Assignment-1 example
NANTCGNNACGAGGGGTAANGGAACTGGAATCCAAACTCTCTGAAGCTGAGAAGGAATTCATCGAAGGAGCACCAACACGTAG
CAAACGATCACCATCCGAGTGGATACCAAGGCCACCCGAAAAATACAGTCTTACTGGGCACAGAGCTCCTATCAACAGAGTTATT
TTCCATCCGGTCTTTAGTCTTATAGTATCTGCCAGCGAAGATGCCACTATCAAGGTGTGGGACTTCGAGAGCGGCGAATTCGAAAG
AACGTTGAAGGGGCACACCGACAGCGTGCAGGACGTTTCCTTCGACGTCTCCGGGAAACTGTTAGTCTCATGCAGTGCGGACATG
TCTATTAAGTTATGGGACTTTCACCAGTCATTCGCCTGCGTGAAAACCATGCACGGACATGATCACAGTGTCAGCTCTGTCGCATT
TGTGCCACAAGGGGATTTCGTAGTGAGCGCCTCTAGGGATAAGACCATCAAAATATGGGAAGTAGCGACAGGGTATTGTGTCAAA
ACGTTAACGGGGCACAGAGAATGGGTACGGATGGCCAGAGTCAGTCCTTGTGGAGAATTAATAGCTAGTTGCTCGAACGATCAA
ACAGTACGGGTTTGGCACGTGGCAACAAAGGAAACGAAGGTCGAACTCAGAGACCACGAACACGTAGTGGAGTGTATCGCATGG
GCACCGGACAGTGCAAGAGCATCGATCAACGCTGCTGCAGGGGCGGACAATAAGGGAGCCCATGAAGGACCTTTCCTCGCATCT
GGCTCGCGAGACAAAGTAATTCGTGTATGGGATGTCGGTGCCGGTGTTTGTCTCTTCGCCCTATTGGGCCACGACAACTGGGTTCG
CGGCATCGTCTTCCATCCTGGTGGCAAGTTCATCGTCAGTGNCTCTGACGACAAGANCCTGCGAGTATNGGANACGCGCAACANA
NGGGTAATGAAAACCCTCNAAGCGCACGTCCACTTCTGCNCCTCCNTTGATTTCACAAAAGCCATCCTTACGTGGTCNCCGGTAGT
GNNNATCAAACGGNNAANN The sequences clipped from the file are indicated in bold. ATG underlined (the N is a T in other EST
sequences).
Honeybee gene: The insert size of the cDNA clone sequenced was approximately 1,500
bases; therefore, 1006 bases of DNA sequence could be clipped out for analysis. MegaBLAST
of the honeybee reference genome identified three regions of sequence similarity on linkage
group/chromosome 6 corresponding to exon 4, 5 and 6 of the gene LOC408869. Using
BLASTn, the last 37 nucleotides aligned with exon 7 (Fig-1). The DNA sequence was used to
search the refRNA database for the honeybee genome. The EST aligned well with the refRNA
sequence XM392399.3 starting a little downstream from the reference sequence in exon 2 and
apart from the Ns in the sequence there was only one substitution and one nucleotide deletion
noted. The EST in the clone is in the correct orientation because the numbering of the reference
sequence and the EST ascended in the same direction. Thirty-three ESTs were identified in a
megaBLAST search of the Honeybee EST database with my EST. All ESTs aligned well
indicating that there is no evidence of alternative splicing. Analysis of the 5’ most EST
sequences suggested that the 5’ untranslated region is approximately 400 bases long and the 3’
untranslated region was estimated to be approximately 700 bases. Blast analyses of the 5’EST
sequences revealed the existence of 3 exons 1,2, 3 in the genome and all 5’ ESTs have these
exons and none map to exon 1 of the model RNA in refRNA (Fig-1). Exon three must exist in
an unsequenced gap of the genome sequence located between 17044 and 17045K because it does
not align with honeybee genomic sequence. Therefore, the model refRNA is wrong because it
includes an incorrect first exon and misses 3 exons found within the EST collection, and the first
AUG is in exon 4 and at the beginning of my EST. Rather than covering 17,043-17,049K of
LG6 as shown in NCBI, LOC408869 covers 17,031-17,049K. The gene is expressed in the head
and brain of the honeybee adult. LOC408869 encodes a protein similar to Lissencephaly-1
CG8440-PA, isoform A.
2
Assignment-1 example
Function in other organisms: Lissencephaly is a human condition with the phenotype
of a smooth (Liss) brain (encephaly). Classical or Type 1 Lissencephaly can be caused by
mutations in the Platelet-activating factor acetylhydrolase, isoform B1, alpha subunit (LIS1) gene
(Lo Nigro et al., 1997). The LIS1 gene is haploinsufficient as deletions or point mutations in one
copy of the LIS1 gene result in a smooth small brain associated with a number of neurological
conditions including jerks, spasms and seizures. The severity of the condition depends on the
position and type of DNA change, and in the most sever cases, death is due to respiratory
problems or sepsis early in life. In Drosophila, Lis1 regulates metaphase spindle orientation in
neuroblasts (Siller and Doe, 2008). Involvement of Lis1 in spindle function has been observed
in C. elegans and mammalian cells; therefore, Lis1 has an evolutionaryly conserved role in
eukaryotic cell division. The smooth small brain observed in humans with Lissencephaly is due
to defects in neural migration. Mutation of one copy of the LIS1 homologue in mice results in
brain developmental defects also due to delayed neural migration (Hirotsune et al., 1998).
The human LIS1 gene and conserved homologues encode a protein containing eight WD
40 conserved repeats. WD40 repeats are found in a number of eukaryotic proteins that function
in a wide array of cellular processes from signal transduction to mRNA processing. The WD40
repeats found in LIS1 proteins are a subfamily called Lissencephaly type 1 homology motif. The
LIS1 protein is found in a range of eukaryotic organisms and is involved in regulating the
formation of the microtubule cytoskeleton and spindle orientation. The primary function of LIS1
is regulating the function of the microtubule motor dyein by binding to two distinct sites: within
the N-terminal stem and near the P loop of the AAA domain (Tai et al., 2002). Therefore, the
impaired neural migration defects of lissencephaly may arise due to altered dynein function.
Structure of the LIS1 protein: The crystal structure of mouse LIS1 complexed with the
alpha subunit of platelet activating factor acetylhydrolase (PAF-AH) has been determined
(Tarricone et al., 2004). The N-terminal region of LIS1 mediates dimerization of LIS1, and the
WD40 repeat region of LIS1 interacts with PAF-AH. Another protein Nde1 competes with
PAF-AH for binding LIS1. LIS1 is known also to interact with dynein, a microtubule motor
molecule. Mutational changes that result in lissencephaly map to the region of the LIS1 protein
that bind Nde1 and dynein suggesting that these mutational changes disrupt the interaction with
Nde1 or dynein. From the crystal structure of LIS1:PAH-AH and competitive interactions with
Nde1, a model for how LIS1, Nde1 and dynein interact has been proposed (Fig-2).
3
Assignment-1 example
Figure 1. Structure of the LOC408869 gene. The boxes indicate exons, and the filled boxes
indicate exons with coding sequence. The alignment of the EST is shown above the exons. The
gap in the genomic sequence is indicated as a bracket. The relative position of the gene on
linkage group 6 is indicated below the gene.
Figure 2. Proposed structure for the complex between LIS1, Nde1 and Dynein (Taken from
Tarricone et al., 2004). Nde1 (green) interacts with LIS1 along the N-terminal arms of the two
LIS1 molecules. One monomer of LIS1 (blue) interacts by AAA of dynein (yellow) and the
other monomer interacts with the stem.
4
Assignment-1 example
References:
Hirotsune, S. et al., 1998. Graded reduction of Pafah1b1 (Lis1) activity results in neuronal
migration defects and early embryonic lethality. Nature Genet. 19: 333-339.
Lo Nigro, C. et al. 1997. Point mutations and an intragenic deletion in LIS1, the lissencephaly
causative gene in isolated lissencephaly sequence and Miller-Dieker syndrome. Hum. Molec.
Genet. 6, 157-164.
Siller, K and Doe, C. Q. 2008. Lis/dynactin regulates metaphase spindle oreintation in
Drosophila neuroblasts. Dev. Biol. 319, 1-9.
Tai, C. Y. et al. 2002. Role of dynein, dynactin, and CLIP-170 interactions LIS1 kinetochore
function. J. Cell Biol. 156, 959-968.
Tarricone, C. et al. 2004. Coupling PAF signaling to dynein regulation: structure of LIS1 in
complex with PAF-acetylhydrolase. Neuron 44, 809-821.
5