Part I: Dilutions and concentrations
1. Calculate the molar concentration of a solution prepared by dissolving 12.0 grams of KCl in
250mL of water. (MW of KCl: 74.5g/mole)
2. Calculate the percentage (w/v) of a solution prepared by dissolving 12.0 grams of KCl in
250mL of water.
3. Calculate the mass concentration (g/mL) of a solution prepared by dissolving 12.0 grams of
KCl in 250mL of water.
4. Calculate the number of grams of KCl needed to make 3L of a 0.5M solution (MW of KCl:
74.5g/mole)
5. Calculate the number of grams of KCl in 3L of a 2% (w/v) solution.
6. Calculate the number of grams of KCl in 3L of a 2% (v/v) solution. (Density of KCl :1.2)
7. How would you prepare 25 mL of 0.01% KCl from a 0.5 M KCl solution?
8. Calculate the % (w/v) of KCl a 0.5M solution. (MW of KCl: 74.5g/mole)
9. Explain how to prepare 100 ml of a solution that is 5 mM MgCl2, 2 mM CaCl2 and 125 mM
KCl from 1 M stocks of each of these chemicals.
10. Calculate the molar ratio between 1µg of a 10Kbp plasmid and 1µg of a 500bp DNA
fragment (Number of molecules of plasmid : number of molecules fragment)
11. Calculate the mass of a 500bp fragment required to obtain a 1:1 molar ratio with 1µg of a
10Kbp plasmid.
12. Calculate the volume of a DNA preparation, which has an absorbance at 260nm of 0.01,
which needs to be added to a solution to obtain 40ng in 10mL.
13. You have a solution of 100% (v/v) isopropanol. How would you prepare 5 mL of a 70%
(v/v) isopropanol solution?
14. The MW of isopropanol is 60.1 and its density is 0.78 g/mL. Using this data, calculate the
concentration in M of the 70% (v/v) solution prepared in the previous question.
15. A DNA sample diluted 1/20 gave an A260= 0.450 and an A280=0.227. What is the DNA
concentration in ng/µL?
Part II : RESTRICTION MAPPING
1. A 1000 bp EcoRI restriction fragment contains a gene you are interested in. As a first
step, you construct a restriction map of the EcoRI fragment using the enzymes PvuII
and HindIII.
Below is shown an agarose gel of the digests.
+PvuII
+PvuII + HindIII
a. How many times do HindIII and PvuII cut within the fragment?
b. Draw a restriction map of the EcoRI fragment and show the approximate distances, in base
pairs, between the HindIII, PvuII, and EcoRI sites.
c. Next, you want to clone the three fragments from the HindIII + PvuII digest (labeled a, b, and
c) into the vector pUC19 (shown below).
Starting with pure isolated DNA fragments and pUC19 DNA. What enzymes would you use
to clone each fragment? Include in your answer the enzymes used to cut the vector.
2. A recombinant plasmid was generated as follows: A region of the yeast genome was
amplified with a pair of primers to which were added the restriction sites BamH I and Hinc
II. The amplicon was then digested with BamH I and Hinc II and ligated into the multiple
cloning site (shown below) of a 3Kbp vector, pGO9, digested with BamH I and EcoR V.
MCS of pGO9:
Xba I Pst I Xho I Bam HI Kpn I EcoR I
Hind III
EcoR V
TCTAGAGCTGCAGCCTCGAGGGATCCCAGGGTACCAGAATTCCCCTACTAAGCTTGACCGATATC
Sequences of the restriction sites used:
BamH I : G▼GATCC
EcoR V : GAT▼ATC
Hinc II : GTT▼AAC
To verify the identity of the recombinant plasmid, restriction digests followed by agarose gel
electrophoresis were performed. The gel and the corresponding approximate sizes in base
pairs, as determined from a standard molecular weight profile, are indicated beside each band.
UD
B
E
7 500
5 000
B+E
4 300
800
X
3 800
1 200
800
400
4 000
900
UD: Undigested
B: BamH I
E: EcoR I
X: Xba I
1. Which lanes demonstrate each of the following:
Partially undigested plasmid:
Partially digested plasmid:
Complete digests:
2. In lane “B + E” which bands represent sequences from…?
Vector only:
Insert only or insert + MCS:
Vector and insert:
3. What fragment sizes would be predicted from a double digest with EcoR I and Xba I?
4. What is the probable distance between the BamH I and Xba I (in the insert) restriction sites?
5. Given that the digests were done with 0.1µg of DNA, how much DNA is represented by the
band with a migration distance of 16.0 mm in lane “E”?
6. Which band in lane “U probably represents supercoiled plasmid DNA?
7. Hinc II cuts how many times in the amplified region of the amplicon?
8. A complete digest with EcoR V resulted in 4 bands. Based on this information, how many
times does EcoR V cut within the cloned insert?
Part III
1. A schematic representation of the A allele of the ABO gene is shown below:
E
“E” represents a unique EcoR I site within the region of interest. The EcoR I site is common to
all A alleles whereas the B and O alleles do not cut with EcoR I. The arrows represent a pair of
primers designed to amplify the illustrated region.
PCR amplification of the above region was performed on genomic DNA from two individuals.
PCR products were then digested with Eco RI and migrated on a gel. The results obtained are
illustrated below:
1
2
1a. Which individuals may be heterozygous for their genotypes of the Eco RI site within the
ABO gene? (0.5 points)
1b. Prior to performing the PCR, the genomic DNA from the two individuals was digested with
EcoR I. Following the PCR using digested DNA, the amplicons were then digested with
EcoR I. Draw a diagram illustrating the results expected following the gel migration. Provide
a brief explanation for the results presented. (2 points)
1
2
1c. Which individuals possibly possess each of the following blood groups:
Blood Group
A
B
AB
Individual:
O