DNA SEQUENCING AND BIOINFORMATICS
Exercise Objective:
In this experiment, DNA sequences will be submitted to Data bank searches using the internet to
identify genes and gene products. The sequences that will be imputed will come from either
autoradiographic sequence analysis or from automated sequence analysis.
BACKGROUND INFORMATION
Bioinformatics
Bioinformatics is a new field of biotechnology that is involved in the storage and manipulation of
DNA sequence information from which one can obtain useful biological information. Almost routinely,
data from DNA sequence analysis is submitted to Data bank searches using the internet to identify
genes and gene products. Data from DNA sequencing is of limited use unless it can be converted to
biologically useful information. Bioinformatics therefore is a critical component of DNA sequencing. It
evolved from the merging of computer technology and biotechnology. The widespread use of the internet
has made it possible to easily retrieve information from the various genome projects. In a typical
analysis, as a first step, after obtaining DNA sequencing data a molecular biologist will search for DNA
sequence similarities using various data banks on the internet. Such a search may lead to the
identification of the sequenced DNA or identify its relationship to related genes. Protein coding regions
can also be easily identified by the nucleotide composition. Likewise, noncoding regions can be identified
by interruptions due to stop codons. The functional significance of new DNA sequences will continue to
increase and become more important as sequence information continues to be added and more powerful
search engines become readily accessible. Due to the cumulative efforts of various research groups
around the world, a draft of the Human Genome sequence was completed in 2003. At this time,
continuing research is enhancing our understanding of the complete Human Genome sequence.
Advances in DNA sequencing and bioinformatics allow some of the information from the Human Genome
Project to be used as a clinical diagnostic tool. It should be noted that other genomes such as that for
Saccharomyces cerevisae and Helicobacter pylori have also been completed.
DNA strand termination sequencing:
This method of sequencing utilizes our knowledge about the replication of DNA and the
mechanisms responsible for it. When DNA is synthesized, the polymerase enzyme adds nucleotides
(building blocks of DNA) into the growing stand by connecting the 5’ phosphate group of the new
nucleotide to the 3’ hydroxyl (-OH) on the previous sugar (Figure 1). If the 3’-OH is removed as in
dideoxynucleotides, there is no place for the next nucleotide to attach, thereby terminating DNA
elongation in that strand.
For sequence analysis, four separate enzymatic reactions are performed, one for each of the four
nucleotides. Each reaction contains the DNA Polymerase, the single-stranded DNA template to be
sequenced to which a synthetic DNA primer has been hybridized, the four deoxyribonucleotide
triphosphates (dATP, dGTP, dCTP, dTTP), often an radiolabeled deoxynucleotide triphosphate, such as
32
P or 35S dATP, and the appropriate DNA sequencing buffer. With the exception of the radiolabeled
nucleotide, this is all that is required to duplicate DNA in the cell. The reactions contain the
dideoxytriphosphate reactions as follows: the “G” reaction contains dideoxyGTP, the “C” reaction
dideoxyCTP, the “A” reaction dideoxyATP, and the “T” reaction dideoxyTTP. The small amounts of
dideoxynucleotide concentrations are carefully adjusted so they are randomly and infrequently
incorporated into the growing DNA strand. Once a dideoxynucleotide is incorporated into a single strand,
DNA synthesis is terminated since the modified nucleotide does not have a free 3’ hydroxyl group on the
ribose sugar which is the site of the addition of the next nucleotide in the DNA chain.
The incorporation of the dideoxynucleotide allows the generation of the nested DNA fragments
and makes possible to determine the position of the various nucleotides in DNA. A particular reaction will
contain millions of growing DNA strands, and therefore “nested sets” of fragments will be obtained. Each
fragment is terminated at a different position corresponding to the random incorporation of the
dideoxynucleotide. As an example, in “nested sets” of fragments produced for a hypothetical sequence in
the “G” reaction contains dATP, dCTP, dGTP, dTTP, DNA polymerase, DNA sequencing buffer, 32Plabeled dATP and dideoxyGTP. (Figure 2) As can be seen, ddGTP (dideoxyGTP) incorporation randomly
and infrequently will produce a “nested set” of fragments which terminate with a ddGTP. The “nested set”
is complimentary to the region being sequenced. Similar “nested sets” are produced in the separate “A”,
“T”, and “C” reactions. For example, the “A” “nested set” would terminate with a ddATP.
This 3’-OH
is removed
in the
dideoxynucleotide
Figure 1 – DNA strand elongation
Figure 2. Example of the “G” lane in DNA termination sequencing.
It should be readily apparent that together the “G, A, T, C” “nested sets” contain radioactive 32Plabeled fragments ranging in size successively from 19 to 31 nucleotides for the hypothetical sequence in
Figure 3.
As shown in the figure, the “G” reaction contains fragments of 21, 23, 25, 29 and 31 nucleotides
in length. Seventeen of these nucleotides are contained in the synthetic DNA sequencing primer. The
rest are added during de novo DNA synthesis. The products from the G, A, T, and C reactions are
separated by a vertical DNA polyacrylamide gel. Well # 1 contains the “G” reaction; well # 2 the “A”
reaction; well # 3 the “T” reaction; and well # 4 the “C” reaction. It is important to note that the strand
being sequenced will have the opposite Watson/Crick base. As an example, the G reaction in tube one
will identify the C nucleotide in the template being sequenced. After electrophoretic separation is
complete, autoradiography is performed. The polyacrylamide gel is placed into direct contact with a sheet
of x-ray film. Since the DNA fragments are labeled with 32P, their position can be detected by a dark
exposure band on the sheet of x-ray film. In addition to 32P or 35S-deoxynucleotide triphosphates used in
DNA sequencing, non-isotopic methods of using fluorescent dyes and automated DNA sequencing
machines are beginning to replace the traditional isotopic methods. For a given sample well, the
horizontal “bands” appear in vertical lanes from the top to the bottom of the x-ray film. Generally, a single
electrophoretic gel separation can contain several sets of “GATC” sequencing reactions. Figure 2 shows
an autoradiograph which would result from analysis of the hypothetical sequence in Figure 1. The dark
bands are produced by exposure of the x-ray film with 32P which has been incorporated into the dideoxyterminated fragments during DNA synthesis. The sequence deduced from the autoradiogram will actually
be the complement of the DNA strand contained in the singled-stranded DNA template. This DNA
sequencing procedure is called the Sanger “dideoxy” method named after the scientist who developed
the procedure.
Figure 3. Hypothetical gel and DNA sequence using dideoxynucleotide termination.
Automated DNA sequencing:
Although DNA sequencing has existed since the early 1970's, it has not been until the 1990's that
the whole process has been automated. In particular, automated DNA sequencers rapidly and efficiently
analyze the reactions in a one-lane sequencing process that uses four-dye fluorescent labeling methods
and a real-time scanning detector. These machines automatically separate the labeled DNA molecules of
varying sizes by gel electrophoresis and also "call" the bases and record the data. In contrast to running
and reading the DNA sequencing gels manually, these automated sequencers can provide much more
information (up to several thousands of base pairs) per gel run. The entire process of collecting and
analyzing sequencing data is automated. Robots perform the sequencing reactions, which are then
loaded onto automated sequencers. After the automated sequencing run is complete, the sequence
information is transferred to computers, which analyze the data. The automated sequencer is a very
small spectrophotometer. The nucleotides rather than being dideoxynucleotide, are labeled with a
fluorescent tag that the sequencer can detect as individual nucleotides move through the capillary sized
polyacrylamide gel. The computer will then take this information in and convert it to a series of peaks
that correspond to the appropriate nucleotide. Red peaks = T; blue peaks = C; green peaks = A; and
black peaks = G.
This highly efficient automated DNA sequencing process has produced many large-scale DNA
sequencing efforts creating a new field of biology called genomics. Genomics involves using DNA
sequence information to understand the biological complexity of an organism. The Human Genome
Project (HGP) thought that a complete human genetic blueprint would be finished by the year 2002. The
goal of the HGP was to determine the complete nucleotide sequence of human DNA and thus localizing
the estimated 80,000-100,000 genes within the human genome. The project was finished ahead of
schedule and it is now known that there are 35,000 genes in the human genome. Advances in DNA
sequencing and bioinformatics will soon make it possible to use information from the Human Genome
Project as a clinical diagnostic tool.
The genetic revolution will continue to yield new discoveries. While scientists continue to identify
genes that cause disease or phenotypic differences (tall verses short), there is a growing danger to see
humans merely as a sum of their genes. Understanding the ethical, legal, and social implications of
genetic knowledge and the development of policy options for public consideration are therefore yet
another major component of the human genome research effort. For example, one particular area of
debate is that of psychiatric disorders whereby researchers are trying to characterize traits such as
schizophrenia, intelligence and criminal behavior purely in terms of genes. This simplistic view may
create situations in which genetic information has the potential to cause inconvenience or harm.
Additionally, ethical debate about prenatal screening of diseases in human embryos is also controversial.
Thus in depth discussion is needed to balancing improvements to human health with the ethical
implications of the genetic revolution.
Figure 4. Chromatograph from an automated sequence data.
The purpose of this exercise is to introduce students to bioinformatics. In order to gain experience
in database searching, students will utilize the free service offered by the National Center for
Biotechnology (NCBI) which can be accessed on the INTERNET. At present there are several
Databases of GenBank including the GenBank and EMBL nucleotide sequences, the nonredundant
GenBank CDS (protein sequences) translations, and the EST (expressed sequence tags) database.
Students can use any of these databases as well as others available on the INTERNET to perform the
activities in this lab. For purposes of simplification we have chosen to illustrate the database offered by
the NCBI. These exercises will involve using BLASTN, whereby a nucleotide sequence will be compared
to other sequences in the nucleotide database.
EXPERIMENTAL PROCEDURES
1. Type: internet.ncbi.nlm.nih.gov to log on to the NCBI web page. It should look something like this.
2. Click on the Blast icon as shown in the following panel..
3. The following menu should appear. Click on the nucleotide blast to access the algorithm for blastn
as indicated by the arrow in the following panel.
4. After clicking on nucleotide blast a web page will appear that looks similar to the following panel.
Note the box where the query sequence may be entered. To get started entering the nucleotide
sequence, start typing the following sequence:
TTTGTCAGCCGGCATCTGTGCGGCTCCAACTTAGTGGAGACATTGTATTCAG
After typing in the nucleotide sequence, proofread it to make sure that it has been entered
correctly. The database that we will cross reference this particular nucleotide sequence will be
Nucleotide collection (nr/nt). The program also needs to be optimized for Somewhat similar
sequences (blastn). Now scroll down this web page and select the following two choices as seen in the
following two panels.
Continue scrolling down this web page until you see the BLAST icon as viewed in the following
panel. Click this icon to initiate the search.
The results of your search may take a few seconds to several minutes to complete. When it
does a web page that looks similar to the following panel will appear. A figure showing the distribution of
blast hits on the query sequence will appear.
As you scroll down this same page, other information will become apparent. For example, a
table of sequences that aligned with the nucleotide sequence that you submitted will appear (see the
panel at the top of next page). Data in this table includes the relative similarity of your submitted
sequence to nucleotide sequences (sometimes entire genes) and the species from which these
sequences were originally obtained. Note that just above these data, is a link for Distance tree of
results. If you chose to click on this, it will show a diagrammatic representation (a cluster diagram) of
similar sequences from various species.
Scrolling farther down the same page, the actual alignments of your submitted sequence (the
query) can be directly compared to specific sequences recorded in the data base.
Based on these results, what gene and what species is the best match for the
nucleotide sequence that you submitted? Hint: see adjacent figure!
EXERCISE A
Now that you have familiarity with the entry and submission process, read the DNA sequence analysis
from your autoradiograph. A few notes on reading a sequencing gel:



Write the sequence down on a piece of paper. Take this sequence and enter it into the query box for the
BLAST search at the NCBI web site.
It is critical that you do not confuse lanes when reading the sequence. The gel contains the A, C, G, T
lanes from left to right.
Reading a sequence gel requires that you read the nucleotides in the 5’3’ direction. This can be
accomplished by reading up the gel from the bottom. Notice that for the most part that the spacing
and intensity of most of the bands is fairly constant. Ignore lightly colored bands choosing only the
darker ones. Occasionally the sequence will be dark and all four lanes will be of relatively similar
intensity. This is called a DNA sequencing compression and is common when there are stretches
of G and C’s.
Notice that it is sometimes difficult to judge the spacing and strongest intensity of the band in each lane
and therefore you need to use your best judgment. Note – If an exact band at a position is ambiguous,
you can enter an N which denotes it could be either A, C, G or T.
Now, begin the exercise: Start reading the DNA sequence from your sample from the point of the arrow
and submit it to NCBI using the BLASTN program. After receiving the BLAST results, scroll down to look
at the exact entries that have nucleotide matches with your query sequence. Again remember that when
two sets of nucleotide sequences show identity of a 21 basic pair continuous strand, it usually indicates
that the sequences are related or identical.
Results to be obtained from sample:
1. What are two potential names given to this gene?
2. What species is this sequence most likely from?
EXERCISE B
An unidentified fungus that was suspected of being a pathogen of cereal grains was isolated and grown
in culture in the laboratory. After isolating the DNA, a primer was used to target a region the genome
where the beta-tubulin gene resides so that it could be amplified through a process known as
polymerase chain reaction (PCR). This sequence of nucleotides was determined by generating a
chromatograph from an automated sequence data. The following sequence represents actual data
collected from this experiment.
CCTCTCTTTTTTAGTTCGTGCTGTGCTGTTGCACGCGTTGCGTTTGTCGTGCCCCTGATTCTACCCC
GCTGGGCGGTGGCAGCTCAACGACAATGCATGATAGATAGCTAGCAGCTTTCACATACCTTCTGT
CAAGACGAAGAAGCTAATCAGATCTTTTCTCTACGATAGGTTCACCTCCAGACCGGTCAGTGCGT
AAGTGCTCATCGCTTCCTCAGCGTCGCATGAGGGGGGATACTTACAGTGTTTATCAGGGTAACCA
AATTGGTGCTGCTTTCTGGCAAACCATCTCTGGCGAGCACGGCCTCGACAGCAATGGTGTCTACA
ATGGTACCTCCGAGCTTCAGCTCGAGCGCATGAGTGTTTACTTCAACGAGGTATGCATTAGCAGT
CAATGTCAAGAGTTCACACGCTCACACATCTAGGCCTCTGGCAACAAGTATGTTCCCCGAGCCGT
CCTCGTCGACCTCGAGCCTGGTACCATGGACGCCGTCCGTGCTGGTCCCTTCGGTCAGCTCTTCC
GTCCCGACAACTTCGTTTTCGGTCAGTCCGGTGCTGGAAACAACTGGGCAAAGGGGGTCACTAAA
NNNNNNNNNNNNN
Submit it to NCBI using the BLASTN program. You can cut and paste these data if you have access to
an electronic file.
EXERCISE C – Just for fun!
Match the following sequences to the species that these are most similar. To determine the answer
submit it to NCBI using the BLASTN program. You can cut and paste these data if you have access to
an electronic file.
1.
2.
3.
4.
5.
Arabidopsis thaliana (plant: mouse-ear cress)
Homo sapiens (human)
Danio rerio (zebra fish)
Homo sapiens neanderthalensis (Neanderthal – extinct; DNA extracted from bones)
Caenorhabditis elegans (a nematode)
Sequence A:
AGAGGAAAGGCCACTACCATCAACGTCCCACCAGATTCGACATACACTCATCCGTTATTCC
CAATCGAAACTTTGTGAAACGAACTCCCACATATCTACCAAAACAGAAAACCCCGACTTTGT
TCGACGACATATCAGATTGCTAATCACTGTTTGTGAACAAGTGAATCTCGAAATCCACGAAG
AATAAAAATGAGGTCTCCAAAATCAGTGAGACGTCCACACATCAGACAGCAACTG
Sequence B:
ATGTCTTGGTCGGCCACCGATCTCGCCGTCCTGTTGGGTCCTAATGCCACGGCGGCGGCC
AACTACAACAACAAATTCATCGACACCGCTTTCGCTATAGACAACACTTACATATGTGGCCA
GCTAGGCGACGTCCTCCTCTTCTCCGCCTACCTTGTCTTCTCTATGCAGCTTGGCTTC
Sequence C:
GTATTTTTCTTCCCCGTCCTGGGCACAGCACACACGCTCACACACACCTCTCCTTTTTCCCT
GAATCCACCATCCTGGGCTGAGAAGCCAGGAGAGAGGGTGGCAAGGTTTGGAGGAACCG
TTGGATTTTGGATAGTGAATCTTCACCATGGCTGAGTTCTTCATCGTCCTCAGGAGTTTGGT
TCTGCTGCAGGTCCTCTGCTTGGCCTTATCGCAAGTGACCGGTCCACCCGGAGCTCAAGG
CCCCGCTGGTTCCCCTGGTCCTGCTGGAACTCCCGGAGCCGACGGCATTGATGGTGAGAA
GGGACCCCCTGGACCTCCTGGACCAAGAGGTCAAAAGGGAGAGTCGGGTGAGCCTGG
Sequence D:
CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGT
CGCAGTATCTGTCTTTGATTCCTGCCCCATTCCATTATTTATCGCACCTACGTTCAATATTAC
AGGCGAGCATACTTACTGAAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACGA
CTAAATGTCTGCACAGCTGCTTTCCACACAGACATCATAACAAAAAATTTCC
Sequence E:
TTCTGCGAGACGCTATCAAACGGAGAGGGGACTTTGAAATGGATGTGGTGGCAATGGTGA
ATGACACGGTGGCCACGATGATCTCCTGCTACTACGAAGACCATCAGTGCGAGGTCGGCA
TGATCGTGGGCACGGGCTGCAATGCCTGCTACATGGAGGAGATGCAGAATGTGGAGCTG
GTGGAGGGGGACGAGGGCCGCATGTGCGTCAATACGAGTGGGGCGCCTTCGGGGACTC
CG