
bp and 16 bp. The ABCB1 3435 C→T mutation destroyed one restriction site and a digestion with
MboI yielded two fragments: 238 bp and 16 bp.
Genotyping of the single nucleotide polymorphism (SNP) at ABCG2 _421_C>A (rs2231142)
was performed using TaqMan SNP Genotyping Assays (Applied Biosystems (ABS), Burlington).
In brief, 3 to 20 ng of genomic DNA was amplified using Taqman Universal PCR Master Mix
(ABS) and a specific probe (Assay ID: C_15854163_70). PCR conditions were 95ºC for 10 min,
followed by 50 cycles of 92ºC for 15 s, 60ºC for 90 s. PCR and genotype analysis was performed
with real-time rotary PCR analyser Rotor-Gene 6000 and Rotor-Gene 6000 software (Corbett
research, Montlake).
2. Determination of plasma inflammatory mediators levels:
In patients with either only iatrogenic coma (n=12), only delirium (n=7), or neither at any
time in their stay (n=11) plasma levels of TNF-α, IL-1β, IL-17, IL-8, MCP-1, IL1ra, IL-10, MIP1β and IL-6 were measured in samples drawn within 24 hours of that clinical state. The level of
these mediators was determined using a BioPlex kit (Bio-Rad; California, USA), according to
manufacturer’s specifications. The plate was read on a Luminex 200 apparatus (Applied
Cytometry Systems, UK). The acquisition and analysis were performed with the StarStation V.
2.3 software (Applied Cytometry Systems).
3. Liquid chromatography and mass spectrometry (LC-MS/MS) Analysis of MDZ and FEN
in Human Plasma
Reagents
MDZ, FEN, 2H4-MDZ and 2H5-FEN were purchased from Cerilliant (Round Rock, TX,
USA). Drug free human plasma containing EDTA was purchased from Bioreclamation
(Westbury, NY, USA). Acetonitrile and formic acid were obtained from EMD Chemicals
(Gibbstown, NJ, USA). Other chemicals, including methanol, were purchased from Fisher
Scientific (Fair Lawn, NJ, USA). Water was deoinized using a Nanopure Barnstead/Thermolyne
system (Dubuque, IA, USA).
FEN and MDZ analysis
The concentrations of FEN and MDZ in plasma were determined by Liquid chromatography
and mass spectrometry (LC-MS/MS) using a validated method developed in our laboratory.
Detailed and specific methods relative to extraction and analytical procedures, validation, and
sampling are provided below.
4.2 Standard solutions
A series of standard working solutions of MDZ and FEN were obtained by diluting the
standard stock solutions with methanol. Calibration standards were prepared by fortifying blank
human plasma with the standard working solutions at 2% (v/v) to enable concentrations spanning
the following analytical ranges 0.5 – 2 000 ng/mL of MDZ and 100 – 50 000 pg/mL of FEN. The
internal standard working solution was prepared at 1.0 µg/mL of 2H4-MDZ and 2H5-FEN in
methanol.
4.3 Instrumentation
The HPLC system consisted of a Shimadzu Prominence series UFLC pump and auto sampler
(Kyoto, Japan). The MS system used was a Thermo TSQ Quantum Ultra (San Jose, CA, USA).
Data were acquired on a Dell computer (Round Rock, TX, USA). Data acquisition and analysis
were performed using Xcalibur 2.0.7 (San Jose, CA, USA). Calibration curves were calculated
from the equation y = ax + b, as determined by weighted (1/x) linear regression of the calibration
line constructed from the peak-area ratios of the drug to the internal standard.
An isocratic mobile phase was used with a Phenomenex Luna PFP (2) column (150 x 3 mm
I.D., 3 m) operating at 40°C. The mobile phase conditions consisted of acetonitrile and 0.2 %
(v/v) formic acid in water at a ratio of 35:65, respectively. The flow rate was fixed at 400 µL/min.
MDZ and 2H4-MDZ eluted at 4.1 min, whereas FEN and 2H5-FEN eluted at 4.5 min. Ten
microliters of the sample was injected; total run time was set at 6.0 min.
The mass spectrometer was interfaced with the UPLC system using a pneumatic assisted
heated electrospray ion source. MS detection was performed in positive ion mode, using selected
reaction monitoring (SRM). The precursor-ion reaction for MDZ, 2H4-MDZ, FEN and 2H5-FEN
were set at 326.2→209.0, 330.2→294.8, 337.2→188.1 and 342.2→188.1, respectively. In order
to optimize the MS/MS parameters, standard solutions of MDZ and FEN were infused into the
mass spectrometer. The following parameters were obtained: nitrogen was used for the sheath and
auxiliary gases and was set at 35 and 20 arbitrary units, respectively. The HESI electrode was set
to 3000 V. The capillary temperature was set at 350°C and its voltage offset was 35 V. Argon
was used as collision gas at a pressure of 1.5 mTorr. The collision energy was set at 34 eV for
MDZ and 2H4-MDZ and at 22 eV for FEN and 2H5-FEN . Scan width for SRM was 0.05 m/z and
scan time was 0.2s. Peak width of Q1 and Q3 were both set at 0.7 FWHM.
4.4 Sample preparation and instrumentation
Using a protein precipitation as sample preparation technique, MDZ and FEN were
extracted from plasma. 500 microliters of standard solution was added to 100 L of the sample.
The sample was vortexed for 5 seconds and left to stand for a period of 10 minutes, then
centrifuged at 16100 g for 10 minutes. The supernatant was transferred into a clean 16 x 10 mm
borosilicate tube and evaporated to dryness at 50°C under a gentle stream of nitrogen. The dried
extract was resuspended with 100 µL of mobile phase and transferred to an injection vial for
analysis.
We used a linear method, using a linear regression weighted 1/x 2 analysis, r, r2 ≥ 0.99
3 and 0.995 for MDZ and FEN, respectively (n=9). The intra- and inter-day precision of
MDZ was less than 3.4. % and 7.2%, respectively. For FEN the intra- and inter-day
precision was less than 6.5% and 7.7%. The accuracy of the intra- and inter-day
validations was 99.1 – 105.3% and 97.7 – 102.0% for MDZ and 101 – 108.8% and 99.0 –
107.9% for FEN. The extraction recoveries at low and high concentrations for MDZ were
73.6 % and 78.7% and for FEN were 74.7 and 79.6%, respectively (n =6). MDZ and FEN
were stable in plasma at ambient temperature for up to 24 hours. With respect to the run
time stability of processed samples, no significant loss in response was observed at 15°C,
and no degradation was observed after four freeze and thaw cycles. The method met all
requirements of specificity, sensitivity, linearity, precision, accuracy and stability
generally accepted in bioanalytical chemistry (FDA Guidance, US Department of Health
and Human Services, Food and Drug Administration, Center for Drug Evaluation and
Research (CDER) and Center for Veterinary Medicine (CVM), (2001) Guidance for
Industry. Bioanalytical Method Validation. Available at: www.fda.gov/cder/guidance.).