Supplementary Methods
Case Selection and DNA Extraction
Frozen PA tumor tissues and patient-matched peripheral blood leukocyte specimens
were retrospectively obtained from the Siteman Cancer Center Tissue Procurement
Core Facility. All biospecimens were collected under an IRB-approved protocol and deidentified prior to use in the study. All specimens were reviewed by an experienced
neuropathologist (A.P.) prior to analysis. Embedded frozen tissues were sectioned at
fifty microns, placed in ALT buffer (QIAamp DNA extraction kit, Qiagen) and proteinase
K, and digested overnight at 56°C. After tissue digestion, DNAs were isolated according
to the standard manufacturer’s protocol (Qiagen, Valencia, CA); DNA quality was
assessed based on the optical density (OD) ratio at 260/280 nm and 1% agarose gel
electrophoresis.
NimbleGen aCGH
Array comparative genomic analysis (aCGH) for the above mentioned 10 sample pairs
was performed by NimbleGen Systems Inc (http://www.nimblegen.com). DNA were
extracted, labeled, and hybridized to “2006-02-14_HG17_WG_CGH” array (Human
genome build 17, National Center for Biotechnology Information build 35), which has a
median probe spacing of 6kb. Array construction, labeling, hybridization, normalization
and data analysis were based on the protocol used by Selzer et al. (Selzer, Richmond
et al. 2005).
Affymetrix 500K SNP Genotyping Array
1
Affymetrix GeneChip Human Mapping 250K NSP and 250K STY arrays (Affymetrix,
Santa Clara, CA) were used to perform CGH on 10 patient matched tumor and germline
DNA samples. Purified double stranded (ds) DNA (250ng) was digested using NSP I
and STY I restriction enzymes. Linker ligation, amplification, fragmentation, labeling,
and array hybridization were performed by the Siteman Cancer Center GeneChip
Facility, following the manufacturer’s standard protocol (Affymetrix). Affymetrix GTYPE
v4.1 software was used to generate Affymetrix CEL files and to call SNP genotypes
using the BRLMM algorithm.
Data processing
Cy3 and Cy5 signal intensities from NimbleGen arrays were normalized to one
another using qspline normalization.
To graphically visualize large, recurrent
amplifications or deletions, unaveraged probe level data was imported into Spotfire and
Z-scores were calculated and visualized by creating a heat map.
To identify
contiguous, altered genomic segments; window averaging using Tukey biweight mean
was performed on the normalized data. Subsequently, segments were generated using
the NimbleGen SegMnt and visualized using SignalMap.
Copy number analysis for Affymetrix GeneChip Human Mapping 250K NSP and
250K STY arrays was performed using dChip (Lin, Wei et al. 2004), CNAG (Nannya,
Sanada et al. 2005), and the Copy Number Analysis Tool (CNAT). GTYPE v4.1 was
used to generate Affymetrix CEL files and to call SNP genotypes using the BRLMM
algorithm. dChip analysis was performed using paired germline samples as reference,
and copy numbers per SNP marker were generated and imported into Spotfire for
2
visualization.
Similarly, paired analysis was performed using CNAT.
Quantile
normalization was performed for probe level normalization with a genomic smoothing
window of 0.1 Mb. SNP markers were considered ‘amplified’ if copy number per SNP
marker was >= 2.5 and ‘deleted’ if copy number per SNP was <= 1.5 for the dChip
results. These criteria were determined after plotting a histogram for copy number per
SNP marker for all 10 patient matched tumor-germline samples (data not shown).
Because the results from CNAT returns discrete data, SNP markers were called
‘amplified’ if copy number per SNP was > 2.0 and ‘deleted’ if copy number per SNP was
< 2.0.
Cross-Platform Comparison
NimbleGen aCGH data were reported at the segment level (i.e. copy number changes
reported for contiguous genomic segments) by CGH-segMNT. Copy number analysis
results from dChip and CNAT were reported at the individual SNP marker level. To
facilitate cross-platform comparison, the SNP marker data were mapped to the
comparable genome build of the NimbleGen array and converted to segment data.
Segment level data was generated from dChip and CNAT SNP level data using the
DNAcopy module in R/Bioconductor. Segments from chromosomes X and Y were
excluded from further analysis. The segment level data from dChip, CNAT, CNAG, and
aCGH were pooled together to identify overlapping and recurrent (i.e. present in more
than one sample and predicted by two or more tools) segments.
DNA Quantitative PCR
3
Real-time quantitative PCR (qPCR) was employed to confirm array-based gene copy
number changes. Briefly, a 20-µL reaction mixture for qPCR was composed of 10 µL of
2× TaqMan universal PCR master mix (Applied Biosystems Inc. – ABI), 10 µl of primer
and probe mix (600 nM each forward and reverse primers, 200 nM specific TaqMan
probe at final concentration), and 10 ng of DNA (dried in wells of PCR plate overnight
before adding the reaction mixture). All real-time PCR assays were performed in
triplicate on an ABI PRISM 7900HT Sequence Detector System (ABI) and followed the
program: 50C for 2 min, 95C for 10 min, and 40 cycles of both 15 sec at 95C and 60
sec at 60C. Primers and TaqMan® probes used in this study were designed using ABI’s
Primer Express (v1.5) and the sequences for these oligo primers and probes are as
follows
(All
sequences
are
CCGGGACAAAGACAACTAGG,
5’
oriented
reverse:
CGTGACACGGACTCACCATATCCTTTG;
CTGGTGGGGTAGCATCTTCT,
to
3’):
set
a
–
AGCTCCCCACTAATGGGTCT,
HIPK2
reverse:
HIPK2
set
–
b
TTGCTGGAGGACTTGGACTT,
ACCCTGCCACTGATCTGACCTCTTTCTCC;
DOCK10
–
forward:
probe:
forward:
probe:
forward:
CTACTACGACATTCATCGGTCAT, reverse: CACGATAGTAGCGACCAAACAG, probe:
CTTCTCCGAATTCACCACCTCTGCC.
The
reference
gene,
DOCK10,
is
on
chromosome 2 where no significant gains/losses were observed with both NimbleGen
and Affymetrix array data in our 10 PA cases and another study (Jones, Ichimura et al.
2006), and it was chosen to normalize the DNA input between individual DNA samples.
A normal DNA sample from Promega (Catalog #: G304A) was used to scale the copy
number per diploid genome. By using serial dilutions of the normal DNA sample as
template, a standard curve for each primer/probe set (HIPK2 and DOCK10) was
4
established to calculate the raw copy value (RCV) for all DNA samples (including tumor
and blood cell DNAs), based on CT values generated by the 7900HT. The ratio of RCV
between target and reference genes in each DNA sample was then divided by the RCV
ratio of the diploid normal DNA sample, and the resulting overall RCV ratio was
multiplied by 2, which was the final result of DNA copy number in individual samples
(Konigshoff, Wilhelm et al. 2003).
Real-time reverse-transcription PCR (RT-PCR)
The expression of HIPK2 was examined by real-time reverse transcription-PCR (RTPCR) using SYBR Green detection chemistry. Three hundred nanograms of total RNA
extracted from each of the samples were used to make complementary DNA (cDNA).
Twenty nanograms of cDNA were used as template for PCR amplification with forward
(5’-CCACAGCACACACGTCAAATC-3’)
and
reverse
(5’-
TTTGCTCTGGTTCACCGTGTC-3’) primers specific for HIPK2 and forward (5’CCTGTTCGACAGTCAGCCG -3’) and reverse (5’- CGACCAAATCCGTTGACTCC -3’)
primers specific for glyceraldehyde-3-phosphate dehydrogenase (GAPDH). PCR
reactions without cDNA samples were used as negative controls. Each reaction was
done in duplicate. SDS system software (Applied Biosystems, Foster City, CA) was
used to convert the fluorescent data into cycle threshold (CT) measurements, and the
CT method (Livak and Schmittgen 2001) was used to calculate fold expression, using
GAPDH as an internal control.
Immunohistochemistry
5
Glioma tissue microarrays (TMAs) used for HIPK2 immunohistochemistry were obtained
from the Washington University/Siteman Cancer Center Tissue Procurement Core
Facility and the MD Anderson Cancer Center (G.N.F.) as previously described (Wang,
Zhang et al. 2002). Human tissues were used in accordance with approved Human
Studies protocols at Washington University. Immunohistochemical staining was
performed using the streptavidin-biotin-peroxidase technique on each set of glass slides
comprising the TMAs. Antigen retrieval was performed by incubating the TMA sections
in an antigen unmasking citrate-based solution at pH 6.0. After washing in tris buffer
solution, endogeneous peroxidase activity was blocked by incubating the slides in 1%
hydrogen peroxide for 30 minutes. The slides were incubated with blocking serum for 1
hour and then incubated with HIPK2 antibody (1:5,000 dilution; Abcam, Cambridge, MA)
overnight at 4ºC. After washing, the slides were incubated with biotinylated secondary
antibody, followed by streptavidin-conjugated peroxidase using Vectastain ABC kit
(Vector Laboratories, Burlingame, CA). Diaminobenzidine was used as a chromogen for
color development. The tissues were then counterstained with hematoxylin, and cover
slips were attached using a permanent mounting solution (Richard-Allen Scientific,
Kalamazoo, MI).
Clonogenic assays
The effects of HIPK2 expression were analyzed using clonogenic assays by cotransfection of equimolar amounts of pCMV-HIPK2, pCMV-HIPK2m (K221R), or empty
vector in combination with pBABE-puro (Addgene, Cambridge, MA). Briefly, 105 U87
glioblastoma cells per well were transfected with 2 µg of plasmid DNA using the Fugene
6
6 reagent (Roche Diagnostics, Indianapolis, IN) before selection with puromycin (0.7
µg/mL; Sigma-Aldrich, St. Louis, MO) for 14 to 21 days. Surviving colonies were stained
with crystal violet and counted. The experiment was done at least three times with
identical results. HIPK2 plasmids were generously provided by Dr. Gabriella D’Orazi
(Regina Elena Cancer Institute, Rome ITALY (D'Orazi, Cecchinelli et al. 2002).
References
D'Orazi G, Cecchinelli B, Bruno T, Manni I, Higashimoto Y, Saito S, et al. (2002).
Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and
mediates apoptosis. Nat Cell Biol 4(1): 11-9.
Jones DT, Ichimura K, Liu L, Pearson DM, Plant K and Collins VP (2006). Genomic
analysis of pilocytic astrocytomas at 0.97 Mb resolution shows an increasing
tendency toward chromosomal copy number change with age. J Neuropathol
Exp Neurol 65(11): 1049-58.
Konigshoff M, Wilhelm J, Bohle RM, Pingoud A and Hahn M (2003). HER-2/neu gene
copy number quantified by real-time PCR: comparison of gene amplification,
heterozygosity, and immunohistochemical status in breast cancer tissue. Clin
Chem 49(2): 219-29.
Lin M, Wei LJ, Sellers WR, Lieberfarb M, Wong WH and Li C (2004). dChipSNP:
significance curve and clustering of SNP-array-based loss-of-heterozygosity
data. Bioinformatics 20(8): 1233-40.
7
Livak KJ and Schmittgen TD (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25(4):
402-8.
Nannya Y, Sanada M, Nakazaki K, Hosoya N, Wang L, Hangaishi A, et al. (2005). A
robust algorithm for copy number detection using high-density oligonucleotide
single nucleotide polymorphism genotyping arrays. Cancer Res 65(14): 6071-9.
Selzer RR, Richmond TA, Pofahl NJ, Green RD, Eis PS, Nair P, et al. (2005). Analysis
of chromosome breakpoints in neuroblastoma at sub-kilobase resolution using
fine-tiling oligonucleotide array CGH. Genes Chromosomes Cancer 44(3): 30519.
Wang H, Zhang W and Fuller GN (2002). Tissue microarrays: applications in
neuropathology research, diagnosis, and education. Brain Pathol 12(1): 95-107.
8