The
generation
of
oxidative
stress-induced
rearrangements
in
Saccharomyces cerevisiae mtDNA is dependent on the Nuc1 (EndoG/ExoG)
nuclease and is enhanced by inactivation of the MRX complex
Piotr Dzierzbickia1, Aneta Kaniak-Golika1*, Ewa Malc2, Piotr Mieczkowski2 and
Zygmunt Ciesla1*
1
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-
106 Warsaw, Poland; 2 Department of Genetics, School of Medicine, Lineberger
Comprehensive Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA
Abbreviations: BER, base excision repair; MMR, mismatch repair; mtDNA, mitochondrial
DNA; ROS, reactive oxygen species; 8-oxoG, 8-oxo-7,8-dihydroguanine; HR, homologous
recombination.
a
These authors contributed equally to this work
1
Running title: Oxidative lesion-induced rearrangements of mtDNA
Key words: mitochondrial genome; oxidative lesions; mtDNA rearrangements; MRX;
Nuc1
*Corresponding
authors: Aneta Kaniak-Golik and Zygmunt Ciesla,
Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02106 Warsaw, Poland
E-mail anetak@ibb.waw.pl
E-mail zc@ibb.waw.pl
Phone 0-48-22-658 4734
Fax 0-48-22-658 4636
2
Abstract
Oxidative stress is known to enhance the frequency of two major types of alterations
in the mitochondrial genome of S. cerevisiae: point mutations and large deletions resulting in
the generation of respiration-deficient petite rho¯ mutants. We investigated the effect of
antimycin A, a well-known agent inducing oxidative stress, on the stability of mtDNA. We
show that antimycin enhances exclusively the generation of respiration-deficient petite
mutants and this is accompanied by a significant increase in the level of reactive oxygen
species (ROS) and in a marked drop of cellular ATP. Whole mitochondrial genome
sequencing revealed that mtDNAs of antimycin-induced petite mutants are deleted for most of
the wild-type sequence and usually contain one of the active origins of mtDNA replication:
ori1, ori2 ori3 or ori5. We show that the frequency of antimycin-induced rho¯ mutants is
significantly elevated in mutants deleted either for the RAD50 or XRS2 gene, both encoding
the components of the MRX complex, which is known to be involved in the repair of double
strand breaks (DSBs) in DNA. Furthermore, enhanced frequency of rho¯ mutants in cultures
of antimycin-treated cells lacking Rad50 was further increased by the simultaneous absence
of the Ogg1 glycosylase, an important enzyme functioning in mtBER. We demonstrate also
that rad50Δ and xrs2Δ deletion mutants display a considerable reduction in the frequency of
allelic mitochondrial recombination, suggesting that it is the deficiency in homologous
recombination which is responsible for enhanced rearrangements of mtDNA in antimycintreated cells of these mutants. Finally, we show that the generation of large-scale mtDNA
deletions induced by antimycin is markedly decreased in a nuc1Δ mutant lacking the activity
of the Nuc1 nuclease, an ortholog of the mammalian mitochondrial nucleases EndoG and
ExoG. This result indicates that the nuclease plays an important role in processing of
oxidative stress-induced lesions in the mitochondrial genome.
3
1. Introduction
Since mitochondrial DNA (mtDNA) is located close to the respiratory chain, a major
source of reactive oxygen species (ROS), the mitochondrial genome is constantly exposed to
oxidative damage. The efficient repair of oxidative lesions in mtDNA plays a central role in
maintaining the stability of the mitochondrial genome [1-3]. If not repaired, lesions in mtDNA
may result in mutations, which in humans may cause a variety of hereditary diseases such as
mitochondrial encephalomyopathies and neuropathies, and are associated with the
pathogenesis of a variety of complex disorders including heart disease, neurodegenerative
diseases such as Parkinson’s, Alzheimer’s and Huntington’s, and other neurological disorders
[4]. Oxidative damage to mitochondria and accumulation of somatic mutations in mtDNA
also appear to be a feature of both normal aging process and cancer [3-5].
The yeast Saccharomyces cerevisiae proved to be a very useful model system to study
mechanisms responsible for maintaining the stability of mtDNA. Though cells of this yeast
species can survive without respiration and mtDNA is dispensable for their viability in
laboratory conditions, it has been shown that loss of mtDNA in the budding yeast leads to
nuclear genome instability through a defect of essential iron-sulfur cluster biogenesis that is
dependent on normal mitochondrial function [6]. In addition, normal mitochondrial function
is required for survival of yeast cells in late-stationary cultures [7] or during chronological
aging [8,9]. Thus, it is not surprising that mtDNA stability is maintained by several, partially
overlapping, DNA repair pathways in yeast cells [10-13]. One of the pathways, the
mitochondrial base excision repair (mtBER) is relatively well characterized. An important
enzyme functioning in mtBER is the Ogg1 glycosylase that excises 8-oxoG, an abundant
oxidative lesion in DNA, opposite cytosine [14]. Another DNA glycosylase acting in the
mitochondria is the Ntg1 protein. This broad specificity enzyme excises several oxidized
pyrimidines and purines [15,16]. Several lines of evidence suggest that, besides mtBER, other
pathways may also participate in the repair of oxidative lesions in mtDNA. These pathways
include in S. cerevisiae: the mitochondrial repair system whose functioning depends on the
activity of the Msh1 protein, a homologue of the bacterial mismatch protein, MutS [13,17-19]
and, in addition, a repair pathway/s based on mechanisms of homologous recombination
[11,13].
Oxidative damage of mtDNA may lead to two major types of changes within
mitochondrial genome of S. cerevisiae. These two kinds of alterations within mtDNA are
manifested either by appearance of respiration-deficient petite rho¯ mutants often having
4
large deletions and other rearrangements of the mitochondrial genome [20], or by induction of
mitochondrial point mutations. The frequency of spontaneous petite mutants is very high,
usually 1-2% in wild-type strains, and may be significantly enhanced under oxidative stress
conditions [21]. On the other hand, the frequency of spontaneous and induced mitochondrial
point mutations is several orders of magnitude lower than the incidence of petite mutants
[10,13,22,23]. This dramatic difference clearly indicates that the mechanisms underlying the
generation of these two kinds of alterations in mtDNA are divergent. It has previously been
suggested that formation of petite rho¯
mutants may be related to mitochondrial
recombination processes [20]. In contrast, the generation of mitochondrial point mutations is
most likely due to replication errors [10].
The question arises which factors determine that primary oxidative lesions in mtDNA
are converted either to mitochondrial point mutations or to rearrangements of the
mitochondrial genome. As reactive oxygen species (ROS) produced in mitochondria can lead
to over 100 different types of modifications in DNA [24], one obvious determinant is the
nature of the modification present in mtDNA. For example, 8-oxoG, an abundant form of
oxidized base, is highly mutagenic, because it mispairs with adenine during DNA replication,
thereby leading to GC→T:A transversions [14]. On the other hand, the presence of replication
blocking-lesions, such as FapyG [25], may result in the formation of single-strand breaks
(SSBs) that could lead, in turn, to the generation of double-strand breaks (DSBs). In addition,
adjacent SSBs generated by direct action of ROS on opposite DNA strands may be converted
to DSBs [26]. Unrepaired DSBs may generate a serious threat to the integrity of the
mitochondrial genome.
To get further insight into mechanisms leading to the instability of mtDNA under
oxidative stress conditions, we used antimycin A, a well known drug which induces this stress
by direct blocking of electron transport during respiration in yeast mitochondria as well as in
those from higher eukaryotes [27]. The results of this work indicate that treatment of yeast
cells with antimycin leads exclusively to the generation of large-scale deletions in the
mitochondrial genome. Interestingly, the generation of antimycin-induced deletions in
mtDNA is dependent on the activity of the mitochondrial Nuc1 nuclease, the yeast ortholog of
mitochondrial EndoG and ExoG nucleases in mammalian cells [28]. Furthermore, our data
indicate that the MRX complex (reviewed in [29,30]) counteracts antimycin-induced
5
instability of mtDNA and is also required for efficient allelic homologous recombination in
mtDNA.
2. Materials and methods
2.1. Yeast strains and plasmids
Strains of S. cerevisiae used in this study are listed in Table 1. To introduce kanMXmarked deletions of RAD50, RAD27 and XRS2 into our strains, we used the following
strategy. We amplified corresponding deletion cassettes by PCR using genomic DNA extracts
from appropriate BY4341 deletion strains as templates and primers whose sequences
corresponded to the gene-specific oligonucleotides A and D designed within the
Saccharomyces
Genome
Deletion
Project
(available
on
http://www-
sequence.stanford.edu/group/yeast_deletion_project/deletions3). The amplified cassettes were
transformed into either the FF18733 strain or both parental strains used in the arg8mt test [13],
MAT, YAK29/1, and MATa, CAB183-1 (for RAD50 and XRS2 deletions). Resulting
transformant clones resistant to G418 were verified by PCR, following the strain verification
criteria established within the Saccharomyces Genome Deletion Project. For these PCR
verification tests, in addition to the above-mentioned primers A and D, the other gene-specific
oligonucleotides, B and C (internal to the ORF to be deleted), and the kanMX marker-specific
oligonucleotides, kanB and kanC, were used (the strain verification criteria and sequences of
all the primers listed above are available online at the site of the Saccharomyces Genome
Deletion Project as mentioned above). To isolate strains with deletion alleles marked with the
hphMX marker (yku70::hphMX and nuc1::hphMX), conferring resistance to hygromycin B,
we replaced kanMX-marked deletion alleles in appropriate BY4741 deletion strains with the
hphMX4 marker using the system described in [31]. Using genomic DNA extracts from the
resulting yku70::hphMX or nuc1::hphMX strains, we amplified the hphMX-marked
deletion cassettes by PCR with corresponding oligonucleotides A and D as above. An
analogous approach was used to extract the ogg1::TRP1 deletion cassette from the strain
CD138. To introduce these deletion alleles into our strains, we used the PCR products to
construct appropriate single and double deletion heterozygous strains (derived from a wildtype homozygous diploid strain obtained by crossing two isogenic wild-type strains, FF18733
and FF18734; Table 1). Hygromycin-resistant clones were isolated and tested for the presence
of the appropriate deletion allele by PCR (with the oligonucleotides: D for the cognate gene
and hphC [5’ TTGGGCGCAGGGTCGATGCG] for hphMX). The ogg1::TRP1 deletion
6
allele was tracked after transformations by PCR with the primers A and D for OGG1 (the
reference for the primers as above; the OGG1 A-D PCR product on the template of the wildtype chromosomal copy of OGG1 is shorter than the corresponding product obtained from the
ogg1::TRP1 deletion chromosome template). Finally, MATa haploid deletion strains were
isolated by dissection of tetrads issued in sporulation of PCR-verified heterozygous strains.
To obtain a CTA1-overexpressor plasmid to be used in tests with antimycin-treated
cells in the YPG medium, we replaced the URA3 marker in the pAH521 (Yep352-CTA1)
plasmid [32], generously provided by M. Skoneczny, with the ura3::kanMX3 swap-marker
cassette from the plasmid M3927 [33], a kind gift from D. Stillman. The same marker
replacement was performed with the YEp352 vector [34].
2.2. Growth media and growth conditions
YP medium contained 1% yeast extract, 1% Bacto-peptone and 2% dextrose (YPD) or
2% glycerol (YPG). YNBD medium contained 0.67% yeast nitrogen base and 2% dextrose.
Solid media contained 2% Bacto agar. Non-respiring petite colonies were scored on YPG
medium supplemented with 0.1% glucose (YPGD). Oligomycin-resistant mutants (Olir) and
erythromycin-resistant mutants were scored on YPG medium, buffered at pH 6.2, containing
either 3 g/ml oligomycin or 4 mg/ml erythromycin, respectively.
2.3 mtDNA sequencing
Total cellular DNA was isolated from the wild-type strain and 26 antimycin-induced
petite mutants. Sequencing libraries were prepared using Illumina TruSeqTM DNA Sample
Prep Kit (TruSeq DNA). Briefly, 5 ml of yeast cultures were grown on YPD, pelleted and
kept at -20oC overnight which increased mtDNA recovery. Total cellular DNA was extracted
and sheared to sizes between 200 and 800 bp by using Covaris S2 sonicator according to the
Illumina TruSeq DNA protocol. Libraries were prepared using TruSeq DNA kit with barcoded adapters for multiplexing. Libraries were size selected for fragments around 300 base
pairs using Pippin Prep automatic DNA size selection system (Sage Science). Libraries were
analyzed and quantified using a LabChip GX automated electrophoresis system (Caliper).
DNA was diluted to 15 nM and samples were pooled together at batches of 10, loaded on the
flow cell, and sequenced on a HiSeq2000 sequencer (Illumina). We performed paired-end
sequencing (2 × 100 cycles), using chemistry version 3. These libraries were run with the
Illumina pipeline v 1.8. Illumina reads were mapped to a reference genome at greater than 100
7
x average coverage and were analyzed using CLC Bio Genomics Workbench 4.9 (CLC Bio
GW).
2.4. Determination of mutant frequencies after treatment with antimycin A or menadione
To measure the frequency of petite formation, single colonies from YPG plates were
inoculated into 4 ml YPG and grown to OD600 0.4-0.6 at 30ºC. Menadione or antimycin A
were then added to a final concentration of 10 mM or 0.5 μg/ml, respectively, and incubated
for 2 or 4 h. Cells were then harvested by centrifugation, washed with water, resuspended in
fresh YPG and incubated for further 4 h at 30ºC. Appropriate dilutions were then plated on
YPGD plates and the percentage of petites was scored after growth for 3 days at 30ºC.
Colonies were scored as rho+ or rho¯/ rho0 by the tetrazolium overlay method [35]. The mean
value from each set of at least 10 cultures was used to determine the percentage of petite
colonies. To measure the frequency of oligomycin-resistant (Olir) mutants, and erythromycinresistant (Eryr) mutants, cultures were grown and treated with menadione and antimycin as
described above. After the final 4 hr incubation in YPG without a drug (see above), cells were
harvested by centrifugation, washed with water and plated either on YPG + oligomycin or
YPG + erythromycin. Appropriate dilutions of the cultures were also spread on YPGD plates
to calculate the number of petite and grande cells in tested cultures. The mean value derived
from at least 10 independent cultures was used to determine the frequency of mutants resistant
to oligomycin (calculated per number of grande cells). P values for statistical significance of
any differences in mutant frequencies between pairs of strains were determined by applying
the nonparametric Mann-Whitney criterion using the program STATISTICA (Statsoft), unless
stated otherwise. In some experiments with antimycin-treatment, the post-treatment
incubation of cells in drug-free YPG was extended to 16 hours, as indicated.
2.5. Assay of mtDNA recombination
To asses levels of mitochondrial recombination within the ARG8m gene, parental wildtype cells or cells deleted for the RAD50 or XRS2 gene carrying either the cox3::arg8mt::
polyAT(+1) or cox3::arg8m- 1 allele were crossed. The resulting diploids were selected and
the frequency of arginine prototrophs scored as described previously with some modifications
[13]. Briefly, 40 l of a fresh overnight YPD preculture (approx. 2.5 x 106 cells) of each wildtype parent or 60 l of a deletion mutant parental culture in YPD (for cultures of YAK29/1
and its derivative strains, adenine was supplemented in the medium at 55 mg/l), were mixed
in a tube, spun down and resuspended in 1 ml of fresh YPD. Cells were pelleted and
8
incubated in the pellet for 1 hour at 30ºC. Afterwards, the mating mixture was briefly
vortexed and incubated for 2 hours at 27ºC with shaking. An aliquot of 50 l from the
resulting mating culture was added to 5 ml of YNBD medium supplemented with arginine (40
mg/l) and leucine (220 mg/l). After 3 days of incubation at 27ºC with shaking, appropriate
dilutions of diploid cultures (to facilitate resuspension of cells, EDTA was added at
concentration of 20 mM to the cultures before preparation of dilutions in sterile distilled
water) were plated on YNBD with arginine and leucine to establish the titre of all selected
diploid cells and on the same medium without arginine to determine the frequency of Arg+
cells. Raw values of Arg+ frequencies in diploid cultures were normalized to estimated
retention of mtDNA in diploid cells based on frequencies of mitochondrial mit- rho+ genome
retention established for each parental strain (by a test cross with an appropriate tester strain:
GW22 for YAK29/1 and its derivative strains, and MCC259 for CAB183-1 and CAB183-1derived strains), as described in [13].
2.6. Determination of ROS levels
The dichlorofluorescein diacetate (DCFH-DA) assay was performed on whole-cell
extracts according to the procedure described by Doudican et al. [22]. Briefly, this assay
utilizes the oxidant-sensitive probe DCFH-DA to assess intracellular ROS levels. Cultures
were grown at 30ºC in YPG medium to OD600 0.4–0.6. Cells were washed twice with distilled
water, resuspended in 10 ml distilled water, and divided into 1.5 ml aliquots. Next, DCFH-DA
was added to a final concentration of 10 μM. Cells were incubated in dark at 30ºC for 30 min.
Afterwards, each sample was washed twice and resuspended in 1.5 ml of a solution
containing 1% sodium dodecyl sulfate, 2% Triton X-100, 100 mM NaCl, 10 mM Tris–HCl
pH 8, 1 mM EDTA. After addition of 0.3 ml acid-washed glass beads, cells were vortexed for
10 min. Samples were incubated at room temperature for 10 min and then pelleted.
Fluorescence of 200 μl of the supernatant was measured using Cary Eclipse fluorescence
spectrophotometer and Cary Eclipse Scan Application 1.1 program, with a fluorescence
excitation of 485 nm and emission at 520 nm.
The dihydroethidine (DHE) assay was performed similarly as DCFH-DA assay (the
final concentration of DHE in the assay also at 10 M) except that fluorescence was measured
with a fluorescence excitation at 518 nm and emission at 605 nm.
2.7. Determination of ATP levels
9
ATP levels in cells from tested cultures were determined with the use of “ATP
Determination Kit” form Invitrogen/Molecular Probes according to the experimental protocol
proposed in the manufacturer’s instructions. In this assay, the luciferase enzyme oxidizes Dluciferin with a concomitant emission of light (maximum at 560 nm) at the expense of ATP
that is added to reactions with cell extracts. Within some range of ATP concentrations, the
intensity of light emitted is proportional to the concentration of ATP in the reaction. Cell
extracts, providing ATP in these reactions, were prepared according to the TCA-diluted
method from the Thermo Labsystems Application Note 200 “The extraction of ATP from
biological material” (and references therein). The application note is available online as a pdf
file at www.pathtech.com.au/files/.../ExtractionATP.pdf. Briefly, aliquots of 50 l were
retrieved from tested cultures (about 106 cells/sample) and snap-frozen in liquid nitrogen.
Immediately after de-freezing a sample on ice, 50 l of the extraction buffer (10% TCA
[trichloroacetic acid], 4 mM EDTA) were added to cells and samples were incubated for 5
minutes on ice. Afterwards, TCA in extracted samples was neutralized by addition of 5 ml 0.1
M Tris-acetate, 2 mM EDTA (pH 7.75). After extraction, samples were usually kept frozen at
-80ºC until they were used for the ATP assay. For these assays, 10 l-aliquots of cell extracts
were mixed with 90 l of the luciferase-luciferin standard reaction solution prepared
according to the ATP assay kit instruction. After 15 minutes of incubation at room
temperature, luminescence generated in the reactions was measured with a Glomax 20/20
luminometer rented from the Promega distributor “Symbios Sp. z o.o.” (Straszyn, Poland).
3. Results
3.1. Antimycin increases ROS level and decreases ATP level
In order to get better insight into mechanisms by which oxidative stress leads to the
instability of the mitochondrial genome, to induce this stress we used antimycin A. Antimycin
A has been shown to block electron transport during respiration in isolated mitochondria from
yeast as well as from higher eukaryotes [27]. It interferes with electron transfer through the
complex III in a manner that leads to the accumulation of reduced forms of ubiquinone
(ubiquinol and ubisemiquinone) upstream of the blocked complex. Ubisemiquinone reacts
with molecular oxygen to produce superoxide. For comparison, we tested also the stability of
mtDNA in menadione-treated cells. In contrast to antimycin, menadione does not block
directly the activity of the electron transport chain, but acts as a typical redox-cycling drug,
10
which is able to accept electrons from electron carriers and to donate them to oxygen to form
superoxide [36,37].
First, prior to the investigation of the effect of antimycin- and menadione-induced
oxidative stress on the stability of the mitochondrial genome, we estimated, under conditions
used in this study, the levels of ROS in cells treated with either of these drugs. To do this,
cells grown in YPG medium were treated for 4 h either with antimycin or menadione and
cellular ROS levels were determined using two different fluorescent probes. Generation of
superoxide was assessed with dihydroethidine (DHE) [38] and generation of hydrogen
peroxide with 2’7’-dichlorofluorescein diacetate (DCFH-DA), which is hydrolyzed by
intracellular esterases to non-fluorescent DCFH, which, in turn, is oxidized to
dichlorofluorescein (DCF) [39]. Table 2 shows that cells treated for 4 h either with antimycin
or menadione displayed a similar increase in the level of superoxide as compared to untreated
cells (by 1.5-fold and 1.7-fold, respectively). However, cells exposed to antimycin exhibited a
much stronger elevation in the level of hydrogen peroxide than cells treated with menadione
(5.2-fold and 2.5-fold increase, respectively).
Next, we wished to know to what extent the treatment with antimycin or menadione,
leads to a bioenergetic deficit in cells exposed to these drugs. To test this, we determined ATP
level in antimycin- or menadione-treated cells grown on glycerol, a non-fermentable carbon
source. Table 3 shows that cells exposed for 4 h to antimycin displayed approximately 50%
decrease in the ATP level as compared to that in untreated cells, the result consistent with
previous data showing that antimycin dramatically reduces ATP production in isolated
mitochondria [40]. On the other hand, the treatment with menadione resulted in a reduction of
ATP by only 20%. This result shows that antimycin treatment affects ATP levels more
severely than menadione and leads to a severe cellular energy crisis.
3.2. Antimycin induces the generation of respiration deficient petite mutants
Three parallel assays were used to estimate the level of mitochondrial mutagenesis in
cells treated either with antimycin or menadione. In the first assay, we estimated the level of
respiration-deficient petite mutants, a method routinely used to measure mitochondrial
mutagenesis in yeast [13,21,22]. In two other assays, the frequency of mutants resistant to
oligomycin (Olir) and mutants resistant to erythromycin (Eryr) was determined and used as a
measurement of mtDNA point mutagenesis. Resistance to oligomycin is acquired through
specific point mutations in the mitochondrial OLI1 and OLI2 genes, encoding subunits 9 and
6, respectively, of the mitochondrial ATPase complex [41,42]. Therefore, acquisition of
11
oligomycin resistance can be used, as reported previously [13,18], as a convenient assay of
mtDNA mutagenesis. Resistance to erythromycin is acquired through specific mutations in
the mitochondrial 21S rRNA gene and acquisition of resistance to this drug is a standard
method of measuring mtDNA point mutagenesis [43]. The incidence of respiration-deficient
petite mutants and the frequency of Olir and Eryr mutants were determined in antimycin- and
menadione-treated cells grown on glycerol in YPG medium. Figure 1A shows that,
antimycin-treated cells displayed approximately an increase of 10-fold in the incidence of
petite mutants as compared to that in untreated cells. On the other hand, antimycin was
completely ineffective in the generation of Olir and Eryr point mutants. Interestingly, a
completely reverse result was obtained with menadione-treated cells grown in YPG medium.
Cells exposed to menadione displayed a marked increase in the frequency of Olir mutants as
compared to untreated cells. However, in contrast to antimycin-treated cells, the exposure to
menadione failed to result in enhanced generation of respiration-deficient petite mutants.
Importantly, the induction of respiration-deficient petite mutants by antimycin was dependent
on the carbon source used in the growth medium. Figure 1B shows that in contrast to cells
growing in YPG medium, antimycin-treatment of cells grown on glucose in YPD medium,
under conditions when most of cellular ATP is supplied by glycolysis and not by
mitochondrial respiration, failed to increase the level of petite mutants. It was previously
reported that antimycin causes no loss of ATP in cells growing on glucose [40]. It should be
noted (Table 2), that antimycin-treatment, irrespectively whether cells were grown on glucose
or glycerol, resulted in a similar increase in the level of hydrogen peroxide (4.2-fold and 5.2fold, respectively). This strongly suggests that antimycin-induced generation of petite mutants
is not exclusively related to the ROS level, but is associated also with a concomitant shortage
of cellular ATP.
The different effect of menadione and antimycin on the stability of mtDNA was also
observed when the frequency of the Olir and respiration deficient petite mutants was
determined in cells deleted for the OGG1 gene, encoding the Ogg1 glycosylase, an important
enzyme functioning in mtBER. The glycosylase excises 8-oxoG, an abundant oxidative lesion
in DNA, and is also known to cleave the DNA replication-blocking lesion FapyG [14,44]. We
found that in the ogg1Δ deletion mutant menadione dramatically enhances the incidence of
Olir mutants, but is completely ineffective in inducing petite mutants. In contrast, although the
level of spontaneous Olir mutants in the ogg1Δ strain was elevated several-fold compared to
that in the wild-type strain, the result consistent with previous data [13,18], it was not further
enhanced by antimycin treatment (supplementary Fig. S1). It should be emphasized that very
12
similar effects of antimycin and menadione on the stability of mtDNA were observed in
experiments using strains with different genetic backgrounds than that of FF18733, e.g. with
BY4742 (data not shown). We conclude therefore, that the treatment of yeast cells with
antimycin results preferentially in the formation of respiration-deficient petite mutants, but
hardly induces the generation of mitochondrial point mutations. In contrast, menadione is an
effective inducer of mitochondrial point mutations.
Supplementary material related to this article found, in the online version, at
http://dx.doi.org/10.1016/j.mrfmmm.2012.12.004.
3.3. The production of antimycin-induced petite mutants is triggered by an increased level of
hydrogen peroxide
One likely explanation of the diverse effects of menadione and antimycin on the
stability of mtDNA is that the treatment with menadione increases preferentially the level of
oxidative lesions giving rise to mitochondrial base-substitution mutations, such as 8-oxoG,
but fails to induce lesions leading to the generation of respiration-deficient petite mutants. In
this context, it is worth emphasizing that the exposure of yeast cells to menadione does not
lead to double-strand breaks (DSBs) [45]. In contrast, DSBs are induced in hydrogen
peroxide-treated yeast cells. We hypothesized that the approximate 5-fold increase in the level
of hydrogen peroxide in antimycin-treated cells (Table 2) could be responsible for the
induction of petite mutants. To verify this hypothesis, we examined antimycin-induced
generation of respiration-deficient petite mutants in cells harboring a multicopy plasmid
bearing the CTA1 gene that encodes catalase A, a well-known scavenger of H2O2. Catalase A
is localized both to peroxisomes and mitochondria and a significant import of catalase A into
mitochondria occurs when cells are grown under respiratory conditions [46]. As shown in
Figure 2, the frequency of antimycin-induced petites was markedly reduced in cells harboring
the pCTA1 plasmid as compared to that in cells carrying the vector plasmid. This result
indicates that it is hydrogen peroxide which is mainly responsible for the generation of petite
mutants in cells exposed to antimycin.
3.4. Analysis of antimycin-induced rearrangements in mtDNA
The appearance of respiration-deficient petite mutants is often due to large deletions
and other rearrangements of the mitochondrial genome [20]. To get preliminary insight into
the structure of mitochondrial genomes in antimycin-induced petite mutants, mtDNA from
independently isolated petite clones was subjected to a restriction analysis. This analysis
13
revealed that mtDNA isolated from antimycin-induced petites showed gross changes in the
restriction profiles as compared to mtDNA derived from respiration-proficient cells,
suggesting that exposure to antimycin leads to gross rearrangements in the structure of
mtDNA that result in the rho¯ phenotype (data not shown). To analyze mitochondrial
genomes from antimycin-induced petite mutants more closely, we subjected their mtDNA to
whole genome sequencing. Total cellular DNA of 26 independent antimycin-induced petite
mutants and the isogenic wild-type strain with functional mtDNA was sequenced and
analyzed. The reads were mapped to the S288c reference genome v.3 [47,48] with at least
100x coverage of the chromosomes. The difference in average coverage fold between
mitochondrial and nuclear DNA was used for calculating the copy number of mtDNA. This
value was then used to calculate the coverage for a single mtDNA repeat.
A comparison of the wild-type and petite mtDNA coverage revealed that the wild-type
mtDNA is almost uniformly covered by the sequencing reads. In the mtDNA from the petite
strains, fragments of the genome that are deleted or amplified can be recognized by a
significantly lower or higher coverage, respectively, of that relevant part of the reference
genome. In antimycin-induced petite mutants, we observed large fragments of mtDNA with
no or almost no (<1% of average coverage) reads mapping to the reference and the remaining
fragments with extremely high number of mapped reads. Out of the 26 petites analyzed, 3
were lacking mtDNA (rho0). The rest were rho¯ mutants containing large deletions ranging
from half to almost all of the mitochondrial genome. The rho¯ mutants retain different
segments of mtDNA that are mostly continuous (rarely in a few discrete fragments – strains
7c, 9a) and mostly made up from intragenic regions (Fig. 3). All, except one (1a – not shown),
include a region containing at least one ori-sequence in the amplified fragment. The ori
sequences have been proposed as origins of replication of mtDNA as their sequence is similar
to those found in origins of mtDNA replication from vertebrates [49,50]. Each ori sequence
contains three conserved GC-rich clusters: A, B and C and a transcription promoter upstream
from cluster C. Eight ori sequences have been found in S. cerevisiae mtDNA, but only four of
those are considered active as only ori1, -2, -3 and -5 contain functional RNA polymerase
sites [51-53]. Among the antimycin-induced rho¯ mutants, we observed three distinct groups
with the amplified region containing either ori2 (Fig. 3B), or ori3 (Fig. 3C), or a region
between ori5 and ori1 including one or both of these ori sequences, and in one case also ori2
(Fig. 3D). Some rho¯ mutants contain just an ori sequence, but others include larger stretches
of mtDNA. In most cases those fragments are near an ori site without rearrangements (only
two contained discontinuous fragments, as mentioned above). We also see some of the
14
mutants having an ori site overrepresented, which indicates further amplifications and the loss
of non-ori mtDNA. Altogether, these results indicate that antimycin preferentially induces the
ori-dependent rho¯ formation.
3.5. The frequency of antimycin-induced respiration-deficient mutants is enhanced in the
rad50 and xrs2 strains
Single-strand breaks (SSBs) are believed to be a very common kind of DNA damage
introduced directly by interaction of ROS with the sugar-phosphate backbone of DNA [54].
Unrepaired ROS-induced SSBs may, in turn, be converted into significantly more genotoxic
double-strand breaks (DSBs). In addition, DSBs can be introduced directly into DNA due to
oxidative attack [54]. Furthermore, SSBs and consequently DSBs may be formed when DNA
polymerase encounters a DNA replication-blocking lesion such as FapyG [25]. Since it has
been previously shown that the exposure of the yeast cells to hydrogen peroxide results in the
production of DSBs [45], we hypothesized that hydrogen peroxide-induced DSBs may be a
primary cause of large-scale mtDNA deletions in antimycin-treated cells. If this assumption is
correct, one should expect that yeast strains deficient in the DSB repair should be more
susceptible to antimycin-induced rearrangements in the mitochondrial genome than strains
proficient in this process.
There are two main pathways involved in DSB repair, homologous recombination
(HR) and non-homologous end-joining (NHEJ) [55-57]. In S. cerevisiae, both pathways
require the Mre11–Rad50–Xrs2 (MRX) complex, which is rapidly recruited to DSBs [29,30].
In addition, NHEJ requires Ku70/80, a heterodimer encoded by the YKU70 and YKU80 genes
in S. cerevisiae [58,59].
It was previously reported that both Mre11 and Rad50 were localized also in the
mitochondrial compartment [60,61], although their possible role in metabolism of mtDNA
was not immediately recognized after these first reports. However, it has recently been shown
that loss of MRX and Ku70/80 complexes significantly affects the rate of spontaneous direct
repeat mediated deletions (DRMD) in mtDNA [62]. We reasoned that, if either HR or NHEJ
plays an important role in the prevention of oxidative lesion-induced rearrangements of
mtDNA, one would expect that antimycin-induced generation of respiration-deficient petite
mutants could be significantly affected by the loss of the MRX complex or/and of the
Yku70/80 complex. To test this possibility, the rad50Δ, xrs2Δ, yku70Δ single mutants, as
well as the yku70Δ rad50Δ double mutant strain, were treated with antimycin and the
frequency of respiration-deficient petite mutants compared to that of the wild–type strain.
15
Figure 4A shows that the frequency of antimycin-induced respiration-deficient petite mutants
was approximately 2-fold higher in the rad50Δ and xrs2Δ mutants than that in the wild-type
control strain. In contrast, the incidence of antimycin-induced petites in yku70Δ was at the
level observed in the wild-type control strain (Fig. 4B). In addition, although the frequency of
spontaneous respiration-deficient mutants in the rad50Δ yku70Δ double mutants was elevated
as compared to the single mutants, the result consistent with a current report [62], the
frequency of antimycin-induced respiration deficient petite mutants in the yku70Δ rad50Δ
double mutant was not significantly different from that in the rad50Δ single mutant. This
result suggests that the Ku70/80 complex, and consequently NHEJ, does not play a significant
role in the prevention of antimycin-induced rearrangements of mtDNA.
Next, we asked whether a higher susceptibility of the rad50Δ and xrs2Δ mutants to
mtDNA rearrangements provoked by antimycin could be due to the deficiency in
mitochondrial HR. To test this possibility, we used an assay developed in this laboratory and
designed to estimate the frequency of mitochondrial allelic recombination events within the
ARG8m reporter gene [13]. Using this test, we compared the level of mitochondrial
recombination in crosses between the rad50Δ and xrs2Δ deletion strains with that of the
isogenic wild-type control crosses. Fig. 4D shows that the incidence of recombination events
within ARG8m in crosses between rad50Δ or xrs2 strains is decreased by about 40% as
compared to control crosses. This result suggests that the enhanced frequency of antimycininduced rearrangements in mtDNA in mutants with inactive MRX complex may be, at least
partially, due to the deficiency in homologous allelic recombination.
To investigate further the mechanism by which the MRX complex is involved in
maintaining the stability of mtDNA, we studied the generation of antimycin-induced petite
mutants in an rad50Δ ogg1Δ double deletion mutant, which lacks both the activity of the
MRX complex and the activity of the Ogg1 glycosylase, an important enzyme functioning in
mtBER [14]. Figure 5 shows that the frequency of antimycin-induced petite mutants in the
ogg1Δ single mutant was not significantly different from that observed in the wild-type strain.
Remarkably, the enhanced generation of antimycin-induced petite mutants observed in the
rad50Δ strain was further increased by simultaneous deletion of OGG1. We conclude,
therefore, that concurrent inactivations of the MRX complex and the Ogg1 glycosylase render
cells exceptionally susceptible to antimycin-induced rearrangements of mtDNA The
synergistic interaction between the rad50Δ and ogg1Δ deletions suggests that the MRX
complex and the Ogg1 glycosylase are involved in overlapping pathways which are
16
responsible for the repair of antimycin-induced oxidative lesions triggering rearrangements of
the mitochondrial genome.
3.6. The generation of antimycin-induced rearrangements in mtDNA is dependent on the
activity of the Nuc1 nuclease
Sequence analysis of mtDNA isolated from antimycin-induced respiration-deficient petite
mutants revealed that their phenotype is due to large-scale deletions in the mitochondrial
genome and often only small fragments of the wild-type mtDNA sequence are preserved (Fig.
3). We hypothesized that the formation of these large deletions in the mitochondrial genome
of antimycin-treated cells, observed under conditions of enhanced ROS production and a
concomitant shortage of intramitochondrial energy, may be mediated by a nuclease(s) known
to be localized in the mitochondrial compartment. To verify this assumption, we investigated
whether the absence of either the Rad27 or Nuc1 nuclease, previously reported to be involved
in mtDNA metabolism, may modify the antimycin effect on the stability of mtDNA. Rad27,
the S. cerevisiae ortholog of mammalian FEN1, is involved in many DNA transactions
including cleavage of 5’ DNA flaps created during Okazaki fragment processing, processing
of intermediates during nuclear long-patch BER, prevention of sequence duplications and
repeat sequence expansions, as well as in DSB repair [63-66]. It has been reported that Rad27
(FEN1) functions in mitochondria of both yeast and mammalian cells [67,68]. S. cerevisiae
rad27Δ mutants display an increased rate of Eryr point mutants, but, in contrast, exhibit a
decrease in mitochondrial direct-repeat mediated deletions (DRMD) [69]. The mechanisms
underlying these mitochondrial phenotypes of rad27Δ are not understood. The Nuc1 nuclease
is the yeast ortholog of mammalian EndoG, which is located in mitochondria, yet translocates
into the nucleus of apoptotic cells [70]. Nuc1p exhibits both endo- and exonuclease activities
with the polarity of the exonuclease activity 5’→3’ [71]. Besides its role in the yeast
apoptosis, it was previously reported that Nuc1 is involved in mitochondrial recombination in
yeast cells [72]. Figure 6A shows that the exposure of rad27Δ cells to antimycin resulted in
about the same induction of respiration-deficient petite mutants as in the wild-type cells. In
contrast, this induction was markedly reduced in antimycin-treated nuc1Δ cells. We
determined also the frequency of antimycin-induced respiration-deficient petite strains in a
nuc1Δ rad50Δ double mutant. This experiment (Fig. 6B) was performed under somewhat
different conditions than that shown in Figure 6A, i.e. after 4 hr long exposure to antimycin
the cells were incubated in antimycin-free YPG medium not for 4 h, as in the experiment
presented in Figure 6A, but for the additional 12 hours. Under these experimental conditions
17
the incidence of antimycin-induced petites in the wild-type strain was evidently higher than in
cells incubated after treatment for 4 h in the drug-free medium. It appeared that both the
nuc1Δ single mutant and the nuc1Δ rad50Δ double mutant displayed a significant decrease in
the frequency of induced petites. However, a significant fraction of respiration-deficient
mutants was still induced by antimycin in the absence of the Nuc1 nuclease. These results
demonstrate that the Nuc1 nuclease plays an important role in the formation of antimycininduced large-scale mtDNA deletions, but, in addition to Nuc1, yet another unidentified
mitochondrial nuclease(s) is also involved in the generation of large-scale deletions in
mtDNA.
4. Discussion
Several new findings emerged from this work. First, we show that the treatment of
yeast cells growing on non-fermentable carbon source with antimycin results in preferential
generation of respiration-deficient petite mutants having gross alterations in the structure of
mtDNA. Second, we show that inactivation of RAD50 or XRS2, two genes encoding
components of the MRX complex, leads to enhanced frequency of antimycin-induced
rearrangements in the mitochondrial genome and this phenotype correlates with the reduction
of mitochondrial homologous recombination in these mutants. Third, the generation of
antimycin-induced large deletions in mtDNA is dependent on the activity of the Nuc1
nuclease.
The treatment of cells growing on a non-fermentable carbon source with antimycin
frequently induces rho¯ mutants having large deletions in mtDNA. In contrast, the exposure of
cells to menadione does not lead to enhanced generation of rho¯ mutants, but efficiently
increases the level of mitochondrial point mutations. The question arises what is the
mechanism(s) underlying the diverse effects of antimycin and menadione on the stability of
mtDNA. One possible explanation is based on our observation that cells exposed to antimycin
exhibit a much stronger elevation in the level of hydrogen peroxide than cells treated with
menadione. Our finding that high-copy overexpression of the CTA1 gene coding for catalase
A suppresses the enhanced generation of rho¯ mutants in antimycin-treated cells clearly points
out to H2O2 accumulating in mitochondria as a ROS molecule that is responsible for
antimycin-induced rearrangements in mtDNA. As a matter of fact, since antimycin by
blocking the respiratory chain induces ROS production specifically in the mitochondrial
compartment, while menadione, a redox-cycling compound, operates in the whole cell (since
both mitochondrial and cytosolic proteins were detected as targets of oxidation damage upon
18
menadione treatment [73]), the difference in H2O2 level within mitochondrial matrix between
antimycin- versus menadione-treated cells may be actually much bigger than that shown in
Table 2. It is reasonable to assume that the nature of the primary oxidative lesions within
mtDNA, and, consequently, the nature of the final alterations in the structure of mtDNA
produced by either menadione or antimycin may be related to the actual level of H2O2 within
mitochondrial matrix. A very high level of intramitochondrial H2O2 in antimycin-treated cells
may result in the preferential generation of lesions, such as SSBs or DSBs, which eventually
lead to rearrangements in the mitochondrial genome. Moreover, the exposure of cells grown
on glycerol-containing medium to antimycin results in about 50% decrease in cellular ATP
level versus only a slight ATP reduction in menadione-exposed cells (Table 3). Furthermore,
it should be noticed that although antimycin-treated cells grown on glucose-containing
medium, under conditions when cellular energy is derived from glycolysis, display a similar
increase in the level of hydrogen peroxide as cells grown on glycerol-containing medium
(Table 2), this is not accompanied by an increased frequency of mtDNA deletions. Thus, the
increase in the level of hydrogen peroxide and the shortage of intramitochondrial energy are
required concomitantly to induce rearrangements in mtDNA. Interestingly, the situation when
enhanced ROS production is accompanied by a simultaneous drop in ATP within
mitochondria is often observed in mammalian cells bearing certain pathogenic mitochondrial
mutations [4]. Classic examples of such mutations are mitochondrial DNA mutations in the
ATP6 gene, e.g. at nt8993, resulting in neurological phenotypes of variable severity in humans
[74]. It would be interesting to examine how these mutations affect the stability of mtDNA.
It should be emphasized that our results are consistent with a previous observation by
Subik et al. [75], who have shown that the treatment of S. cerevisiae cells growing on a
glucose-containing medium both with antimycin and bongkrekic acid, which inhibits import
of glycolytically-produced ATP from the cytosol into mitochondria, results in a continuous
and random loss of mitochondrial genes. Conversely, the treatment of cells growing in a
glucose-containing medium solely with antimycin failed to have a significant effect on
mtDNA. While this work was in progress, Gomes et al. [76] reported an interesting precedent
of a mutant deleted for COQ10, a gene required for coenzyme Q transport in mitochondria.
Due to the redox imbalance in coq10cells, this mutant displays an increased production of
H2O2 accompanied by a high instability of mtDNA [77]. In the most recent report [76], the
authors have shown, by an extensive series of genetic manipulations, a remarkable correlation
between the level of H2O2 in coq10cells and a loss of the wild-type mtDNA.
19
We report in this study that rad50Δ and xrs2Δ mutants deficient in the activity of the
MRX complex, which is critical for detection of DSBs and initiation of their repair by either
HR or NHEJ, display an enhanced frequency of antimycin-induced rearrangements in mtDNA
(Fig. 4). We demonstrate also that the incidence of antimycin-induced respiration-deficient
mutants is similar in the yku70Δ single mutant to that of the wild-type control. In addition,
antimycin-treated cells of the rad50Δ yku70Δ double mutant display a similar frequency of
petites as the rad50Δ single mutant. These results indicate that mitochondrial NHEJ does not
play a significant role in the prevention of oxidative lesion-induced rearrangements in
mtDNA. Our findings imply also that the increased susceptibility of MRX-deficient mutants
to antimycin-induced rearrangements in mtDNA may be due to their decreased potential for
sustaining mitochondrial allelic HR. In accordance with this assumption, we have found that
the incidence of recombination events within ARG8m in crosses between rad50Δ or between
xrs2Δ strains is significantly decreased as compared to control crosses. For this reason, we
propose that the generation of mtDNA rearrangements initiated by oxidative lesions in
mtDNA of antimycin-treated cells is counteracted by MRX-dependent allelic homologous
recombination. Accordingly, our data strongly support previous suggestions that
recombination does play an important role in the repair of oxidative lesions in the yeast
mitochondrial genome. It has been shown that an S. cerevisiae mhr1-1 mutant, which is
partially defective in mitochondrial recombination at 30ºC, the temperature permissive for
growth of the strain on respiratory carbon sources, accumulates at non-permissive temperature
more oxidative lesions in mtDNA than the wild-type strain, suggesting that recombination
processes may be involved in the repair [11]. Biochemical studies on the isolated Mhr1
protein revealed that it catalyzes homologous pairing essential for homologous DNA
recombination [78]. Furthermore, a synergistic effect on the generation of respirationdeficient petite mutants has been observed in strains deleted for both NTG1 and PIF1, both in
normal conditions and under oxidative stress [22,79]. PIF1 encodes a DNA helicase
implicated in mtDNA recombination [80], though its exact mitochondrial function in the
regulation of mtDNA stability awaits further inquiry. In addition, the yeast mitochondrial
nucleoid protein Mgm101, which is related to the Rad52-type recombination proteins, was
currently shown to be required for mitochondrial repeat-mediated recombination [81]. A
defect in the Mgm101 function decreases tolerance to oxidative damage, and induces mtDNA
fragmentation in vivo.
It is justifiable to presume that the role of the MRX complex in the mitochondrial
compartment may be similar to that the same complex plays in the nucleus. It was previously
20
shown that the MRX complex, besides its essential role in Spo11-mediated meiotic
recombination [82,83], is also required for DSB repair in cells in the vegetative growth state
[29]. For example, mre11 mutant cells exhibit decreased frequencies of ionizing radiationinduced interhomolog recombination [84]. Moreover, it has been reported that heteroallelic
recombination between homologous chromosomes is not induced in rad50Δ cells upon
exposure to methyl methansulfonate [85]. By analogy, we postulate that the MRX complex
plays an important role in the recombinational repair of oxidative lesion-induced DSBs in
mtDNA and acts to prevent rearrangements of the mitochondrial genome under oxidative
stress conditions.
However, alternative mechanisms by which the MRX complex may be also involved
in the prevention of antimycin-induced rearrangements in mtDNA should be considered. The
MRX complex is required for checkpoint responses to DSBs [86,87]. Inactivation of the MRX
complex may result in the failure of the Mec1/Rad53 kinase cascade to increase dNTP levels
after cells are challenged by DNA-damaging agents [88]. It was previously proposed that
processed DSBs trigger MRX-dependent checkpoint activation by oxidative DNA damage
[89]. Thus, rad50Δ and xrs2Δ mutants may be unable to increase dNTP levels after cells are
exposed to antimycin. In consequence, the efficiency of both mtDNA replication and mtDNA
repair may be more severely affected than in MRX-proficient strains. It was previously
reported that lower dNTP levels increase the frequency of mitochondrial DNA-deficient petite
cells while higher dNTP levels result in reduced petite formation [90-92]. On the other hand,
it was recently reported that the MRX complex is involved in BER and may be required for
efficient polymerase activity in this repair pathway [93]. This raises the possibility that MRX
complex deficiency may affect also the functioning of mitochondrial BER.
A significant finding which emerged from this work indicates that the Nuc1 nuclease,
the yeast ortholog of the mammalian EndoG and ExoG nucleases [28,70] plays an important
role in the generation of large-scale deletions in antimycin-treated cells. The involvement of
Nuc1 in programmed cell death in yeast cells has been described [70]. However, the role of
Nuc1 in mtDNA metabolism is so far not understood. Gene inactivation studies in yeast have
suggested earlier that Nuc1 is involved in mitochondrial DNA recombination. Zassenhaus and
collaborators speculated that the enzyme produced recombinogenic DNA ends by introducing
single-stranded gaps into double-stranded DNA using its 5’→3’-exonuclease activity [72].
The present work uncovers an important role of Nuc1 in mtDNA metabolism. We
demonstrate in this study that the generation of antimycin-induced rearrangements in mtDNA
is markedly reduced in strains deleted for the NUC1 gene. This observation suggests that the
21
fate of, at least, some types of oxidative lesions in mtDNA, e.g. SSBs and DSBs, is dependent
on the activity of the enzyme. It is worth noting that ExoG, a mammalian ortholog of Nuc1,
has recently been reported to be required for repairing endogenous SSBs in the mitochondrial
genome [94]. We propose the 5’→3’-exonuclease activity of Nuc1 is involved in processing
of mtDSB ends. Under conditions of acute oxidative stress accompanied by a shortage of
intramitochondrial energy, e.g. in cells treated with antimycin, the Nuc1 activity leads to
extensive degradation of mtDNA. This Nuc1-mediated processing is likely to be the first step
which eventually results in the formation of rho¯ mutants whose mtDNA are deleted for most
of the mitochondrial genome. The subgenomic mtDNA molecules in these petites arise
presumably by means of non-allelic recombination. However, it should be noticed that in the
absence of the Nuc1 nuclease a significant fraction of respiration-deficient mutants is still
induced by antimycin. This observation suggests that, in parallel to Nuc1, another, yet
unidentified, mitochondrial nuclease(s) is involved in the generation of large-scale deletions
in mtDNA.
Our observation that the generation of antimycin-induced large-scale deletions in
mtDNA is dependent on Nuc1 raises the intriguing possibility that under conditions of
oxidative stress Nuc1 may be involved in the selective degradation of damaged copies of
mtDNA. It was previously postulated that mitochondria are capable of abandoning damaged
mtDNA, owing to multiple copies of mtDNA [95]. In addition, it has already been reported
that degradation processes operate on oxidatively damaged mtDNA in mammalian cells [96].
Presumably, the degradation of oxidatively damaged mtDNA, together with mtDNA repair
pathways such as mtBER, may represent a component of the complex machinery that is
responsible for the protection of the mitochondrial genome integrity.
In conclusion, the results presented in this work imply that the level of
intramitochondrial energy plays a key role in directing the fate of oxidative lesions in
mtDNA. Once the level of mitochondrial ATP and other nucleoside triphosphates drops
below a certain threshold level, several kinds of oxidative lesions, such as DSBs, may be
processed by the Nuc1 nuclease to produce large-scale deletions in mtDNA. In accordance
with a current report [62], we show also that the MRX complex functions in the mitochondrial
compartment and acts to maintain the mtDNA integrity possibly on a pathway of
mitochondrial allelic homologous recombination.
Conflict of interest
The authors declare that they have no conflict of interest.
22
Acknowledgements
This work was supported by Grant No. N N303 611038 from the Polish Ministry of Science.
We thank Marek Skoneczny and David Stillman for providing plasmids.
References
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
V.A. Bohr Repair of oxidative DNA damage in nuclear and mitochondrial DNA, and
some changes with aging in mammalian cells, Free Radic Biol Med 32 (2002) 804812.
B.S. Mandavilli, J.H. Santos and B. Van Houten Mitochondrial DNA repair and aging,
Mutat Res 509 (2002) 127-151.
J.A. Stuart and M.F. Brown Mitochondrial DNA maintenance and bioenergetics,
Biochim Biophys Acta 1757 (2006) 79-89.
D.C. Wallace A mitochondrial paradigm of metabolic and degenerative diseases,
aging, and cancer: a dawn for evolutionary medicine, Annu Rev Genet 39 (2005) 359407.
D.C. Wallace and W. Fan Energetics, epigenetics, mitochondrial genetics,
Mitochondrion 10 (2010) 12-31.
J.R. Veatch, M.A. McMurray, Z.W. Nelson and D.E. Gottschling Mitochondrial
dysfunction leads to nuclear genome instability via an iron-sulfur cluster defect, Cell
137 (2009) 1247-1258.
A. Trancikova, P. Weisova, I. Kissova, I. Zeman and J. Kolarov Production of reactive
oxygen species and loss of viability in yeast mitochondrial mutants: protective effect
of Bcl-xL, FEMS Yeast Res 5 (2004) 149-156.
N.D. Bonawitz, M.S. Rodeheffer and G.S. Shadel Defective mitochondrial gene
expression results in reactive oxygen species-mediated inhibition of respiration and
reduction of yeast life span, Mol Cell Biol 26 (2006) 4818-4829.
R.W. Powers, 3rd, M. Kaeberlein, S.D. Caldwell, B.K. Kennedy and S. Fields
Extension of chronological life span in yeast by decreased TOR pathway signaling,
Genes Dev 20 (2006) 174-184.
F. Foury, J. Hu and S. Vanderstraeten Mitochondrial DNA mutators, Cell Mol Life Sci
61 (2004) 2799-2811.
F. Ling, H. Morioka, E. Ohtsuka and T. Shibata A role for MHR1, a gene required for
mitochondrial genetic recombination, in the repair of damage spontaneously
introduced in yeast mtDNA, Nucleic Acids Res 28 (2000) 4956-4963.
S.A. Mookerjee and E.A. Sia Overlapping contributions of Msh1p and putative
recombination proteins Cce1p, Din7p, and Mhr1p in large-scale recombination and
genome sorting events in the mitochondrial genome of Saccharomyces cerevisiae,
Mutat Res 595 (2006) 91-106.
A. Kaniak, P. Dzierzbicki, A.T. Rogowska, E. Malc, M. Fikus and Z. Ciesla Msh1p
counteracts oxidative lesion-induced instability of mtDNA and stimulates
mitochondrial recombination in Saccharomyces cerevisiae, DNA Repair (Amst) 8
(2009) 318-329.
S. Boiteux, L. Gellon and N. Guibourt Repair of 8-oxoguanine in Saccharomyces
cerevisiae: interplay of DNA repair and replication mechanisms, Free Radic Biol Med
32 (2002) 1244-1253.
23
[15]
[16]
[17]
[18]
[19]
[20]
[21]
[22]
[23]
[24]
[25]
[26]
[27]
[28]
[29]
[30]
[31]
L. Eide, M. Bjoras, M. Pirovano, I. Alseth, K.G. Berdal and E. Seeberg Base excision
of oxidative purine and pyrimidine DNA damage in Saccharomyces cerevisiae by a
DNA glycosylase with sequence similarity to endonuclease III from Escherichia coli,
Proc Natl Acad Sci U S A 93 (1996) 10735-10740.
S. Senturker, P. Auffret van der Kemp, H.J. You, P.W. Doetsch, M. Dizdaroglu and S.
Boiteux Substrate specificities of the ntg1 and ntg2 proteins of Saccharomyces
cerevisiae for oxidized DNA bases are not identical, Nucleic Acids Res 26 (1998)
5270-5276.
R.A. Reenan and R.D. Kolodner Characterization of insertion mutations in the
Saccharomyces cerevisiae MSH1 and MSH2 genes: evidence for separate
mitochondrial and nuclear functions, Genetics 132 (1992) 975-985.
P. Dzierzbicki, P. Koprowski, M.U. Fikus, E. Malc and Z. Ciesla Repair of oxidative
damage in mitochondrial DNA of Saccharomyces cerevisiae: involvement of the
MSH1-dependent pathway, DNA Repair (Amst) 3 (2004) 403-411.
S.A. Mookerjee, H.D. Lyon and E.A. Sia Analysis of the functional domains of the
mismatch repair homologue Msh1p and its role in mitochondrial genome maintenance,
Curr Genet 47 (2005) 84-99.
B. Dujon Mitochondrial genetics and function, in: The molecular biology of the yeast
Saccharomyces: life cycle and inheritance, Cold Spring Harb. Lab., N.Y., 1981, pp.
505-635.
K.K. Singh, B. Sigala, H.A. Sikder and C. Schwimmer Inactivation of Saccharomyces
cerevisiae OGG1 DNA repair gene leads to an increased frequency of mitochondrial
mutants, Nucleic Acids Res 29 (2001) 1381-1388.
N.A. Doudican, B. Song, G.S. Shadel and P.W. Doetsch Oxidative DNA damage
causes mitochondrial genomic instability in Saccharomyces cerevisiae, Mol Cell Biol
25 (2005) 5196-5204.
E. Malc, P. Dzierzbicki, A. Kaniak, A. Skoneczna and Z. Ciesla Inactivation of the
20S proteasome maturase, Ump1p, leads to the instability of mtDNA in
Saccharomyces cerevisiae, Mutat Res 669 (2009) 95-103.
P. Jaruga and M. Dizdaroglu Repair of products of oxidative DNA base damage in
human cells, Nucleic Acids Res 24 (1996) 1389-1394.
K. Asagoshi, H. Terato, Y. Ohyama and H. Ide Effects of a guanine-derived
formamidopyrimidine lesion on DNA replication: translesion DNA synthesis,
nucleotide insertion, and extension kinetics, J Biol Chem 277 (2002) 14589-14597.
S.S. Wallace Biological consequences of free radical-damaged DNA bases, Free Radic
Biol Med 33 (2002) 1-14.
A. Boveris in: Biochemistry and genetics of yeast, Academic Press New York, N.Y.,
1978, pp. 65-80.
I.A. Cymerman, I. Chung, B.M. Beckmann, J.M. Bujnicki and G. Meiss EXOG, a
novel paralog of Endonuclease G in higher eukaryotes, Nucleic Acids Res 36 (2008)
1369-1379.
T.T. Paull Making the best of the loose ends: Mre11/Rad50 complexes and Sae2
promote DNA double-strand break resection, DNA Repair (Amst) 9 (2010) 12831291.
G.J. Williams, S.P. Lees-Miller and J.A. Tainer Mre11-Rad50-Nbs1 conformations
and the control of sensing, signaling, and effector responses at DNA double-strand
breaks, DNA Repair (Amst) 9 (2010) 1299-1306.
A.L. Goldstein and J.H. McCusker Three new dominant drug resistance cassettes for
gene disruption in Saccharomyces cerevisiae, Yeast 15 (1999) 1541-1553.
24
[32]
[33]
[34]
[35]
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46]
[47]
[48]
M. Binder, M. Schanz and A. Hartig Vector-mediated overexpression of catalase A in
the yeast Saccharomyces cerevisiae induces inclusion body formation, Eur J Cell Biol
54 (1991) 305-312.
W.P. Voth, Y.W. Jiang and D.J. Stillman New 'marker swap' plasmids for converting
selectable markers on budding yeast gene disruptions and plasmids, Yeast 20 (2003)
985-993.
J.E. Hill, A.M. Myers, T.J. Koerner and A. Tzagoloff Yeast/E. coli shuttle vectors
with multiple unique restriction sites, Yeast 2 (1986) 163-167.
M. Ogur, R. St. John and S. Nagai Tetrazolium overlay technique for population
studies of respiration deficiency in yeast, Science 125 (1957) 928-929.
M. Chaput, J. Brygier, Y. Lion and A. Sels Potentiation of oxygen toxicity by
menadione in Saccharomyces cerevisiae, Biochimie 65 (1983) 501-512.
H. Osorio, E. Carvalho, M. del Valle, M.A. Gunther Sillero, P. Moradas-Ferreira and
A. Sillero H2O2, but not menadione, provokes a decrease in the ATP and an increase
in the inosine levels in Saccharomyces cerevisiae. An experimental and theoretical
approach, Eur J Biochem 270 (2003) 1578-1589.
L. Benov, L. Sztejnberg and I. Fridovich Critical evaluation of the use of
hydroethidine as a measure of superoxide anion radical, Free Radic Biol Med 25
(1998) 826-831.
J. Frank, H.K. Biesalski, S. Dominici and A. Pompella The visualization of oxidant
stress in tissues and isolated cells, Histol Histopathol 15 (2000) 173-184.
J. Traba, E.M. Froschauer, G. Wiesenberger, J. Satrustegui and A. Del Arco Yeast
mitochondria import ATP through the calcium-dependent ATP-Mg/Pi carrier Sal1p,
and are ATP consumers during aerobic growth in glucose, Mol Microbiol 69 (2008)
570-585.
U.P. John and P. Nagley Amino acid substitutions in mitochondrial ATPase subunit 6
of Saccharomyces cerevisiae leading to oligomycin resistance, FEBS Lett 207 (1986)
79-83.
P. Nagley, R.M. Hall and B.G. Ooi Amino acid substitutions in mitochondrial ATPase
subunit 9 of Saccharomyces cerevisiae leading to oligomycin or venturicidin
resistance, FEBS Lett 195 (1986) 159-163.
F. Foury and S. Vanderstraeten Yeast mitochondrial DNA mutators with deficient
proofreading exonucleolytic activity, EMBO J 11 (1992) 2717-2726.
N. Guibourt and S. Boiteux Expression of the Fpg protein of Escherichia coli in
Saccharomyces cerevisiae: effects on spontaneous mutagenesis and sensitivity to
oxidative DNA damage, Biochimie 82 (2000) 59-64.
L. Letavayova, E. Markova, K. Hermanska, V. Vlckova, D. Vlasakova, M. Chovanec
and J. Brozmanova Relative contribution of homologous recombination and nonhomologous end-joining to DNA double-strand break repair after oxidative stress in
Saccharomyces cerevisiae, DNA Repair (Amst) 5 (2006) 602-610.
V.Y. Petrova, D. Drescher, A.V. Kujumdzieva and M.J. Schmitt Dual targeting of
yeast catalase A to peroxisomes and mitochondria, Biochem J 380 (2004) 393-400.
J.M. Cherry, C. Adler, C. Ball, S.A. Chervitz, S.S. Dwight, E.T. Hester, Y. Jia, G.
Juvik, T. Roe, M. Schroeder, S. Weng and D. Botstein SGD: Saccharomyces Genome
Database, Nucleic Acids Res 26 (1998) 73-79.
J.M. Cherry, E.L. Hong, C. Amundsen, R. Balakrishnan, G. Binkley, E.T. Chan, K.R.
Christie, M.C. Costanzo, S.S. Dwight, S.R. Engel, D.G. Fisk, J.E. Hirschman, B.C.
Hitz, K. Karra, C.J. Krieger, S.R. Miyasato, R.S. Nash, J. Park, M.S. Skrzypek, M.
Simison, S. Weng and E.D. Wong Saccharomyces Genome Database: the genomics
resource of budding yeast, Nucleic Acids Res 40 (2012) D700-705.
25
[49]
[50]
[51]
[52]
[53]
[54]
[55]
[56]
[57]
[58]
[59]
[60]
[61]
[62]
[63]
[64]
[65]
[66]
[67]
G. Baldacci, B. Cherif-Zahar and G. Bernardi The initiation of DNA replication in the
mitochondrial genome of yeast, Embo J 3 (1984) 2115-2120.
D.A. Clayton Replication and transcription of vertebrate mitochondrial DNA, Annu
Rev Cell Biol 7 (1991) 453-478.
M. de Zamaroczy, R. Marotta, G. Faugeron-Fonty, R. Goursot, M. Mangin, G.
Baldacci and G. Bernardi The origins of replication of the yeast mitochondrial genome
and the phenomenon of suppressivity, Nature 292 (1981) 75-78.
G. Baldacci and G. Bernardi Replication origins are associated with transcription
initiation sequences in the mitochondrial genome of yeast, Embo J 1 (1982) 987-994.
M. de Zamaroczy, G. Faugeron-Fonty, G. Baldacci, R. Goursot and G. Bernardi The
ori sequences of the mitochondrial genome of a wild-type yeast strain: number,
location, orientation and structure, Gene 32 (1984) 439-457.
C. von Sonntag Free-Radical-Induced DNA Damage and Its Repair: A Chemical
Perspective, Springer-Verlag Berlin, Heidelberg, 2006.
F. Paques and J.E. Haber Multiple pathways of recombination induced by doublestrand breaks in Saccharomyces cerevisiae, Microbiol Mol Biol Rev 63 (1999) 349404.
L.S. Symington Role of RAD52 epistasis group genes in homologous recombination
and double-strand break repair, Microbiol Mol Biol Rev 66 (2002) 630-670.
M. van den Bosch, P.H. Lohman and A. Pastink DNA double-strand break repair by
homologous recombination, Biol Chem 383 (2002) 873-892.
B.O. Krogh and L.S. Symington Recombination proteins in yeast, Annu Rev Genet 38
(2004) 233-271.
J.M. Daley, P.L. Palmbos, D. Wu and T.E. Wilson Nonhomologous end joining in
yeast, Annu Rev Genet 39 (2005) 431-451.
A. Sickmann, J. Reinders, Y. Wagner, C. Joppich, R. Zahedi, H.E. Meyer, B.
Schonfisch, I. Perschil, A. Chacinska, B. Guiard, P. Rehling, N. Pfanner and C.
Meisinger The proteome of Saccharomyces cerevisiae mitochondria, Proc Natl Acad
Sci U S A 100 (2003) 13207-13212.
J. Reinders, R.P. Zahedi, N. Pfanner, C. Meisinger and A. Sickmann Toward the
complete yeast mitochondrial proteome: multidimensional separation techniques for
mitochondrial proteomics, J Proteome Res 5 (2006) 1543-1554.
L. Kalifa, D.F. Quintana, L.K. Schiraldi, N. Phadnis, G.L. Coles, R.A. Sia and E.A.
Sia Mitochondrial genome maintenance: roles for nuclear nonhomologous end-joining
proteins in Saccharomyces cerevisiae, Genetics 190 (2012) 951-964.
R. Ayyagari, X.V. Gomes, D.A. Gordenin and P.M. Burgers Okazaki fragment
maturation in yeast. I. Distribution of functions between FEN1 and DNA2, J Biol
Chem 278 (2003) 1618-1625.
X. Wu and Z. Wang Relationships between yeast Rad27 and Apn1 in response to
apurinic/apyrimidinic (AP) sites in DNA, Nucleic Acids Res 27 (1999) 956-962.
D.X. Tishkoff, N. Filosi, G.M. Gaida and R.D. Kolodner A novel mutation avoidance
mechanism dependent on S. cerevisiae RAD27 is distinct from DNA mismatch repair,
Cell 88 (1997) 253-263.
X. Wu, T.E. Wilson and M.R. Lieber A role for FEN-1 in nonhomologous DNA end
joining: the order of strand annealing and nucleolytic processing events, Proc Natl
Acad Sci U S A 96 (1999) 1303-1308.
M. Akbari, T. Visnes, H.E. Krokan and M. Otterlei Mitochondrial base excision repair
of uracil and AP sites takes place by single-nucleotide insertion and long-patch DNA
synthesis, DNA Repair (Amst) 7 (2008) 605-616.
26
[68]
[69]
[70]
[71]
[72]
[73]
[74]
[75]
[76]
[77]
[78]
[79]
[80]
[81]
[82]
[83]
[84]
B. Szczesny, A.W. Tann, M.J. Longley, W.C. Copeland and S. Mitra Long patch base
excision repair in mammalian mitochondrial genomes, J Biol Chem 283 (2008)
26349-26356.
L. Kalifa, G. Beutner, N. Phadnis, S.S. Sheu and E.A. Sia Evidence for a role of FEN1
in maintaining mitochondrial DNA integrity, DNA Repair (Amst) 8 (2009) 12421249.
S. Buttner, T. Eisenberg, D. Carmona-Gutierrez, D. Ruli, H. Knauer, C. Ruckenstuhl,
C. Sigrist, S. Wissing, M. Kollroser, K.U. Frohlich, S. Sigrist and F. Madeo
Endonuclease G regulates budding yeast life and death, Mol Cell 25 (2007) 233-246.
E. Dake, T.J. Hofmann, S. McIntire, A. Hudson and H.P. Zassenhaus Purification and
properties of the major nuclease from mitochondria of Saccharomyces cerevisiae, J
Biol Chem 263 (1988) 7691-7702.
H.P. Zassenhaus and G. Denniger Analysis of the role of the NUC1 endo/exonuclease
in yeast mitochondrial DNA recombination, Curr Genet 25 (1994) 142-149.
E. Cabiscol, E. Piulats, P. Echave, E. Herrero and J. Ros Oxidative stress promotes
specific protein damage in Saccharomyces cerevisiae, J Biol Chem 275 (2000) 2739327398.
A. Baracca, G. Sgarbi, M. Mattiazzi, G. Casalena, E. Pagnotta, M.L. Valentino, M.
Moggio, G. Lenaz, V. Carelli and G. Solaini Biochemical phenotypes associated with
the mitochondrial ATP6 gene mutations at nt8993, Biochim Biophys Acta 1767 (2007)
913-919.
J. Subik, G. Takacsova and L. Kovac Intramitochondrial ATP and cell functions. I.
Growing yeast cells depleted of intramitochondrial ATP are losing mitochondrial
genes, Mol Gen Genet 166 (1978) 103-116.
F. Gomes, E.B. Tahara, C. Busso, A.J. Kowaltowski and M.H. Barros nde1 deletion
improves mitochondrial DNA maintenance in Saccharomyces cerevisiae coenzyme Q
mutants, Biochem J (2012 ).
C. Busso, E.B. Tahara, R. Ogusucu, O. Augusto, J.R. Ferreira-Junior, A. Tzagoloff,
A.J. Kowaltowski and M.H. Barros Saccharomyces cerevisiae coq10 null mutants are
responsive to antimycin A, Febs J 277 (2010) 4530-4538.
F. Ling and T. Shibata Recombination-dependent mtDNA partitioning: in vivo role of
Mhr1p to promote pairing of homologous DNA, Embo J 21 (2002) 4730-4740.
T.W. O'Rourke, N.A. Doudican, M.D. Mackereth, P.W. Doetsch and G.S. Shadel
Mitochondrial dysfunction due to oxidative mitochondrial DNA damage is reduced
through cooperative actions of diverse proteins, Mol Cell Biol 22 (2002) 4086-4093.
A. Lahaye, H. Stahl, D. Thines-Sempoux and F. Foury PIF1: a DNA helicase in yeast
mitochondria, EMBO J 10 (1991) 997-1007.
M. Mbantenkhu, X. Wang, J.D. Nardozzi, S. Wilkens, E. Hoffman, A. Patel, M.S.
Cosgrove and X.J. Chen Mgm101 is a Rad52-related protein required for
mitochondrial DNA recombination, J Biol Chem 286 (2011) 42360-42370.
E. Alani, R. Padmore and N. Kleckner Analysis of wild-type and rad50 mutants of
yeast suggests an intimate relationship between meiotic chromosome synapsis and
recombination, Cell 61 (1990) 419-436.
E.L. Ivanov, V.G. Korolev and F. Fabre XRS2, a DNA repair gene of Saccharomyces
cerevisiae, is needed for meiotic recombination, Genetics 132 (1992) 651-664.
D.A. Bressan, B.K. Baxter and J.H. Petrini The Mre11-Rad50-Xrs2 protein complex
facilitates homologous recombination-based double-strand break repair in
Saccharomyces cerevisiae, Mol Cell Biol 19 (1999) 7681-7687.
27
[85]
[86]
[87]
[88]
[89]
[90]
[91]
[92]
[93]
[94]
[95]
[96]
Y. Tomizawa, A. Ui, F. Onoda, H. Ogiwara, S. Tada, T. Enomoto and M. Seki Rad50
is involved in MMS-induced recombination between homologous chromosomes in
mitotic cells, Genes Genet Syst 82 (2007) 157-160.
M. Grenon, C. Gilbert and N.F. Lowndes Checkpoint activation in response to doublestrand breaks requires the Mre11/Rad50/Xrs2 complex, Nat Cell Biol 3 (2001) 844847.
D. D'Amours and S.P. Jackson The Mre11 complex: at the crossroads of dna repair
and checkpoint signalling, Nat Rev Mol Cell Biol 3 (2002) 317-327.
X. Zhao, A. Chabes, V. Domkin, L. Thelander and R. Rothstein The ribonucleotide
reductase inhibitor Sml1 is a new target of the Mec1/Rad53 kinase cascade during
growth and in response to DNA damage, Embo J 20 (2001) 3544-3553.
V. Pawar, L. Jingjing, N. Patel, N. Kaur, P.W. Doetsch, G.S. Shadel, H. Zhang and W.
Siede Checkpoint kinase phosphorylation in response to endogenous oxidative DNA
damage in repair-deficient stationary-phase Saccharomyces cerevisiae, Mech Ageing
Dev 130 (2009) 501-508.
S.J. Elledge and R.W. Davis Identification and isolation of the gene encoding the
small subunit of ribonucleotide reductase from Saccharomyces cerevisiae: DNA
damage-inducible gene required for mitotic viability, Mol Cell Biol 7 (1987) 27832793.
M. Huang and S.J. Elledge Identification of RNR4, encoding a second essential small
subunit of ribonucleotide reductase in Saccharomyces cerevisiae, Mol Cell Biol 17
(1997) 6105-6113.
X. Zhao, E.G. Muller and R. Rothstein A suppressor of two essential checkpoint genes
identifies a novel protein that negatively affects dNTP pools, Mol Cell 2 (1998) 329340.
S. Steininger, F. Ahne, K. Winkler, A. Kleinschmidt, F. Eckardt-Schupp and S. Moertl
A novel function for the Mre11-Rad50-Xrs2 complex in base excision repair, Nucleic
Acids Res 38 (2010) 1853-1865.
A.W. Tann, I. Boldogh, G. Meiss, W. Qian, B. Van Houten, S. Mitra and B. Szczesny
Apoptosis induced by persistent single-strand breaks in mitochondrial genome: critical
role of EXOG (5'-EXO/endonuclease) in their repair, J Biol Chem 286 (2011) 3197531983.
D. Kang and N. Hamasaki Maintenance of mitochondrial DNA integrity: repair and
degradation, Curr Genet 41 (2002) 311-322.
I. Shokolenko, N. Venediktova, A. Bochkareva, G.L. Wilson and M.F. Alexeyev
Oxidative stress induces degradation of mitochondrial DNA, Nucleic Acids Res 37
(2009) 2539-2548.
Legends to Figures
Fig. 1. Mitochondrial DNA instability induced by antimycin or menadione. Cultures of
FF18733 were grown either in YPG (A) or YPD medium (B). Cells were treated either with
antimycin or menadione for 4 h, and then cultivated for further 4 h in fresh YPG or YPD,
respectively. The frequencies of Olir, Eryr (except for cells treated with menadione in YPG
medium) and petite mutants were determined. Each bar in panels A and B represents the
28
average value obtained from two separate experiments in which at least 10 independent
cultures of each strain was used. Error bars indicate standard deviations.
Fig. 2. Effect of the pCTA1 plasmid on the generation of antimycin-induced petite mutants.
Cultures of FF18733 either the pCTA1 plasmid or YEp352 (vector) were grown in YPG
medium supplemented with G418 (200 μg/ml). Cells were treated for 4 h with antimycin, and
subsequently grown for 16 h in fresh YPG. The frequency of petite mutants was then
determined. Each bar represents the average value obtained from two separate experiments in
which 10 independent cultures of each strain was used. Error bars indicate standard
deviations. ***P< 0.0005.
Fig. 3. Sequence analysis of mtDNA in antimycin-induced respiration-deficient petite
mutants. Two wild-type mtDNA strains and 22 antimycin-induced rho¯ mutants were
analyzed. Sequences of mtDNA from rho¯ mutants were divided into 3 groups based on the
ori site they include. (A) The analysis of wild-type mtDNA. (B) The plot corresponds to
mtDNA from rho¯ mutants containing ori2. (C) The analysis of mtDNA from rho¯ mutants
containing ori3. (D) The plot corresponds to mtDNA from rho¯ mutants containing ori5
and/or ori1 (in one case also ori2). The labels corresponding to the lines in panels B-D
represent individual rho¯ strains that were used in sequencing.The labels corresponding to the
lines in panels B-D represent individual rho¯ strains that were used in sequencing. In all four
panels, the X axis shows the nucleotide position within mtDNA, whereas the Y axis shows the
coverage per one copy of mtDNA. The positions of ori sequences are represented by red
arrows on the x axis. The arrowheads show the orientations of ori sequences, i.e. the direction
from cluster C to cluster A [53]. The map of the wild-type mtDNA, in the same scale as the
plots, is included above the Panel A with positions of the main genes coded by mtDNA.
Fig. 4. Effect of antimycin on the stability of mtDNA in rad50Δ and xrs2Δ mutants (A) and
in yku70Δ and rad50Δ yku70Δ mutants (B). Mitochondrial recombination within the ARG8m
gene (C and D). (A) Cultures of FF18733, YAK322 (rad50Δ) and YAK490 (xrs2Δ) grown in
YPG medium were treated for 4 h with antimycin; subsequently, the cells were cultivated in
fresh YPG medium for 4 h. The frequency of petite mutants was determined. Each bar
represents the average value obtained from two separate experiments in which at least 10
independent cultures of each strain were tested. (B) Cultures of FF18733, YAK322 (rad50Δ),
YAK671 (yku70Δ), and YAK675 (rad50Δ yku70Δ), were treated as in (A). Each bar
29
represents the average value obtained from three separate experiments in which at least 10
independent cultures of each strain were tested. **P< 0.005, ***P< 0.0005. (C) Schematic
representation of the two arg8m alleles in mtDNA of the parental strains. The interval between
the mutational alterations, conferring Arg¯ phenotype, in the two alleles of the parental strains
is indicated. (D) Crosses between YAK29/1 (cox3::arg8m-1) and CAB183-1 (cox3::arg8m::
(AT)16 +1), YAK55 (YAK29/1 rad50Δ) and YAK58 (CAB183-1 rad50Δ), YAK516
(YAK29/1 xrs2Δ) and YAK518 (CAB183-1 xrs2Δ), were performed as described in Section
2 and the percentage of Arg+ in diploid cultures determined. Each bar represents the average
of median values obtained from at least three separate experiments in which 10 to 16 crosses
for each parental pair, as listed above, were tested. The values were normalized as described
in Section 2 and [13]. Error bars indicate standard deviations. *P< 0.05, **P< 0.005 (as
determined by two-tailed t-test statistics).
Fig. 5. Effect of antimycin on the stability of mtDNA in the ogg1Δ rad50Δ double mutant.
Cultures of FF18733, CD138 (ogg1Δ), YAK322 (rad50Δ) and YAK870 (ogg1Δ rad50Δ)
grown in YPG medium were treated with antimycin for 4 h and subsequently cultivated in
antimycin-free YPG for 16 h. The frequency of petite mutants was determined. Each bar
represents the average value obtained from three separate experiments in which 10
independent cultures of each strain were tested. Error bars indicate standard deviations.
***P< 0.0005.
Fig. 6. Effect of antimycin on the stability of mtDNA in rad27Δ, nuc1Δ single mutants and a
nuc1Δ rad50Δ double mutant. (A) Cultures of FF18733, YAK254 (rad27Δ) and YAK512
(nuc1Δ) grown in YPG medium were treated with antimycin for 4 h and subsequently
cultivated in antimycin-free YPG medium for 4 h. The frequency of petite mutants was
determined. Each bar represents the average value obtained from two separate experiments in
which 10 independent cultures of each strain were tested. Error bars indicate standard
deviations. (B) Cultures of FF18733, YAK512 (nuc1Δ), YAK322 (rad50Δ) and YAK757
(nuc1Δ rad50Δ) grown in YPG medium were treated with antimycin for 4 h and subsequently
cultivated in antimycin-free YPG medium for 16 h. Each bar represents the average value
obtained from two separate experiments in which 10 independent cultures of each strain were
tested. ***P< 0.0005.
30
Supplementary Fig. S1. Mitochondrial DNA instability induced by menadione or antimycin
in ogg1Δ and ntg1Δ mutants. Cultures of FF18733, CD138 (ogg1Δ) and CD183 (ntg1Δ) were
grown in YPG medium. Cells were treated for 4 h either with menadione (A) or antimycin
(B), and then cultivated for further 4 h in fresh YPG. The frequencies of Olir and petite
mutants were determined. Each bar represents the average of median values obtained from
two separate experiments in which at least 10 independent cultures of each strain was used.
Error bars indicate standard deviations.
Table 1
S. cerevisiae strains used in this study.
Strain
FF18733
FF18734
CD138
CD183
CAB183-1
YAK29/1
GW22
MCC259
YAK55
YAK58
YAK322
YAK490
YAK516
YAK518
YAK254
YAK512
YAK671
YAK675
YAK870
YAK757
Relevant genotype
MATa leu2-3,112 trp1-289 ura3-52 his-7 lys1-1
MATα leu2-3,112 trp1-289 ura3-52 his-7 lys1-1
FF18733 ogg1Δ::TRP1
FF18733 ntg1Δ::URA3
MATa ura3-52 leu2-3 lys2 his3 arg8Δ::hisG/cox3::arg8m (AT)16 + 1
MATα ade2-101 leu2 ura3-52 arg8Δ::URA3 kar1-1/cox3::arg8m - 1
MATa lys2/+ cox3-421
MATα ade2-101 ura3-52 kar1-1/– [COX3]
YAK29/1 rad50Δ::kanMX
CAB183-1 rad50Δ::kanMX
FF18733 rad50Δ::kanMX
FF18733 xrs2Δ::kanMX
YAK29/1 xrs2Δ::kanMX
CAB183-1 xrs2Δ::kanMX
FF18733 rad27Δ::kanMX
(a segregant like FF18733) nuc1Δ::hphMX
(a segregant like FF18733) yku70Δ::hphMX
(a segregant like FF18733) yku70Δ::hphMX rad50Δ::kanMX
(a segregant like FF18733) ogg1Δ::TRP1 rad50Δ::kanMX
(a segregant like FF18733) nuc1Δ::hphMX rad50Δ::kanMX
Reference
F. Fabre
F. Fabre
S. Boiteux
S. Boiteux
E. A. Sia
[14]
T. D. Fox
T. D. Fox
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
This study
31
Table 2
ROS levels in antimycin- and menadione-treated cells
Cells
Medium
Fluorescent dye
RFU
Fold effect
YPG
DHE
untreated
35.76 ± 0.86
1
+ menadione
58.96 ± 4.94
1.7
+ antimycin A
52.04 ± 3.77
1.5
untreated
15.88 ± 1.79
1
+ menadione
38.91 ± 7.19
2.5
+ antimycin A
81.80 ± 17.12
5.2
untreated
17.63 ± 2.32
1
+ antimycin A
73.37 ± 12.12
4.2
YPG
YPD
DCFH-DA
DCFH-DA
Fluorometric results of DCFH-DA and DHE fluorescence on cells treated either with
menadione or antimycin. FF18733 was grown either in YPG or YPD medium at 30ºC and
harvested in the exponential phase of growth. Dichlorofluoresceine diacetate and
dihydroethidine assays were performed as described in Section 2. The RFU values represent
relative fluorescence normalized for 106 cells assayed. Each value represents the mean value
obtained from four independent measurements. Standard deviations are indicated.
32
Table 3
ATP levels in antimycin- or menadione-treated cells
Cells
RLU/106 cells
Relative level (%)
untreated
1175 ± 102
100
+ antimycin A
647 ± 74
55.1
+ menadione
950 ± 107
80.1
For the assay, FF18733 was grown in YPG at 30ºC and treated in fresh YPG with
indicated compounds for 4 hours (concentrations of these compounds during the treatment as
in Section 2). Cells were harvested immediately after the treatment. The assay was performed
as described in Section 2. The RLU values are in relative luminescence units measured with a
Glomax 20/20 luminometer/Promega in its internal luminescence units. Luminescence of a
blank sample (an aliquot of YPG without cells equal to the volume of a cell sample) was
deducted from each measurement of a cell sample. Each value represents the mean value
obtained from duplicate samples retrieved from five cultures treated in the same way.
Standard deviations are indicated. For the difference between ATP level in cells treated with
antimycin and that in untreated cells P value was 0.01 (using the Mann-Whitney statistics).
33
Fig.1
34
Fig. 2
35
Fig3.
36
Fig. 4
37
Fig.5
38
Fig. 6
39
Fig. S1
40