Supplementary Information
1) Table of Contents
Supplementary Information
1
1) Table of Contents
1
2) Description of Supplementary Information submitted
2
3) Supplementary Figure Legends
3
Supplementary Table S1: SHIRPA-based health screening
3
Supplementary Figure S1: NOMA-GAP deficient mice show normal
general mouse behavior
3
Supplementary Figure S2: Analysis of general animal behavior in a
familiar environment (home-cage screening).
4
Supplementary Figure S3: Behavior in the novel environment of the open
field.
4
Supplementary Figure S4: Species-specific behavioral traits
5
Supplementary Figure S5: NOMA-GAP regulates dendritic spine
morphology independently of downstream regulation of Cdc42.
5
Supplementary Figure S6: Electrophysiological properties of NOMA-GAP
deficient upper layer cortical neurons
6
Supplementary Figure S7: N-/- Cdc42 fl/+ cre mice behave like NOMAGAP deficient mice in the home cage.
7
Supplementary Figure S8: Alignment of the serine-proline rich region of
NOMA-GAP in different species.
3) Supplementary Materials and Methods
Reagents
8
9
9
Lentivirus production
11
Supplementary Behavioral Experiments
12
4) Supplementary References
24
2) Description of Supplementary Information submitted
Supplementary Information file: containing Supplementary Figure Legends,
Supplementary Materials and Methods and Supplementary References
Tables and Figures:
Table S1: The results of the SHIRPA-based health screening of NOMA-GAP
deficient mice
Fig. S1: Analysis of sensory perceptions and general mouse health including
olfactory function, vision, muscle strength and hindlimb clasping.
Fig. S2: Analysis of the behavior of NOMA-GAP deficient mice in the homecage.
Fig. S3: Analysis of the behavior of NOMA-GAP-deficient mice in a novel
environment.
Fig. S4: Analysis of mouse-specific behavioral traits including nest-building,
burrowing of foreign objects and burrowing.
Fig. S5: Analysis of dendritic spine morphology in cultured NOMA-GAPdeficient and control neurons as well as in vivo in neurons with heterozygous
and homozygous deletion of Cdc42.
Fig. S6: Analysis of the electrophysiological properties of NOMA-GAPdeficient upper layer cortical neurons in adult mouse brain slices.
Fig. S7: Analysis of the behavior of NOMA-GAP-deficient Cdc42 fl/+ Cre mice
in the home-cage.
Fig. S8: Alignment of the serine-proline rich region of NOMA-GAP in different
species.
2
3) Supplementary Figure Legends
Supplementary Table S1: SHIRPA-based health screening
NOMA-GAP-deficient and control male and female adult mice were screened
for general animal health and behavior in a battery of tests based on SHIRPA
protocol (see Supplementary Experimental Procedures for further
information). n = 7 N-/-female, 8 N-/-male, 10 N+/- female, 7 N+/- male
Supplementary Figure S1: NOMA-GAP deficient mice show normal
general mouse behavior
A) Olfactory function was tested using the buried food test. The latency to
find the buried food pellets during a 15 min test was recorded. Animals that
consumed no pellets during the habituation and during the test were removed
from the analysis. n = 7 female, 8 male N-/-; n =9 female, 6 male control mice.
B) Vision and perception of depth was tested using the visual cliff test. The
time spent above the cliff area was recorded during a 10min test. n = 7
female, 8 male N-/- ; 10 female and 7 male control mice.
C) Muscle strength was tested using the grip strength test. An average of
three trials per mouse were conducted. n = 7 female, 8 male N-/-; 10 female,
7 male control mice. Normalized grip strength (grip strength /animal weight;
g= gram) of the forelimbs only and of the fore and hindlimbs together are
shown.
D) The number of times hindlimb clasping was observed for an animal over
4 measures (over 7 months) upon suspension of the mouse by its tail. n = 7
female and 8 male N-/-; 9 female and 7 male control mice. Non parametric
Mann-Whitney U test for two independent samples, males, U = 8 *, p < 0.025.
3
Supplementary Figure S2: Analysis of general animal behavior in a
familiar environment (home-cage screening).
General behavior patterns of NOMA-GAP deficient and control animals were
quantified in a 22h period in the familiar environment of their home cage.
Behavior recorded were A) Mean time spent grooming per hour (s) during
light and dark phase; B) Mean distance travelled (m). One female animal was
removed from this data set due to technical problems during the experiment
run. C) Mean time spent resting (s) where “resting time” is the cumulated time
an animal is stationary, not moving or making a pause between two actions. It
is an indicator of immobility relative to other types of movements and (D)
Mean time spent in eating and drinking zone (s); all during light and dark
phases. n = 7 female and 8 male N-/-; 10 female and 7 male control N+/mice. One outlier control male was removed in D). Light phase, cont vs. N-/-,
females, non parametric Mann-Whitney U test for two independent samples,
U = 16; * p <0.05.
Supplementary Figure S3: Behavior in the novel environment of
the open field.
Mouse behavior was analyzed in the open field test under mild lighting
conditions. Behavior measured included A) total distance traveled in cm, B)
time spent in the center of the field, C) time spent in the periphery, D) latency
to enter the center, E) number of freezing bouts and F) number of grooming
bouts during the 20 min test period. n = 7 female and 8 male N-/-, 10 female
and 7 male control mice. Latency to enter center, females: non parametric
Mann-Whitney U test for two independent samples, U = 17; * p < 0.05.
4
Freezing bouts, males: non parametric Mann-Whitney U test for two
independent samples, U = 17; * p < 0.05
Supplementary Figure S4: Species-specific behavioral traits
A number of species-specific behavioral traits were analyzed. These included:
A-B) Nest building, where the complexity of nests built overnight were scored
(see A for scoring parameters). n = 7 female, 8 male N-/- and 17 female, 7
male control mice. Non parametric Mann-Whitney U test for two independent
samples, U = 14; * p < 0.05, U =65; ** p < 0.01. (C-D) Burying of foreign
objects (marbles). The number of marbles buried (B) and the time taken to
cover the first marble during a 30 min test were scored. n = 7 female, 8 male
N-/- and 10 female and 7 male control mice. Non parametric Mann-Whitney U
test for two independent samples, U = 80.5; * p < 0.05. E) Burrowing test.
Mice were provided with 200 g of bedding material in a tube (burrow) in their
home cage. The percentage of material remaining in the burrow after 2 h and
overnight is shown. n = 7 female, 8 male N-/- and 10 female, 7 male control
mice. Non parametric Mann-Whitney U test for two independent samples, U =
15.5; * p < 0.05 (overnight), U = 13.5; * p < 0.025 (after 2 h).
Supplementary Figure S5: NOMA-GAP regulates dendritic spine
morphology independently of downstream regulation of Cdc42.
(A-D) NOMA-GAP-deficient cortical neurons have longer spine necks in
culture. NOMA-GAP-deficient and control heterozygote neurons transfected
with eGFP at DIV 14, were visualized at DIV 20 (A). Scale bar = 2 µm. (B)
Mean length of spine neck. n = 277 N+/-, 223 N-/- spines. Mann-Whitney U
test, p = 0.0160. (C) Mean width of spine head in vitro. n = 277 N+/-, 223 N-/-
5
spines. Mann-Whitney U test. (D) Mean density of dendritic protrusions in
vitro. n = 7 N+/-, 7 N-/- dendritic segments of approximate length of 60 µm. t
test.
(E-H) Post-mitotic homozygous deletion of Cdc42 does not restore spine
morphology in NOMA-GAP-deficient neurons in the mouse brain. (E)
Segments of basal dendrites of layer 2/3 pyramidal neurons of N+/- Cdc42 fl/+
and N-/- Cdc42 fl/+ animals expressing eGFP (see Fig. 3C-F) or N-/- Cdc42
fl/fl animals expressing floxed-mCherry-IRES-eGFP (FMF-eGFP) together
with NeuroD1-Cre were visualized at P23 following IUE at E15.5. Scale bar =
2 μm. (F) Mean length of spine neck. n = 736 N-/- Cdc42 fl/fl (+Cre) spines
analyzed. Mann-Whitney U test, pN+/- Cdc42 fl/+ vs N-/- Cdc42 fl/fl (+Cre) < 0.0001; pN-/Cdc42 fl/+ vs N-/- Cdc42 fl/fl (+Cre)
= 0.0345. (G) Mean width of spine head. n = 736 N-/-
Cdc42 fl/fl (+Cre) spines analyzed. Mann-Whitney U test pN-/- Cdc42 fl/+ vs N-/- Cdc42
fl/fl (+Cre)
= 0.0002. (H) Mean spine density. n = 10 N-/- Cdc42 fl/fl (+Cre)
dendritic segments of approximate length of 40 μm. t-test.
Supplementary Figure S6: Electrophysiological properties of
NOMA-GAP deficient upper layer cortical neurons
(A) Whole-cell current-clamp recordings of principal somatosensory layer 2/3
neurons in NOMA-GAP deficient or wildtype adult mice. We injected every 5 s
rectangular current steps for 1 s with an increment of 50 pA. For clarity merely
voltage responses to current injections of -300 pA, +/- 50 pA and + 150 A are
depicted. Scale bars here and in (F) represent 20 mV and 0.2 s. Population
data demonstrating the augmented input resistance (Rin) (B) in NOMA GAPdeficient neurons (black columns) and comparable membrane potential (C), n
= 20 for N+/+ and n = 23 for N-/-.
6
(D) Voltage clamp recordings of spontaneous (left trace sequence) and
miniature postsynaptic currents (right trace sequence) at a holding potential of
-60mV. (E) Frequency, amplitude and decay time of the events remained
comparable under block of sodium channels (and therewith action potentials)
with 1 µM TTX and fast GABA(A) inhibition with 10 µM bicuculline (respective
line series), indicating that most of the events recorded in layer 2/3 principal
neurons were excitatory, putatively AMPA-mediated events.
(F) Current-clamp recordings reveal that heterozygous deletion of Cdc42 in
NOMA-GAP-deficient neurons had no effect on Rin (G) or membrane potential
(H), n = 12 for N-/- Cdc42 fl/+ and n = 11 for N-/- Cdc42 fl/+ Cre.
Supplementary Figure S7: N-/- Cdc42 fl/+ cre mice behave like
NOMA-GAP deficient mice in the home cage.
General behavior patterns of NOMA-GAP deficient Cdc42 floxed Nex cre and
control animals were quantified in a 22 h period in the familiar environment of
their home cage as described in Supplementary Fig. S2.
n = 12 N-/- Cdc42 fl/+, 10 control (N+/+ and N+/+ Cdc42 fl/+) and 10 N-/Cdc42 fl/+ Nex-Cre male mice. Behavior recorded were (A) grooming time,
(B) level of activity, non parametric Mann-Whitney U test, U = 11 (cont vs. ko)
and U = 6 (cont vs. rescue); *** p <0 .001, (C) resting times and (D) time
spent in eating and drinking zones, Mann-Whitney U test, U = 21 light phase
cont vs. rescue; * p < 0.05, U = 16 dark phase cont vs. rescue; * p < 0.025, U
= 20 dark phase cont vs. ko; ** p < 0.01. All behaviors are scored during light
and dark phases.
7
Supplementary Figure S8: Alignment of the serine-proline rich
region of NOMA-GAP in different species.
The serine-proline-rich region is underlined. The start of exons 19 and 20 are
marked. Human isoform 1 described in the database lacks the sequences
encoded by the first part of exon 20. Only one isoform has so far been
described in mouse, rat, gorilla, chimpanzee, dog, Carolina anole lizard or
frog. The following sequences were aligned using MultiAlin version 5.4.1: Mus
musculus NP_839983.1, Rattus norvegicus XP_002728775.2, Homo sapiens
NP_443180.2 and NP_001166101.1, Gorilla gorilla gorilla XP_004060593.1,
Pan troglodytes XP_003954493.1, Macaca mulatta XP_002801233.1 and
XP_001099117.2, Canis lupus familiaris XP_005616952.1, Anolis carolinensis
XP_003224994.1, Xenopus (Silurana) tropicalis NP_001090769.
8
3)
Supplementary Materials and Methods
Reagents
Antibodies against the following proteins were used in this study: phosphoPAK (Cell Signaling), PAK (Santa Cruz), Myc (Cell Signaling), GFP
(Rockland), PSD-95 (MA-1 Thermo Scientific), RFP/DsRed (Clontech); HA
(Roche), synaptophysin (Synaptic Systems); FLAG (Sigma); phospho tyrosine
(Cell signaling); GluR1 (NeuroMab); PSD-95 phospho S295 (Abcam), and
NOMA-GAP (Abcam). All compounds used were purchased from SigmaAldrich, Germany unless otherwise stated.
To overexpress NOMA-GAP, eGFP and/or PSD-95 in mature primary cortical
neurons, a GFP N-terminal tagged NOMA-GAP construct and a mCherry cterminal tagged PSD95 construct were subcloned into a lenti-viral shuttle
vector (FUGW (1)) in which the ubiquitin promoter was exchanged for a
neuronal human synapsin-1 promoter, generating the plasmids f(syn) GFPNOMA-GAPw and f(syn)PSD95-mCherryw. A double synapsin-1 promoter
plasmid f(syn)sqw expressing eGFP served as cytosolic infection reporter.
The following primers were used for the generation of f(syn) GFP-NOMAGAPw: CTGCTAGCATGGTGAGCAAGGGCGAGG,
GAAGGCGCGCCTCAGCAGTAGCTTCG. f(syn)PSD95-mCherryw was
subcloned using NheI and EcoRI.
Tagged wt NOMA-GAP, delPX, delRhoGAP, Nterm and shrt Cterm constructs
have been described previously (2). The remaining deletion constructs were
subcloned into pEFmyc.2 as follows: SerPro region (using the primers
9
CCGAATTCCTG AGATCTGCCAAGAGC,
AGACTAGTCTACAGCAGTTCTAGGACAGC), longCterm (restriction digest
of wt NOMA-GAP using the internal BglII site), SH3 (using the primers
CTCGAATTCGAGGCGTCACTCAATATCC,
GGCAAGCTTCTACGGACCTGGCCGCTCTG), RhoGAP long (using the
primers CTCGAATTCACAGAGCGGCCAGGTCCG, GGCAAGCTTCTA
AGCCCCGCTGGCCTG).
Full length DLG1/SAP97 (NM_001252433) was amplified from FU_BETASAP97-EGFP_I3 (a gift from C. Garner) by PCR (forward primer: 5’TAGATCTTATGCCGGTCCGGAAGC -3’, reverse primer: 5’ATCTCGAGTCATAGCTTTTCTTTTGCCG-3’). The Insert was digested with
BglII and XhoI and cloned via BamHI and XhoI into pCMVTag2A
(Stratagene).
Full length DLG2 (NM_001364) was amplified from a Human Fetal Brain BD
Marathon-Ready cDNA library (Clontech) by PCR (forward primer: 5’TAGATCTTATGTTCTTTGCATGTTACTG -3’, reverse primer: 5’ATCTCGAGTTATAACTTTTCCTTTGAGG-3’). The Insert was digested with
BglII and XhoI and cloned via BamHI and XhoI into pCMVTag2A
(Stratagene).
Full length DLG3/SAP-102 (BC093866) was amplified from a Human Fetal
Brain BD Marathon-Ready cDNA library (Clontech) by PCR (forward primer:
5’- AGGAATTCGATGCACAAGCACCAGCACTG-3’, reverse primer: 5’CTGTCGACTCAGAGTTTTTCAGGGGATG-3’) and cloned via EcoRI and SalI
into pCMV-Tag2A (Stratagene).
10
Full length DLG4/PSD-95 (NM_019621) was amplified from a pCMV-Tag2A
PSD-95 by PCR (forward primer: 5’AGGAATTCGATGGACTGTCTCTGTATAGTG -3’, reverse primer: 5’CTGTCGACTGGAGTCTCTCTCGGGCTGGGAC -3’) and cloned via EcoRI
and SalI into pEYFP-N1 (Clontech).
Floxed-mCherry-IRES-eGFP has been previously described (3). The
generation of pCMV-Tag2A PSD-95, CS-PDZ 1-3, SH3-GK and PSD-95L460P have been described elsewhere (4).
Lentivirus production
Viruses were produced as previously described (1). Briefly HEK293T cells
were co-transfected with 10µg shuttle vector and the mixed helper plasmids
(pCMVd8.9 7.5µg and pVSV-G 5µg) using XtremeGene 9 DNA transfection
reagent (Roche Diagnostics, Mannheim, Germany). Supernatant was
harvested after 48h, cell debris removed by filtration and aliquots of the filtrate
flash frozen in liquid nitrogen and stored at -80°C. Viral titers were estimated
by infection of wildtype hippocampal neurons with GFP or mCherry reporter
constructs.
Morphometric analysis of dendritic spines
Dendritic spines of secondary basal dendrites from primary cultured neurons
and brain sections were imaged using a confocal Leica SL with a 60x oil
objective and 4x and 6x zoom respectively. Morphometric analyses of
dendritic spines were performed by a blind investigator on z-projections using
NIH ImageJ software. Neck length was measured from the dendritic shaft to
the beginning of the spine head. When the neck was not clearly visible it was
11
considered to be the shortest distance between spine head and dendritic
shaft. Head width was defined as the widest length perpendicular to the neck.
Spines were quantified in dendritic segments of approximately 60 µm or 40
µm in length in primary cortical neurons and in brain sections respectively.
Spine density was defined as the number of spines divided by the length of
the analyzed dendritic segment. Dendritic processes were classified as
filopodia, headed spines and stubby spines as follows: Filopodia do not have
a clear head-like structure, stubby spines show a head but no neck and
headed spines show a head and neck. Synapse density was determined by
counting of aligned presynaptic (synaptophysin) and postsynaptic (PSD-95)
proteins in GFP transfected neurons using the cell counter plug-in for NIH
ImageJ.
Supplementary Behavioral Experiments
All tests were performed in sound-attenuated rooms, during the animal light
phase. Mice were group-housed except for the males of the first batch (N+/and N-/-) that needed to be rapidly separated due to repeated aggression and
remained singly housed. Animals had ad libitum access to food and water,
except before the buried food test (see detailed description) and lived in a 12
h -12 h light-dark cycle (light phase onset at 6 am). In each cage mice had
access to nest material, wood sticks and a plastic tube. All experiments were
performed in accordance with the German animal protection law. All
experiments and initial analyses were performed in a 'blind' fashion, i.e., the
experimenter had no knowledge of the genotype of the mice tested and
analyzed.
12
General health check.
This health screening was based on "SHIRPA" protocols (5-8). It consists of a
standardized set of 54 discrete measures of animal’s appearance, activity,
morphological, motor, affective, sensory and neurological status. This
screening is for detection of gross abnormalities between groups of animals. It
is an exploratory tool to guide further analysis of behavior. At the beginning of
the test, the mouse was transferred its home cage into a small beaker glass
on the scale and weighed (1). Inside the beaker glass the following behaviors
were recorded without disturbing the mouse: Whisker morphology (2) Skin
color of plantar surface and color of the coat (4) Hair length (5) Hair
morphology and piloerection (7) Gross abnormal physical features (8)
Morphology of the head, eyes, ears (pinna), teeth, tail, nails, limbs and the
position of the limbs (rotation of the limb relative to vertical stance) (16)
Salivation (17). Corneal reflex was tested with Q-tip (18). The mouse was
then transferred into a bigger viewing jar and convulsions, twitches, tremors or
other abnormal behavior (22) as well as walking gait were recorded (23). The
mouse was transferred to the center of an arena (cleaned big cage): Visual
placing ability of the mouse was tested while gripping the base of the tail
between the thumb and the forefinger (the animal was lifted to a height of
approximately 15 cm and lowered slowly to a surface. Scoring is based on
distance of nose from the surface before extending the forelimbs as a reflex;
24). The mouse was then placed approximately 25 cm above the center of the
arena floor and the following behaviors recorded without disturbing the
mouse: Locomotor activity (25) Gait (26) Transfer arousal (27) Pelvic and tail
elevation (28). The animal was allowed to remain in the arena (free
13
movements) to test the following sensory functions and reflexes: Pinna reflex
with Q-Tip (29) Vibrissa placing response when touched (30) Back touch
escape (31) Acoustic startle response (32) Object approach with Q-Tip (33)
Righting reflex (34) Body tone (35) Postural reflex when cage is moved
(extend all legs and walk backwards; 36) and when the cage is inclined (45°;
maintain position on inclined plane; 37). The mouse was then lifted above the
arena gripping the base of the tail and the following observed: Positional
passivity (38) Trunk curl (39) Limb grasping (40). The following were also
tested: Grip strength (with an horizontal pull applied to the tail, the animal was
slowly drawn backwards and the grid-gripping resistance of the animal to the
pull was scored; 41) Grasping of wires (the animal lifted by the tail was
allowed to grasp a wire with its forelimbs, then rotated partially downward and
released, tendency of normal animals to actively grasp the wire with its limbs;
42) and the Air righting reflex (43). The following were then recorded:
Respiratory rate (duration 10s) (44) Limb and abdominal tones (46) and the
Heart rate (47). Last measures taken were the body and tail length (49). Once
the animal was back in its home cage the following were scored: number of
feces and urination in the arena (50), Grasp irritability, positional struggle,
provoked freezing and vocalization observed during the full procedure (54).
Between mice, the arena was cleaned with 5 % alcohol. All material was
cleaned with 70% alcohol at the end of the day.
Partition test or familiarity test.
The purpose of this test is to assess the influence of environmental familiarity
on spontaneous interest of a mouse for another unfamiliar mouse. This test is
done directly in home cage environment (9). A custom made transparent wall
14
which partitioned the cage in 2 areas was placed parallel to the long side of
the cage (35 × 20 × 15 cm). The partition wall fitted the dimensions of the
cage so that a mouse could not crawl under it and reach the other area of the
cage. Two lines of small holes (5 mm diameter) at the bottom of the partition
allowed mice to smell each other from both sides of the partition. Fresh
bedding but no environmental enrichments were placed in the cage.
Unfamiliar and test mice were placed in two different holding rooms at least 1
hour before the beginning of the test. An unfamiliar mouse was placed in one
side of the cage 5min before the test mouse was placed in the other side of
the cage. Mice could freely explore their new environment and the unfamiliar
mouse through the pierced partition for 20 min. During this first phase,
measures were taken of the amount of time spent at the partition as an
indication of social interest using the video-tracking system Viewer 3
(BIOBSERVE). The unfamiliar mouse was then removed and a regular cage
lid with food and water ad libitum was placed on top of the cage. The test
mouse was kept on its side of the cage for the next 24 h so that the
environment became familiar. In the second phase of the test, another
unfamiliar mouse was placed on the other side of the cage for another 20 min
and time spent at the partition was recorded.
Three chamber test.
Social preference and social recognition were tested as described in (10). In
this test the natural interest of a mouse for another unfamiliar mouse is
evaluated. The social testing arena was a rectangular, three-chamber box (60
x 40 x 22 cm, Stoelting apparatus) with white non transparent external wall.
Each chamber was (20 x 40 x 22 cm) in size. Dividing walls were made from
15
clear Plexiglas, with rectangular openings (50 cm x 80 mm) allowing access
into each chamber. The light condition was kept dim and uniform over the 3
chambers. The chambers of the arena were cleaned with 5% alcohol between
test subjects. The test and unfamiliar mice were all moved to an adjacent
room to the experimental room (same climatic condition) one hour before the
test. In the experimental room, the test mouse was first placed in the middle
chamber and allowed to explore this chamber for five minutes (transparent
sliding doors closing the openings). After this habituation period an unfamiliar
C57BL/6J male mouse, that had no prior contact with the subject mouse, was
placed in one of the side chamber. The location of the unfamiliar mouse in the
left vs. right side chamber was systematically alternated between test
animals. The unfamiliar mouse was enclosed in a round wire cage with grey
Plexiglas covers (7 x 7 x 15 cm), which allowed nose contact through the bars
but prevented fighting. The animals serving as unfamiliar mice had previously
been habituated to the small cage (at least 3 times before test, 5 min each
time). An identical empty wire cage was placed in the opposite chamber. Both
openings to the side chambers were then unblocked and the test mouse was
allowed to explore the entire social arena for a 10min session. The amount of
time spent in each chamber and the latency to enter the chamber with the
unfamiliar mouse were recorded by the video-tracking system Viewer 3
(BIOBSERVE). An entry was defined as all four paws in one chamber.
Number of sniffs at the wire cage was recorded manually as an index of close
investigation. At the end of the first 10 min, each mouse was tested in a
second 10 min session to quantify social preference for a new unfamiliar
mouse after a 5 min break (similar condition as the habituation phase). A
16
second, unfamiliar mouse was placed into the previously empty wire cage.
The test mouse had a choice between the first, already-investigated mouse
(familiar mouse), and the novel unfamiliar mouse. As described above,
measures were taken of the amount of time spent in each chamber and in
close proximity with the grid during the second 10 min session. The wire
cages were tall enough to prevent climbing by the test mice. Only mice from
the second batch were found climbing on the grid. When this behavior was
observed, nothing was done except when the mouse stayed longer than 4sec
on top of the grid. In this case the experimenter gently pushed the mouse so
that it climbed down the grid. In all cases such event was scored and following
behavior of the mouse after climbing described. The animal’s data were kept
unless changes in behavior were observed afterwards (freezing, rapid
running).
Grip strength test.
This test is used to measure maximal muscle strength of forelimbs and the
combined strength of forelimbs and hind limbs as a primary phenotype
screening (5). Each mouse was weighed before the test. Grip strength of the
forelimbs only and of the fore and hind limbs together were recorded
automatically and transferred to the computer by a (TSE) Grip Strength Meter.
For each animal and type of measure, three values were taken and averaged.
Each animal of a batch was tested consecutively in the same order. Grip
strength mean value was normalized by animal body weight.
17
Limb clasping test.
This test is used as a primary screening of motoric dysfunction that have been
related to dopaminergic degeneration, Rett’s syndrome or Fragile X
syndrome. Limb clasping was evaluated at 4 different time points across the
18 weeks of testing as a regular health checking procedure. When
transferred to another cage the mouse was suspended by the base of the tail
for 15 s maximum. Limb clasping was recorded when one or both animals’
legs were pulled in tightly, either touching each other or touching the body
(11). The symptom was scored absent when the legs splayed outwards. We
reported the rate of occurrence of limb clasping across time (%).
Visual cliff test.
This test evaluates vision and perception of depth of mice. It is a
recommended test for primary phenotype screening (5). The visual cliff
apparatus consists of 3 interconnected boards: one horizontal board (40 x 29
cm), connected to a vertical wall (40 x 50 cm), and connected to a second
horizontal board (40 x 29 cm) at a lower level. The first horizontal surface is
stabilized by two legs (50 cm high). A black and white checkerboard pattern
covers the visible surface of the 3 boards that emphasizes the ledge drop-off.
A transparent Plexiglas (60 x 41.5cm) plate covers the first horizontal board
and spans over the ledge and the “cliff” area so that there is no actual dropoff, just the visual appearance of a cliff (12). Four white walls (40 x 40 cm)
surrounded the top surface of the box (“cliff” and “no cliff” areas). The test
mice were all moved to an adjacent room to the experimental room (same
climatic condition) 30 min before the test. In the experimental room, the test
mouse was first placed in the center of the “no cliff” or “safe” surface, facing
18
the opposite wall from the “cliff” area and allowed to freely explore the field for
ten minutes. A blind animal visits equally the two sides (“cliff” and “no cliff”) of
the box and with a shorter latency to visit the “cliff” area than an animal with
normal vision, which detects the difference in the environment (between
safe/risky area). The amount of time spent in each area of the box, the latency
to enter the “cliff” area and stretching postures were recorded by the videotracking system Viewer 3 (BIOBSERVE).
Buried food Test.
This test relies on the animal’s natural tendency to use olfactory cues for
foraging and is used to confirm the animal ability to smell volatile odors (13).
The week before testing, the mice were given sweet pellets (Purified rodent
tablets, 45 mg, TestDiet®, at least 3 times). All mice had to consume the
pellets before test or be excluded from the test. Sixteen hours before testing,
mice were deprived of food with water ad libitum. At least 30 min before the
beginning of the test, animals were moved from the animal facility to a holding
room. Before testing, each mouse was given 5 min of habituation in the
testing cage (no food inside). After this habituation, the mouse was
temporarily removed from the testing cage. In the testing cage (regular home
cage; 35 × 20 × 15 cm) a sweet pellet was hidden 1 cm deep and 5 cm away
from the cage rear in the 4 cm of fresh bedding. For testing, the mouse was
positioned in the center of the opposite end of the cage, and the latency to
find the food, i.e., the time from the moment the mouse was placed into the
cage to the time it located the sweet pellet and initiated digging, was
recorded. Whether the pellet was eaten or not and other spontaneous
behavior (rearing, climbing on the lid, grooming and extensive digging) were
19
also scored. The mouse was then removed from the cage. A new cage and
fresh bedding were used for each mouse.
Nest construction test.
This test evaluates the natural nest building behavior of mice when providing
them with clean nesting material directly in their home cage (14). Six weeks
before the test, each mouse was singly housed for the night and given nesting
material Nestlets (5 x 5 cm squares of pressed white cotton) for training.
During the test, mice were also individually housed and six Nestlets were
placed in the middle of each cage (at 4 pm). At 9 am of next day the
experimenter scored the position in the cage and the shape of the nest of
each cage, whether there had been digging in the bedding and how many
Nestlets were still visible. A nest consisted of a low pile of bedding with a
crater at the top, surrounded by, or sometimes covered with, shredded cotton.
Six nest shape could be scored based on (14): 0 no visible piling of bedding
and no shredded cotton; 1 bedding mound and crater alone, no shredded
cotton; 2 bedding mound and crater, cotton shredded around (flat); 3 bedding
mound and crater, cotton shredded around to form a crater-shaped nest; 4
bedding mound and crater, cotton shredded around to form a cup-shaped
nest; 5 bedding mound and crater, cotton shredded around to form a ballshaped nest covering the mouse (see Supplementary Fig. S4A for illustration
of each shape).
Marble burying test.
This test takes advantage of mice spontaneous digging behavior when given
a suitable substrate such as a thick layer of bedding (15). In a mouse cage
20
(35 × 20 × 15 cm), twenty clean and identical glass marbles were placed,
equally spaced in five rows of four marbles on a 4 cm layer bedding. For each
animal a different cage with fresh bedding was used but illumination was kept
homogeneous. The test mice were all moved to an adjacent room to the
experimental room (same climatic condition) at least 30 min before the test.
The animal was placed in the testing cage close to a wall and allowed to
explore the cage for 30 min. The test was video recorded and the latency for
the first marble to be buried was manually scored. At the end of the test the
mouse was rapidly removed from the cage and the total number of marbles
buried counted. A marble was considered “buried” when two thirds of its
volume was covered by bedding. The marbles were cleaned with 5 % alcohol
and dried for approximately 10 min before being used again.
Burrowing test.
This test evaluates the natural tendency of mice to burrow and do tunnel
maintenance when it is filled with small-solid objects such as food pellets (16,
17). The test was performed in the animals’ home cage (40 × 40 × 35 cm)
with the animal singly housed over night. Two days before the test, a tube
(grey plastic tube, 20 cm long, 6.8 cm diameter with a closed extremity) filled
with regular food pellets was placed in the home cage over night. On the day
of the test all objects in the cage and food (from the top of the cage) were
removed and a tube filled with 200 g of food pellets was placed in each cage
against the longer wall of the test cage. The opening of the tube was elevated
using bedding underneath it. The test was started 3 h before the dark phase.
The amount of material displaced from the burrow was measured after 2 h of
test and after a full dark phase.
21
Home cage screening.
For the quantification of natural animal behavior in the familiar environment of
its home cage, we used the HomeCageScan (HCS) software (CleverSys;
cleversysinc.com) which detect automatically different behaviors of freely
moving mouse in its home cage (40 × 40 × 35 cm) during 24 h / 7 d. The
software was installed on a computer outside the experimental room and data
and videos were directly stored on an external hard disc (Western digital, WD)
connected to the HCS computer. General behavior patterns of the mice were
quantified during a 22 h period (Average of 10 h of light phase and 12 h of
dark phase/mouse). Among other behaviors detected, the more meaningful
behaviors for this study were durations of grooming, resting, eating and
drinking (mean per hour in seconds) and distance travelled (mean in m).
Open Field Test.
This test is used to examine the natural tendency of the mouse to explore a
new, open environment (18). Spontaneous activity in the open field was
tested in a squared arena (45 x 45 cm, 47 cm high) placed in a sound
insulated, light controlled cabinet (multi-conditioning system MCS, TSE). The
light condition was kept dim (50 lux max) and uniform across animals and to
be the less anxiogenic as possible as we wanted to focus on differences in
exploratory tendencies between groups mostly. The open field was cleaned
with 5% alcohol between animals. The test mice were all moved to an
adjacent room to the experimental room (same climatic condition) at least 30
min before the test. Individual animals were placed in the center of the open
field and were allowed to explore it for 20 min. Time spent in different areas of
the field, distance traveled and latency to enter zones were automatically
22
recorded using the MCS Actimot software and video recorded on DVD.
Number of grooming, freezing, urination and defecation were scored
manually.
Statistical analysis of the behavioral data.
The data, given in figures and text are expressed as boxplots representing the
median (band), the first and third quartiles (box), the 10th and 90th percentiles
(whiskers), and the mean (+). Due to the small number of animals per group
the normality of the distribution of our data cannot be extrapolated and the
use of parametric test to be avoided as the risk type I error is increased. We
used non-parametric statistical tests which are independent of the distribution
of the dataset but use the ranks differences between series. To compare
paired data we used the Wilcoxon signed ranks test for paired samples (non
parametric test equivalent to the paired t-test) and to compare independent
values we used the Mann-Whitney U test for two independent samples (19,
20) AnaStats.fr). A p value below 0.05 was considered to be significant.
23
4) Supplementary References
1.
Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D. Germline
transmission and tissue-specific expression of transgenes delivered by
lentiviral vectors. Science 2002 Feb 1; 295(5556): 868-872.
2.
Rosario M, Franke R, Bednarski C, Birchmeier W. The neurite
outgrowth multiadaptor RhoGAP, NOMA-GAP, regulates neurite
extension through SHP2 and Cdc42. J Cell Biol 2007 Jul 30; 178(3):
503-516.
3.
Parthasarathy S, Srivatsa S, Nityanandam A, Tarabykin V. Ntf3 acts
downstream of Sip1 in cortical postmitotic neurons to control progenitor
cell fate through feedback signaling. Development 2014 Sep; 141(17):
3324-3330.
4.
Rademacher N, Kunde SA, Kalscheuer VM, Shoichet SA. Synaptic
MAGUK multimer formation is mediated by PDZ domains and
promoted by ligand binding. Chem Biol 2013 Aug 22; 20(8): 10441054.
5.
Green EC, Gkoutos GV, Lad HV, Blake A, Weekes J, Hancock JM.
EMPReSS: European mouse phenotyping resource for standardized
screens. Bioinformatics 2005 Jun 15; 21(12): 2930-2931.
6.
Rogers DC, Jones DN, Nelson PR, Jones CM, Quilter CA, Robinson
TL et al. Use of SHIRPA and discriminant analysis to characterise
marked differences in the behavioral phenotype of six inbred mouse
strains. Behav Brain Res 1999 Nov 15; 105(2): 207-217.
7.
Irwin S. Comprehensive observational assessment: Ia. A systematic,
quantitative procedure for assessing the behavioral and physiologic
state of the mouse. Psychopharmacologia 1968 Sep 20; 13(3): 222257.
8.
Rogers DC, Fisher EM, Brown SD, Peters J, Hunter AJ, Martin JE.
Behavioral and functional analysis of mouse phenotype: SHIRPA, a
proposed protocol for comprehensive phenotype assessment. Mamm
Genome 1997 Oct; 8(10): 711-713.
24
9.
Spencer CM, Alekseyenko O, Serysheva E, Yuva-Paylor LA, Paylor R.
Altered anxiety-related and social behaviors in the Fmr1 knockout
mouse model of fragile X syndrome. Genes Brain Behav 2005 Oct;
4(7): 420-430.
10.
Moy SS, Nadler JJ, Perez A, Barbaro RP, Johns JM, Magnuson TR et
al. Sociability and preference for social novelty in five inbred strains: an
approach to assess autistic-like behavior in mice. Genes Brain Behav
2004 Oct; 3(5): 287-302.
11.
Guy J, Gan J, Selfridge J, Cobb S, Bird A. Reversal of neurological
defects in a mouse model of Rett syndrome. Science 2007 Feb 23;
315(5815): 1143-1147.
12.
Crawley JN. Behavioral phenotyping of transgenic and knockout mice:
experimental design and evaluation of general health, sensory
functions, motor abilities, and specific behavioral tests. Brain Res 1999
Jul 17; 835(1): 18-26.
13.
Yang M, Crawley JN. Simple behavioral assessment of mouse
olfaction. Curr Protoc Neurosci 2009 Jul; Chapter 8: Unit 8 24.
14.
Deacon RM. Assessing nest building in mice. Nat Protoc 2006; 1(3):
1117-1119.
15.
Deacon RM. Digging and marble burying in mice: simple methods for in
vivo identification of biological impacts. Nat Protoc 2006; 1(1): 122-124.
16.
Deacon RM. Burrowing in rodents: a sensitive method for detecting
behavioral dysfunction. Nat Protoc 2006; 1(1): 118-121.
17.
Deacon RM. Burrowing: a sensitive behavioral assay, tested in five
species of laboratory rodents. Behav Brain Res 2009 Jun 8; 200(1):
128-133.
18.
Gould TD, Dao DT, Kovacsics CE. The Open Field Test, vol. 42.
Springer, 2009.
19.
Georgin J-P, Gouet M. Statistiques avec Excel P U DE RENNES,
2005.
20.
Siegel S, Castellan JN. Nonparametric statistics for the behavioral
sciences. 2nd edn. McGraw-Hill (New York), 1988, 399pp.
25