Supplementary Information for
PEA-15 unphosphorylated at both serine 104 and serine 116 inhibits ovarian cancer cell
tumorigenicity and progression through blocking β-catenin
Jangsoon Lee, Chandra Bartholomeusz, Savitri Krishnamurthy, Ping Liu, Hitomi Saso, Tiffany
A. LaFortune, Gabriel N. Hortobagyi, and Naoto T. Ueno
Figure legends of supplementary movies
Supplementary Methods
Supplementary figures: 4
Supplementary table: 1
Figure Legends.
Supplementary Movie 1. Time-lapse video of 3D projection formation in vector-control clone.
Three-dimensional Matrigel projection formation assays were performed using -Slide plates
(ibidi GmbH) as described in Material and Methods. Real-time cell projections were captured for
5 hr using a Nikon Eclipse Ti system.
Supplementary Movie 2. Time-lapse video of 3D projection formation in PEA-15-AA clone.
Three-dimensional Matrigel projection formation assays were performed using -Slide plates
(ibidi GmbH) as described in Material and Methods. Real-time cell projections were captured for
5 hr using a Nikon Eclipse Ti system.
Supplementary Methods
Transfection
SKOV3-ip1 cells were transfected with various expression plasmids containing empty vector
(pcDNA3-HA), PEA-15-WT (pcDNA3-HA-PEA-15-WT), PEA-15-AA (pcDNA3-HA-PEA-15AA), or PEA-15-DD (pcDNA3-HA-PEA-15-DD) using Lipofectamine 2000 (Invitrogen)
according to the manufacturer’s instructions. Two days after transfection, medium was
exchanged for selective medium containing G418 (Invitrogen) at a final concentration of 800
g/ml. Thereafter, selective medium was exchanged for fresh selective medium every 3 days.
Ectopic expression of each gene in the stable cell lines was confirmed by Western blot analysis
with anti-HA antibody (Covance).
Western blot analysis
Total protein extracts were prepared using cold radioimmunoprecipitation assay lysis buffer (50
mM Tri-HCl, pH 7.4, 1% NP-40, 150 mM NaCl, 10% glycerol, 1.5 mM MgCl2, 1 mM EDTA,
phosphatase inhibitor cocktail, and protease inhibitor cocktail. Equal amounts of protein (15 g)
were resolved by SDS-PAGE with a 13% gel. Membranes were incubated with rabbit polyclonal
antibodies against PEA-15 (Cell Signaling) overnight. -actin (clone AC-15; Sigma-Aldrich)
was used as a loading control.
Time Lapse Microscopy
After cells were seeded on -Slide plates (ibidi GmbH) according to the In vitro 3D Matrigel
projection formation assay, time lapse movies were acquired for 5 hrs using a Nikon Eclipse TiU microscope, equipped with an ×20 phase contrast objective (Nikon) and a Cool Snap HQ2
CCD camera (Photometrics), controlled by NIS-Elements imaging software (Nikon).
Immunohistochemistry and Immunofluorescence
Tumor tissues were fixed in neutral-buffered formalin and embedded in paraffin. Sections (5 µm
each) were prepared using a microtome, mounted on slides, deparaffinized in xylene, rehydrated
in graded alcohols, and washed in distilled water. Antigens were retrieved by boiling the sections
in 10 mM citric acid (pH 6.0) for 40 min. Endogenous peroxidases were quenched by incubation
in 3% H2O2 for 10 min at room temperature. The slides were washed three times with phosphatebuffered saline (PBS) and blocked for 30 min with 10% normal goat serum in 1% bovine serum
albumin/PBS. The slides were then exposed to Ki-67 antibody (Lab Vision), CD31, pPEA-15S104, -catenin antibodies (Cell Signaling), pPEA-15-S116 (Invitrogen) and MMP-7 (R&D
system). Immunostained slides were evaluated by light microscopy, and the
immunohistochemical signal was scored according to the Allred system. Briefly, a proportion
score was assigned to represent the estimated proportion of positive-staining tumor cells (none =
0; 1 of 100 = 1; 1 of 10 = 2; 1 of 3 = 3; 2 of 3 = 4; and 1 of 1 = 5). Average estimated intensity of
staining in positive cells was assigned an intensity score (negative = 0; weak = 1; intermediate =
2; and strong = 3). Proportion score and intensity score were added to obtain a total score ranging
from 0 to 8. Immunofluorescence staining was visualized using Alexa Fluor 488 and DAPI
(Invitrogen). Stained slides were visualized with an Eclipse 80i microscope (Nikon), and the
images were captured at a magnification of 200× and stored using NIS-Elements BR3.1 software
(Nikon) according to the manufacturer’s instructions.
Human tumor samples (tissue microarray)
We obtained tissue microarray slides containing 60 specimens of primary cancer and 10
specimens of cancer-adjacent normal of ovarian tissues or breast tissues from US Biomax, Inc.
We only included in our analysis patients who had serous, mucinous, or endometrioid
adenocarcinoma and a disease stage of I, II, or III. The numbers and percentages of patients for
each tumor histologic type and disease stage were summarized. Variables available for analysis
included histopathologic diagnosis (based on World Health Organization criteria), nuclear grade
(based on Gynecologic Oncology Group criteria), and disease stage (according to the
International Federation of Gynecology and Obstetrics system). The level of PEA-15
phosphorylated at Ser104 (pPEA-15-S104), pPEA-15-S116, and -catenin were reported.
Quantitative RT-PCR
Total RNA was purified from cells using an RNA prep Kit (Invitrogen) according to the
manufacturer’s instructions. Next, 20 ng of total RNA was used for one-step quantitative RTPCR analysis with iScript One-Step RT-PCR kit including SYBR Green reagents using a CFX96
real-time PCR detection system (Bio-Rad Laboratories). PCR conditions were 94°C for 5
minutes followed by 40 cycles of 94°C for 15 seconds and 60°C for 30 seconds. Human c-myc,
c-met, -catenin and 18S ribosomal RNA primers were purchased from Sigma-Aldrich. The
sequences of the -catenin primers were 5'TACCCAGCGCCGTACGTCCA3' (forward) and
5'CCATGCGGACCCCCTCCACA3' (reverse), c-myc primers were 5'
AAAACCAGCAGCCTCCCGCGA3' (forward) and 5' AATACGGCTGCACCGAGTCGT3'
(reverse), c-met primers were 5' GCTGCCAGTGAAGTGGATGGCT3' (forward) and 5'
AGCACGCCAAAGGACCACACA3' (reverse), and 18S ribosomal RNA primers were
5'TGCATGGCCGTTCTTAGTTG3' (forward) and 5'AGAGTCTCGTTCGTTATCGGAATT3'
(reverse). 18S ribosomal levels were used as an endogenous control. The real-time PCR data
were calculated using the comparative threshold cycle method and the iCycler CFX96 analyzer
software (Bio-Rad).
Statistical analysis
For experimental outcomes, descriptive statistics (mean and standard deviation) were summarized
for each group. An analysis of variance model was used to compare the mean outcome values
among the tested groups. P<0.05 was considered statistically significant.