Loss of TAK1 increases cell traction force in a ROS-dependent manner to drive epithelialmesenchymal transition of cancer cells.
Chee Ren Ivan Lama, Carol Tana, Ziqiang Teoa, Chor Yong Taya, Terri Phuaa, YunLong Wub,c,
Ping Qiang Caib, Lay Poh Tanb, Xiao Dong Chenb, Pengcheng Zhua, Nguan Soon Tana,d,1
a
School of Biological Sciences, Nanyang Technological University, 60 Nanyang Drive,
Singapore 637551.
b
School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang
Avenue, Singapore 639798.
c
School of Pharmaceutical Science, Xiamen University, China 361000
d
Institute of Molecular and Cell Biology, 61 Biopolis Drive, Proteos, Singapore 138673.
Running title: TAK1 modulates epithelial-mesenchymal transition.
1
Corresponding author: N.S.T.: Email: nstan@ntu.edu.sg or nstan@imcb.a-star.edu.sg; Tel:
+65-63162941; Fax: +65-67913856.
SUPPLEMENTRY FIGURE LEGEND
Figure S1. Comparison of cellular proliferation and death in A5RT3CTRL and A5RT3TAK1
cells.
(A) The expression levels of TAK1 mRNA and protein in A5RT3CTRL and A5RT3TAK1 cells.
(B-C) Immunoblot analysis of TAK1 downstream signaling mediator, NFκB p65 subunit (B) and
ERK and JNK (C) in cells treated with cytokine IL-1 at 20 ng/ml prior to analysis. β-tubulin
immunoblotting showed equal loading and transfer. Values below each band represents mean
fold change compared with control.
(D) FACS analysis of proliferation rate in A5RT3CTRL and A5RT3TAK1 cells as determined by
BrdU labelling. Results were gated to show percentage of cell population in the various mitotic
phases (ie. G1, S and G2/M). Quadrant percentages are indicated in the respective dot plots.
(E) Phase contrast microscopic images of TAK1-knockdown HSC-5, II4 and MKN28 treated
with TGFβ1 (10 ng/ml) for 48 h. Scale bar: 100µm.
(F) Representative immunoblots of indicated EMT markers of cell samples mentioned in (E).
Values below each band represents mean fold change compared with control.
For immuoblotting, β-tubulin serves as loading control.
Figure S2. TAK1 overexpression in A5RT3TAK1 rescued TGFβ1-induced EMT.
(A) Phase contrast images of A5RT3TAK1 transfected with expression vector containing TAK1
cDNA and treated with TGFβ1 (10 ng/ml) for 48 h. Scale bar: 100µm.
(B) qPCR analysis of EMT markers in TAK1-transfected A5RT3TAK1 cells with and without
TGFβ1 treatment. Samples were normalized with reference gene, L27.
(C) Immunoblot analysis of TAK1-transfected A5RT3TAK1 cells for the overexpression of TAK1
and EMT phenotype upon TGFβ1 treatment. Representative blots were shown with respective
densitometry values indicated below lanes, normalised with respect to the control. Samples were
normalized with β-tubulin as a loading control.
Data represent means± S.D; n=3.
Figure S3. TGFβ1-induced EMT is effected through SMAD signaling.
(A) Phase contrast images of SMAD3 siRNA transfected A5RT3CTRL cells with 72 h of TGFβ1
(10 ng/ml) treatment. Scale bar: 100µm.
(B) qPCR analysis of EMT markers in SMAD3 siRNA transfected A5RT3CTRL cells with and
without TGFβ1 treatment. Samples were normalized with reference gene, L27.
(C) Immunoblot analysis of SMAD3 siRNA transfected A5RT3CTRL cells for their knockdown
and EMT markers upon TGFβ1 treatment. Representative blots were shown with respective
densitometry values indicated below lanes, normalised with respect to the control. Samples were
normalized with β-tubulin as a loading control.
(D) Immunoblot analysis of phosphorylated SMAD3 in SMAD3-knockdown A5RT3CTRL cells.
Values below each band represents mean fold change compared with control.
For
immuoblotting, β-tubulin serves as loading control.
Data represent means± S.D; n=3.
Figure S4. Determination of optimal NAC concentration.
(A-B) Apoptosis assay by annexin V/PI staining (A) and CM-H2DCFDA staining (B) of
A5RT3TAK1 cells treated with indicated concentrations of NAC as determined by FACS.
Numbers indicate percentages of cells in the respective quadrants.
(C) Phase contrast microscopy images of A5RT3CTRL cells after 48 h of 100 µM NAC treatment.
(D) Representative immunoblots indicated EMT markers in A5RT3CTRL cells treated NAC.
Values below each band represents mean fold change compared with control.
For
immuoblotting, β-tubulin serves as loading control.
Data represent means± S.D; n=3.
Figure S5. Effect of different concentration of Y27632 in ROCK acivity.
(A) Representative immunoblots of phosphorylated ROCK in A5RT3CTRL treated with indicated
concentration of ROCK inhibitor Y27632. Values below each band represents mean fold change
compared with control. β-tubulin serves as loading control.
(B) Relative protein expression of RhoA in siRNA RhoA-knockdown A5RT3 cells treated with
or without TGF-β1.
Data represent means± S.D; n=3.
Supplemental Table 1- qPCR Primer sequences used in this study.
TAK1 qPCR primer 1
GTTCCGTGTAAGGGCTTTGA
TAK1 qPCR primer 2
GAGCAGCTGCCACTTACCTTTACA
E-cadherin qPCR primer 1
GCCGAGAGCTACACGTTCA
E-cadherin qPCR primer 2
GACCGGTGCAATCTTCAAA
N-cadherin qPCR primer 1
TGCGGTACAGTGTAACTGGG
N-cadherin qPCR primer 2
GAAACCGGGCTATCTGCTCG
Vimentin qPCR primer 1
GTTTCCCCTAAACCGCTAGG
Vimentin qPCR primer 2
AGCGAGAGTGGCAGAGGA
SNAI1 qPCR primer 1
TCGGAAGCCTAACTACAGCGA
SNAI1 qPCR primer 2
AGATGAGCATTGGCAGCGAG
L27 qPCR primer 1
TGATGGCACCTCAGATCGC
L27 qPCR primer 2
AGAGTACCTTGTGGGCATTAGG