Online Appendix for the following JACC article
TITLE: Cannabidiol Attenuates Cardiac Dysfunction, Oxidative Stress, Fibrosis,
Inflammatory and Cell Death Signaling Pathways in Diabetic Cardiomyopathy
AUTHORS: Mohanraj Rajesh, PhD, Partha Mukhopadhyay, PhD, Sándor Bátkai MD,
PhD, Vivek Patel, Keita Saito, PhD, Shingo Matsumoto, PhD, Yoshihiro Kashiwaya, MD,
PhD, Bela Horvath, MD, PhD, Bani Mukhopadhyay, PhD, Lauren Becker, György Haskó,
MD, PhD, Lucas Liaudet, MD, David A. Wink, Aristidis Veves, MD, PhD, Raphael
Mechoulam, PhD, Pál Pacher, MD, PhD
APPENDIX
Detailed Methods
Animals and treatment
All the animal protocols conformed to the National Institutes of Health (NIH) guidelines
and were approved by the Institutional Animal Care and Use Committee of NIAAA/NIH.
Diabetes mellitus was induced in 8- to 12-week-old C57/BL6J mice weighing 23 to 25 g
(male, Jackson Laboratories, Bar Harbor, ME) by intraperitoneal (IP) injection of
streptozotocin (STZ, Sigma Chemicals) at the dose of 50 mg/kg dissolved in 100 mM
citrate buffer pH 4.5 for 5 consecutive days. After 1 week, blood glucose levels were
measured using Ascensia Counter Glucometer (Bayer Healthcare, NY) by mandibular
1
puncture blood sampling. Mice that had blood sugar values >250 mg/dl were used for the
study. In the first set of experiments type I diabetic mice were treated with cannabidiol
(CBD [1, 10, or 20 mg/kg IP]) or vehicle for 11 weeks (Supplemental Fig. 1). The CBD
treatment was initiated after the establishment of frank type 1 diabetes mellitus (insulingenerating beta cells were already destroyed by multiple injections of streptozotocin) in
order to avoid the potential protective effects of CBD against the destruction of beta cells
and establishment of type 1 diabetes. In another set of experiments, 8 weeks diabetic
mice were treated with CBD (20 mg/kg) or vehicle for 4 weeks (Supplemental Fig. 2).
The second set of experiments was aimed to evaluate if CBD was able to attenuate the
already developed myocardial fibrosis (myocardial fibrosis in this model starts to develop
from 4 weeks of established diabetes and peaks around 6 to 8 weeks). The corresponding
control groups were treated with either vehicle or CBD alone for the same duration. All
the animals were provided with food and water ad libitum. In another set of experiments,
at the indicated time points (Supplemental Figs. 1 and 2) blood glucose was determined
and pancreas insulin content was also measured. The CBD was from Tocris (Ellisville,
MO) or isolated as described earlier (1).
Hemodynamic measurements in mice
Left ventricular performance was measured in mice anesthetized with 2% isoflurane
using a 1F microtip pressure-volume catheter (PVR 1045, Millar Instruments, Houston,
TX) coupled with ARIA pressure–volume conductance system (Millar Instruments) and a
Powerlab/4SP A/D converter (AD Instruments, Mountain View, CA), as previously
described (2–6).
2
Determination of glycosylated hemoglobin (HbA1C)
Glycosylated hemoglobin (HbA1C) levels in the EDTA whole blood was determined
using the commercially available reagents procured from Stanbio Laboratory (Boerne,
TX).
Pancreas insulin content
Mice were sacrificed at the indicated time points, and pancreas tissues were excised
carefully and immediately snap frozen in liquid nitrogen. The samples were processed as
described previously and insulin content in the pancreas was determined using the ELISA
kit (ALPCO diagnostics, Salem, NH) (2).
Determination of SOD activity and GSH/GSSG content
The SOD activities and glutathione (GSH) and oxidized glutathione (GSSG) levels in the
myocardial tissues were determined using commercially available kits procured from
Trevigen (Gaithersburg, MD) as described (4,5).
Determination of lipid peroxidation
Myocardial malondialdehyde (MDA) or 4 hydroxynonenal levels (4-HNE) levels were
determined by kits obtained from Cayman Chemicals (Ann Arbor, MI) and Trevigen,
respectively as described (4,5,7).
3
Determination of myocardial ROS by electron paramagnetic resonance
spectrometer (EPR)
Myocardial ROS levels were determined by EPR using the spin probe 1-hydroxy-3methoxycarbonyl-2,2,5,5-tetramethylpyrrolidine (CMH) obtained from Enzo Life
Sciences (Plymouth Meeting, PA) as described earlier (8,9). The measurements were
performed using Varian X-band EPR system (Walnut Creek, CA) with the following
settings: center field 3364 G; field sweep 80 G; microwave power 20 mW; modulation
amplitude 2 G; field modulation frequency 100 kHz; microwave frequency 9.358 GHz,
and time constant 64 ms. In brief, 10 to 15 mg of myocardial tissue from each sample
was rinsed thoroughly in 20 mM KHB buffer containing iron chelator 5 M DETC, to
remove the contamination and to reduce the artifact. Then the samples were minced with
fine scissors and incubated in KHB buffer containing the spin probe CMH (200 M) at
37C for 30 min, and then the reaction was arrested by placing the samples in ice.
Subsequently an aliquot (150 l) from the samples were loaded onto capillary tubes, and
ROS levels were determined using EPR system as described above.
Reverse transcription and real-time PCR
Heart tissues were homogenized and total RNA was isolated using Trizol LS reagent
(Invitrogen) according to the manufacturer’s instruction. The RNA was treated with
RNase-free DNase (Ambion, TX) to remove traces of genomic DNA contamination.
Total RNA was then reverse-transcribed to cDNA using Super-Script II (Invitrogen), and
the target genes were amplified using the standard real-time PCR kit (Applied
Biosystems, Foster City, CA). The amplification was performed in real-time PCR system
4
(Applied Biosystems) using the following conditions: initial denaturation at 95°C for 2
min followed by 35 cycles was performed at 95°C for 30 s and 60°C for 30s. The-fold
induction/repression in gene expression by real-time RT-PCR was calculated after
adjusting for -actin using the formula 2–
Ct
. Primers used for amplification of
respective genes are described in (see Appendix Table 1).
Determination of PARP and caspase 3/7 activities
Determination of PARP and caspase 3/7 activities in the heart homogenates or human
cardiomyocyte extracts was performed using kits (Trevigen, and Promega, Madison, WI)
as described (4,5).
TUNEL staining
Paraffin sections were dewaxed, and in situ detection of apoptosis in the myocardial
tissues was performed by terminal deoxynucleotodyltransferase mediated nick-end
labeling (TUNEL) assay as per the instruction provided with the kit (Roche Diagnostics,
Indianapolis, IN). After TUNEL labeling, sections were stained with mouse monoclonal
-actinin (cardiomyocyte marker, 1:100 dilution, DBS) for 1 h, followed by incubation
with appropriate secondary antibody conjugated with Texas Red (Vector Laboratories,
Burlingame, CA). Nucleus was labeled with DAPI, and the TUNEL positive cells were
observed using LSM Pascal confocal microscope (Carl Zeiss; using 40 objective) (4).
Quantitative TUNEL assay
5
Quantitative TUNEL assay was determined using DELFIA DNA fragmentation assay kit
(Perkin Elmer Life Sciences, Boston, MA) and was performed in 96-well microplate (Pall
Life Sciences, Ann Arbor, MI) as described by us previously (6). In brief, equal mount of
myocardial total lysates was adsorbed on to the plates, following fixation, then 50 l of
reaction solution (0.01% CHAPS buffer, 5.5 units TdT enzyme, 15 M dTTP, 5 M BiodUTP, and TdT buffer) and incubated at 37C for 30 min. Then wells were washed with
DELFIA plate wash solution. Then Europium (EU)-labeled streptavidin was diluted in
DELFIA assay buffer and incubated for 1 h at room temperature; after washing, 200
l/well enhancement solution was added, and the fluorescence was measured in VICTOR
plate reader (Perkin Elmer Life Sciences).
Cell death ELISA
The quantitative determination of cytoplasmic histone-associated DNA fragments (mono
and oligonucleosomes) due to in vivo cell death were measured using ELISA kit (Roche
Diagnostics GmbH) (4,5).
Determination of 3-nitrotyrosine (3-NT) content
Quantification of 3-NT levels in the heart tissues/human cardiomyocyte extracts were
performed using ELISA kit (Hycult Biotechnology, Uden, the Netherlands) (4,5).
Determination of protein carbonyl content
Protein oxidation is defined as the covalent modification of the proteins induced by
reactive oxygen species. Oxidative modification of proteins can be induced by wide array
6
of pro-oxidant stimulus, and elevated levels were demonstrated in several pathological
conditions. Here, we used commercially available reagents (Cell Biolabs Inc., San Diego,
CA) to measure the protein carbonyl levels in the myocardial samples. In brief, BSA
standards or protein samples were adsorbed on to 96-well plates for 2 h at 37C. The
protein carbonyls present in the samples or standards were derivatized to DNP
hydrazones with dinitrophenylhydrazine (DNPH) and incubated with anti-DNP antibody,
followed with HRP conjugated secondary antibody. Then the absorbance was measured
at 450 nm using the ELISA plate reader.
Detection of 3-NT modified proteins in myocardial tissues by immunoprecipitation
In brief, equal amount of tissue homogenates (200 g protein) was mixed with 20 g of
3-NT affinity sorbent (NT antibody crosslinked to protein A-agarose, Cayman Chemicals)
and incubated at 4C in a rocking rotor. Then the immunoprecipitates were washed thrice
with PBS containing 0.1% Triton X-100. The immunoprecipitates were dissolved in
Laemmli buffer containing DTT, and the samples were subjected to SDS-PAGE analysis;
then the 3-NT proteins were detected by Silver stain as described previously (5).
Western immunoblot analysis
Heart tissues were homogenized in mammalian tissue protein extraction reagent (TPER,
Pierce Biotechnology, Rockford, IL) supplemented with protease and phosphatase
inhibitors (Roche, GmbH). In case of cells, they were lyzed in RIPA buffer supplemented
with protease and phosphate inhibitors. Blots were probed with either rabbit iNOS/TNF antibody, p38 MAPK, phospho p38 (Thr 180/Tyr 182) MAPK, IB-α, phospho (Ser
7
32/36) IB-α, p42/44MAPK, phospho (Thr 202/Tyr204) p42/44 MAPK, cleaved
caspase-3 antibody, SAPK/JNK, phospho SAPK/JNK (Thr183/Tyr185), p38/ MAPK,
MAPKAPK2/phosphoMAPKAPK2 (Thr334) (all obtained from Cell Signaling
Technology, Beverly, MA) and were used at 1:1000 dilution and incubated overnight at
4C. Anti-mouse ICAM-1/VCAM-1 (goat polyclonal antibodies) were procured from
R&D Systems (Minneapolis, MN). After subsequent washing with PBST, the membranes
were probed with appropriate secondary antibodies conjugated with HRP (Pierce
Biotechnology) and incubated 1 h at RT. Then the membranes were developed using
chemiluminescence detection kit (Super Signal-West Pico Substrate, Pierce
Biotechnology). To confirm uniform loading, membranes were stripped and re-probed
with -actin (Chemicon, Ramona, CA). Simultaneously, nuclear fractions were prepared
from the heart tissues/human cardiomyocytes using nuclear protein extraction reagent
according to the manufacturer’s instruction (Pierce Biotechnology), and 20 g of protein
was resolved on 12% SDS-PAGE and p65NF-B translocation was determined by
Western blot analysis using monoclonal p65NF-B (BD Biosciences) to verify equal
loading, the membrane was probed with histone antibody (Cell Signaling Technology).
Determination of NF-κB activation by gel shift assay
The NF-κB activation in the myocardial tissue samples or cell lysates was performed
using the reagents and the accompanying protocols from Panomics, Inc. (Fremont, CA).
In brief, the nuclear extracts were incubated with biotin-labeled transcription factor probe,
and then the protein/DNA complexes were separated on a non-denaturing polyacrylamide
gel. The gel was transferred to a biodyne membrane and detected using streptavidin-HRP
8
and a chemiluminescent substrate. The shifted bands corresponding to the protein/DNA
complexes were identified relative to the unbound dsDNA. The bands were visualized
after exposure to the X-ray film.
Immunohistochemistry
Heart samples were fixed in 4% buffered formalin. After paraffin embedding, 5 μm
sections were stained with either 3-NT (mouse monoclonal, Cayman Chemicals) at 1:100
dilution for 12 h at 4C. Then the sections were incubated with anti-mouse HRP reagent
(Signal Stain Boost IHC detection reagent, R&D Systems) for 1 h at room temperature
and then developed with peroxide-based substrate Vectastain DAB kit (Vector
Laboratories, Burlingame, CA). Subsequently, the sections were counterstained with
nuclear fast red for 3 min. Finally, the sections were dehydrated in ethanol and cleared in
xylene and mounted. In addition, heart samples frozen in optimal cutting temperature
(OCT) resin were sectioned using cryo-microtome and processed for 3-NT staining with
the aforementioned 3-NT monoclonal antibody and secondary antibody being anti-mouse
FITC; the nucleus was stained with DAPI, and images were acquired using confocal
microscope-LSM Pascal confocal microscope (Carl Zeiss, using 40 objective).
Sirius red staining for collagen
Tissue sections were stained with picro-sirius red satin solution for 1 h at room
temperature. Then slides were washed in two changes of acidified water (0.5% acetic
acid) for 2 min, and excess of water was removed by blotting. Finally, the sections were
dehydrated in 100% alcohol and cleared in xylene and mounted with cover glass.
9
Cell culture studies
Human cardiomyocytes (HCM) along with the culture medium were purchased from
ScienCell Research Laboratories (Carlsbad, CA). The cells were maintained in 5% CO2
environment at 37C. Prior to the experiments, cells were grown to 80% to 90%
confluence in polyl-lysine coated culture dishes and then conditioned in 2% FBS medium
for 6 h. Cells were treated with 30 mM-L-glucose or 30 mM D-glucose, designated as
high glucose (HG)±CBD (4 µM) for 48 h. Then, cells were harvested and processed for
the downstream assays.
Determination of cytosolic and mitochondrial ROS generation and apoptosis by
flow cytometry
Cells were treated as described above, and 5-(and-6)-chloromethyl-2′,7′dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Molecular Probes, CA) was used
to detect intracellular (cytosolic) generation of reactive oxygen species (ROS). HCM
cells were loaded with 10 μM CM-H2DCFDA for 30 min in the dark. After loading, cells
were trypsinized for 2 min and washed with warm HCM medium without phenol red.
Production of ROS was determined by measuring the change in the fluorescence due to
intracellular production of CM-DCF (5-(and-6)-chloromethyl-2′, 7′-dichlorofluorescein)
caused by oxidation of CM-H2DCF by ROS. The CM-DCF fluorescence was measured
with excitation wavelength of 488 nm and an emission wavelength of 520 nm (FL1
channel) using the BD FACS Calibur system (BD Biosciences).
10
Simultaneous mitochondrial superoxide/ROS generation and cell death were
determined as described previously in detail (10). Briefly, cells were loaded with
MitoSOX Red for 30 min followed by trypsinization as well as staining with APCAnnexin-V and Sytox Green. Samples were run on the flow cytometer with 488 nm
excitation to measure oxidized MitoSOX Red in the FL2 and FL3 channel, respectively,
and APC-Annexin V (FL4) and Sytox Green (FL1). Data were also collected from the
FSC (forward scatter), SSC (side scatter), and FL1 and FL4 channels. Cells were plotted
for FSC and SSC. Cell debris with low FSC and SSC were excluded from analyses. Then,
cells were analyzed for APC-Annexin V (FL4) and Sytox Green (FL1). Apoptotic and
late apoptotic/necrotic cells (Annexin V and Annexin V and Sytox Green positive) were
excluded for analyses, and MitoSOX Red was analyzed for each cell population as a
histogram of mean intensity (FL2). Thus, MitoSOX Red of each cell population was
analyzed, excluding any nonspecific interference from apoptotic and nonviable cells, in
which MitoSOX Red can bind to the nucleus (10).
Statistical analysis
Results are expressed as mean ± SEM. Statistical comparisons were made by one-way
ANOVA followed by Newman-Keuls post-hoc analysis using GraphPad Prism 5
software (San Diego, CA). When heterogeneity of variance was present (Fig. 3A, D, E, G;
Fig. 2E, F; Fig. 4A, B; Fig. 5C, D; Fig. 6B, C, D; Fig. 8A; and Supplemental Fig. 4A, B,
D; Supplemental Fig. 6B; Supplemental Fig. 8A), ANOVA was also performed after
logarithmic transformation of the data, followed by Newman-Keuls post-hoc analysis.
Probability values of p < 0.05 were considered significant.
11
Appendix References
1. Gaoni Y, Mechoulam R. The isolation and structure of delta-1-tetrahydrocannabinol
and other neutral cannabinoids from hashish. J Am Chem Soc 1971;93:217-24.
2. Mabley JG, Pacher P, Murthy KG, et al. The novel inosine analogue, INO-2002,
protects against diabetes development in multiple low-dose streptozotocin and non-obese
diabetic mouse models of type I diabetes. J Endocrinol 2008;198:581-9.
3. Pacher P, Nagayama T, Mukhopadhyay P, Batkai S, Kass DA. Measurement of cardiac
function using pressure-volume conductance catheter technique in mice and rats. Nat.
Protocols 2008;3:1422-1434.
4. Mukhopadhyay P, Rajesh M, Batkai S, et al. CB1 cannabinoid receptors promote
oxidative stress and cell death in murine models of doxorubicin-induced cardiomyopathy
and in human cardiomyocytes. Cardiovasc Res;85:773-84.
5. Mukhopadhyay P, Rajesh M, Batkai S, et al. Role of superoxide, nitric oxide, and
peroxynitrite in doxorubicin-induced cell death in vivo and in vitro. Am J Physiol Heart
Circ Physiol 2009;296:H1466-83.
6. Mukhopadhyay P, Bátkai S, Rajesh M, et al. Pharmacological Inhibition of CB1
Cannabinoid Receptor Protects Against Doxorubicin-Induced Cardiotoxicity. Journal of
the American College of Cardiology 2007;50:528-536.
7. Moon KH, Hood BL, Mukhopadhyay P, et al. Oxidative inactivation of key
mitochondrial proteins leads to dysfunction and injury in hepatic ischemia reperfusion.
Gastroenterology 2008;135:1344-57.
12
8. Dikalov SI, Li W, Mehranpour P, Wang SS, Zafari AM. Production of extracellular
superoxide by human lymphoblast cell lines: comparison of electron spin resonance
techniques and cytochrome C reduction assay. Biochem Pharmacol 2007;73:972-80.
9. Mariappan N, Elks CM, Fink B, Francis J. TNF-induced mitochondrial damage: a link
between mitochondrial complex I activity and left ventricular dysfunction. Free Radic
Biol Med 2009;46:462-70.
10. Mukhopadhyay P, Rajesh M, Hasko G, Hawkins BJ, Madesh M, Pacher P.
Simultaneous detection of apoptosis and mitochondrial superoxide production in live
cells by flow cytometry and confocal microscopy. Nat Protoc 2007;2:2295-301.
13
Supplemental Figure 1. CBD treatment for 11 weeks (starting from 1 week of
established diabetes) does not alter the blood glucose/pancreas insulin
content/glycosylated hemoglobin levels or body weights
(A) Schematic representation of diabetes induced by multiple IP injections of STZ as
described in Methods. Mice that exhibited blood glucose >250 mg/dl were randomly
distributed in groups and used for the studies (this was considered the onset of diabetes).
One week after established diabetes, diabetic mice (or corresponding controls) were
treated with CBD 1, 10, and 20 mg/kg daily IP for 11 weeks, followed by hemodynamic
and/or biochemical measurements. Blood glucose levels at the indicated time points with
the varying concentrations (1, 10, and 20 mg/kg) of CBD treatment is shown, n = 12 to
14 per group. (B) The pancreas insulin content at the indicated time points is shown with
the varying concentrations (1, 10, and 20 mg/kg) of CBD treatment, n = 12 to 14 per
group. (C) Shows the glycosylated hemoglobin levels in the respective groups
determined at the conclusion of the study is shown. *p < 0.05 vs. vehicle/CBD, n = 12 to
14 per group. (D) The body weights are shown. *p < 0.05 vs. vehicle or Vehicle+CBD;
#p < 0.05 vs. diabetes (D) or diabetes+CBD; n = 12 to 14 per group.
14
15
Supplemental Figure 2. CBD for 4 weeks (starting from 8 weeks of established
diabetes) does not alter the blood glucose/pancreas insulin content
(A) In this protocol, diabetes was established for 8 weeks (at this time point, all
functional and biochemical characteristics of diabetic cardiomyopathy, including
myocardial fibrosis, are fully developed), followed by CBD or vehicle treatment for 4
weeks. Shown are the blood glucose levels at the indicated time points with the varying
concentrations (1, 10, and 20 mg/kg) of CBD treatment, n = 12 per group. (B) The
pancreas insulin content glucose levels at the indicated time points with the varying
concentrations (1, 10, and 20 mg/kg) of CBD treatment is shown, n = 12 per group.
16
17
Supplemental Figure 3. CBD treatment reverses/attenuates the diabetes-induced
established cardiac dysfunction
CBD treatment (20 mg/kg daily IP) of 8-week diabetic mice for 4 weeks
attenuates/reverses diabetes-induced cardiac dysfunction. Results are mean ± SEM of 8 to
11 per group. *p < 0.05 vs. vehicle control/CBD alone; #p < 0.05 vs. diabetes.
18
19
Supplemental Figure 4. CBD treatment attenuates/reverses the diabetes-induced
nitrosative stress and apoptosis
CBD treatment (20 mg/kg daily IP) of 8-week diabetic mice for 4 weeks
attenuates/reverses (A) the increased 3-NT levels, (B) PARP activity, (C) caspase 3/7
activity, and (D) chromatin fragmentation in diabetic hearts of the respective groups *p <
0.05 vs. vehicle control/CBD alone; #p < 0.05 vs. diabetes, n = 6 per group.
20
21
Supplemental Figure 5. CBD treatment attenuates/reverses the diabetes-induced
myocardial fibrosis
CBD treatment (20 mg/kg daily IP) of 8-week diabetic mice for 4 weeks
attenuates/reverses myocardial fibrosis. Shown is the Sirius red staining for fibrosis in the
myocardial sections and its quantification *p < 0.05 vs. vehicle control/CBD alone; #p <
0.05 vs. diabetes (D), n = 4 per group.
22
Supplemental Figure 6. CBD treatment attenuates high glucose (HG)-induced
cytosolic and mitochondrial ROS/superoxide and 3-NT generation in human
cardiomyocytes (HCM)
(A) Shown is the cytosolic ROS generation upon HG treatment and its attenuation by
CBD. (B) HG-induced mitochondrial ROS/superoxide generation were attenuated by
CBD (4 µM) treatment. (C) Cells were treated as indicated, and 3-NT accumulation in
the cells was determined by ELISA as described in Methods. *p < 0.05 vs. 5 mM
glucosel/30 mM L-glucose or CBD; #p < 0.05 vs. high glucose (HG), n = 4 per group.
23
24
Supplemental Figure 7. CBD mitigates HG-induced NF-κB activation in HCM
(A) Shown is the Western immunoblot analysis of I-κB- phosphorylation and
subsequent dissociation in the cytosol fractions of isolated cells, and Western
immunoblot analysis indicating the nuclear translocation of NF-κB in the nuclear
fractions prepared from cells after respective treatments. (B) Gel shift assay shows NFκB activation as per the indicated treatments. *p < 0.05 vs. 5 mM glucosel/30 mM Lglucose or CBD; #p < 0.05 vs. high glucose (HG), n = 4 per group.
25
26
Supplemental Figure 8. CBD mitigates HG-induced apoptosis/cell death in HCM via
Akt
(A) Cells were treated as indicated, and apoptosis/necrosis was determined by annexinV/Cytox Green binding/positivity using flow cytometer. The Akt/PI3K inhibitor
LY294002 was used at 25 M. (B) Shown is PARP activation as per the treatments
indicated. *p < 0.05 vs. 5 mM glucosel/30 mM L-glucose or CBD; #p < 0.05 vs. high
glucose (HG), n = 4 to 7 per group.
27
Supplemental Table 1. List of primers used in this study
Gene
Forward primer
Reverse primer
MMP2
CAAGGACCGGTTTATTTGGC
ATTCCCTGCGAAGAACACAGC
MMP9
TCTTCTGGCGTGTGAGTTTCC
CGGTTGAAGCAAAGAAGGAGC
gp91phox
GACCATTGCAAGTGAACACCC
AAATGAAGTGGACTCCACGCG
p22phox
ATGGAGCGATGTGGACAGAAG
TAGATCACACTGGCAATGGCC
P67phox
TTCCATCCCCAAATGCAAAG
TCAGATGCCCTAAAACCGGAG
TNF -α
TCTCATTCCTGCTTGTGGCAG
TCCACTTGGTGGTTTGCTACG
TGF-
TCTACAACCAACACAACCCGG
GAGCGCACAATCATGTTGGAC
Fibronectin TGCAGTGACCAACATTGATCGC
AAAAGCTCCCGGATTCCATCC
CTGF
ACTATGATGCGAGCCAACTGC
TGTCCGGATGCACTTTTTGC
Collagen1
TGGCCTTGGAGGAAACTTTG
CTTGGAAACCTTGTGGACCAG
-actin
TGCACCACCAACTGCTTAG
GGATGCAGGGATGATGTTC
ICAM-1
AACTTTTCAGCTCCGGTCCTG
TCAGTGTGAATTGGACCTGCG
VCAM-1
TTATTGTTGACATCTCCCCCG
TCATTCCTTACCACCCCATTG
28