Electronic Supplementary Material
Extended atrial conduction system characterised by the expression of the HCN4 channel subunit
and connexin45
M. Yamamoto; H. Dobrzynski; J.O. Tellez; R. Niwa, R. Billeter; H. Honjo; I. Kodama; M.R. Boyett
METHODS
Cryosectioning and histology
Tissue was embedded in 10 % gelatine (porcine type A, Sigma, Poole, UK) and frozen at ~-50ºC in
isopentane (cooled in liquid N2) and stored at -80ºC until cryosectiong. Frozen serial sections (10 µm
thickness) were cut from throughout the preparations. After cryosectioning, the sections were mounted on
Super-Frost Plus glass slides (BDH, Poole, UK) and stored at -80ºC until use. Sections were used for
histology or immunohistochemistry. For histological study, sections were stained by Masson’s trichrome
technique.
Immunohistochemistry
Immunohistochemistry was carried out on rat tissue only. Sections were fixed by immersing the
slides in methanol at -20ºC for 5 min and were washed three times with PBS (Phosphate Buffered Saline, pH
7.4, Sigma) over 30 min. The sections were blocked with 10 % normal donkey serum for 1 h at room
temperature and this was followed by treatment with primary and secondary antibodies. The sections were
labelled with rabbit anti-HCN4 or double-labelled with guinea-pig anti-Cx45 and rabbit anti-Cx43. The
sections were incubated with the single antibody or the mixture of antibodies for ~20 h at 4ºC. Following
incubation with the primary antibodies, the sections were washed several times in PBS over 30 min, and
incubated in secondary antibodies, anti-rabbit conjugated to FITC (Chemicon, Hampshire, UK) or anti-rabbit
conjugated to FITC and anti-guinea-pig conjugated to Cy3 (Chemicon), for 1-1.5 h and mounted with
Vectashield mounting medium (H-1000; Vecta Laboratories, Burlingame, CA, USA). Finally, coverslips
were sealed with nailpolish. Rabbit anti-HCN4 primary antibody (Alomone Labs, Jerusalem, Israel) was
used at a 1:30 dilution, guinea-pig anti-Cx45 primary antibody (Q14/GP42 [1], a gift from N.J. Severs,
Imperial College London, UK) was used at a 1:250 dilution and rabbit anti-Cx43 primary antibody (Sigma)
was used at a 1:1000 dilution. Anti-rabbit secondary antibody conjugated to FITC was used at a 1:100
dilution and anti-guinea-pig secondary antibody conjugated to Cy3 was used at a 1:250 dilution. In control
1
experiments, either the primary or secondary antibody was omitted. In all control experiments, there was no
signal produced above background fluorescence. Histological images were collected using a Leica Materials
Workstation (Leica Microsystems, Wetzlar, Germany). Immunolabelled sections were examined by confocal
laser scanning microscopy (Zeiss LSM5 PASCAL; Carl Zeiss Microscopy, Jena, Germany). Projection
images were the composite of six consecutive single optical sections taken at 0.5 µm intervals.
The specificity of the HCN4, Cx43 and Cx45 antibodies used has been proven [2-4].
RNA isolation and generation of cDNA
From seven rabbits, tissue samples (~1 mm by 1-2 mm) were taken from the right atrial free wall and
the proximal and distal parts of the pulmonary veins, frozen and cryosectioned (at 20 µm thickness). Total
RNA was isolated from the frozen sections with a modified Qiagen muscle RNA extraction procedure [7].
The RNA concentration was then estimated with the RiboGreen assay (Molecular Probes). In addition, the
integrity of seven randomly picked RNA samples was confirmed on a formaldehyde-agarose gel stained with
ethidium bromide. 150 ng of total RNA from each sample was reverse transcribed with Superscript II reverse
transcriptase (Invitrogen) in a 20 µl reaction according to the manufacturer’s instructions, using random
hexamer priming. Aliquots of the resulting cDNA were diluted 10-fold in water for direct use in PCR.
Quantitative PCR and primers
The relative content of selected cDNA fragments was determined with quantitative PCR using a
LightCycler (Roche) and detection with SyBr green in 10 µl reactions (primer sequences and annealing
temperatures are given in Table 1). All runs were 40 cycles in duration. For all transcripts and samples, at
least three separate measurements were made with 1 µl aliquots of each cDNA sample. For quantification,
we used the “fit points” method of the preinstalled software on the Roche LightCycler. One of the
experimental cDNA samples was chosen as a reference standard. For each run, ratios relative to this
reference standard were determined based on the respective delta CTs and an average efficiency (determined
graphically, SD 2–3 %). These ratios were then averaged over all three runs and related to the average
content of 28S cDNA in each sample to correct for variations in input RNA. Expression levels are shown
graphically as a percentage of expression in the right atrial free wall.
Electrophysiological recordings
When the activation sequence of the right atrium was recorded, the right atrium was isolated from
the rat heart and the inferior vena cava was opened, but the superior vena cava was kept intact. The
2
preparation was fixed in a tissue bath with the epicardial surface up and superfused with Tyrode solution at
34ºC. The composition of the solution was as follows (in mM): NaCl 93; KCl 10; CaCl 2 1.5; MgSO4 1;
Na2HPO4 1; NaHCO3 20; glucose 11.0. The solution was saturated with 95 % O2/5 % CO2 to give a pH of
7.4. Extracellular potentials were recorded from 70 to 80 sites (at 0.5 or 1 mm intervals) from the epicardium
with a pair of modified bipolar electrodes and the activation sequence map was constructed by manually
drawing isochrones at 2.5 ms intervals [5]. When the spontaneous beating rate of the sinoatrial node and
nodal-like tissue in the interatrial groove was measured, tissue was dissected from the rat heart as described
in the main text, fixed in the tissue bath with the endocardial surface up and superfused with Tyrode’s
solution at 34 ºC; extracellular potentials were recorded. When the membrane potential of the pulmonary
veins was recorded, the myocardial sleeve of the right superior pulmonary vein was isolated from the rabbit
heart and fixed in a tissue bath and superfused with Krebs-Ringer solution at 33ºC. The composition of the
solution was as follows (in mM): NaCl 120.3; KCl 4.0; CaCl2 1.2; MgSO4 1.3; NaH2PO4 1.2; NaHCO3 25.2;
glucose 11.0. The solution was saturated with 95 % O2/5 % CO2 to give a pH of 7.4. The membrane potential
was recorded by a glass microelectrode from the endocardium near the pulmonary vein-atrium junction [6].
References
[1] Coppen SR, Kodama I, Boyett MR, Dobrzynski H, Takagishi Y, Honjo H, et al. Connexin45, a major
connexin of the rabbit sinoatrial node, is co-expressed with connexin43 in a restricted zone at the
nodal-crista terminalis border. J Histochem Cytochem 1999;47:907-918.
[2] Altomare C, Terragni B, Brioschi C, Milanesi R, Pagliuca C, Viscomi C, et al. Heteromeric HCN1HCN4 channels: a comparison with native pacemaker channels from the rabbit sinoatrial node. J
Physiol 2003;549:347-359.
[3] Neijssen J, Herberts C, Drijfhout JW, Reits E, Janssen L, Neefjes J. Cross-presentation by intercellular
peptide transfer through gap junctions. Nature 2005;434:83-88.
[4] Coppen SR, Dupont E, Rothery S, Severs NJ. Connexin45 expression is preferentially associated with
the ventricular conduction system in mouse and rat heart. Circ Res 1998;82:232-243.
[5] Yamamoto M, Honjo H, Niwa R, Kodama I. Low frequency extracellular potentials recorded from the
sinoatrial node. Cardiovasc Res 1998;39:360-372.
3
[6] Honjo H, Boyett MR, Niwa R, Inada S, Yamamoto M, Mitsui K, et al. Pacing-induced spontaneous
activity in myocardial sleeves of pulmonary veins after treatment with ryanodine. Circulation
2003;107:1937-1943.
[7] Wittwer M, Fluck M, Hoppeler H, Muller S, Desplanches D, Billeter R. Prolonged unloading of rat
soleus muscle causes distinct adaptations of the gene profile. FASEB J 2002;16:884-886.
4
Table 1. Primers and PCR conditions used.
Primer sequence 5′- 3′
Target
transcript
Accession
number
28S
AF460236
GTTGTTGCCATGGTAATCCTGCTCAGTACG
TCTGACTTAGAGGCGTTCAGTCATAATCCC
HCN1
AF168122
CAGCGATTTCAGGTTTTATTG
ATGGTGTTGTTGTCTGTTCTGT
HCN4
AB022927
GCTGTCCTGTCGTCTTGTTTCTC
CGGTTATTGTTGGTGGTGTATCTC
5
Fragment
length
(bp)
133
Primer
concentration
(µM)
1
1
110
0.5
0.5
74
2
2