Supplementary Materials and Methods
Human Endometrial Tissue
All human tissue samples were obtained from patients under protocols approved by
Institutional Review Boards at the University of Texas Health Science Center and MD
Anderson Cancer Center.
Gene expression was analyzed in fresh frozen tissues from 71 endometrioid adenocarcinoma
samples obtained at the time of hysterectomy and submitted to the Department of
Pathology, MD Anderson Cancer Center. Diagnoses were confirmed following light
microscopic examination of H&E-stained slides by a gynecologic pathologist at MD Anderson
Cancer Center (Houston, TX). Tissues were frozen in liquid nitrogen and stored at -80 C.
Gene expression was analyzed in postmenopausal endometrial tissues obtained from a
selected subset (n = 11) of a large group of healthy postmenopausal women (n = 210)
participating in a clinical trial of estrogen replacement therapy (ERT) as described
previously(Deng et al., 2005). Tissues were frozen in liquid nitrogen and stored at -80 C.
DNA methylation analysis was conducted on normal tissues derived from baseline
endometrial biopsies from an endometrial cancer chemoprevention trial as previously
described (Xie et al., 2007). Endometrial pipelle biopsies (n=10) were obtained under
conditions approved by the institutional review board at the University of Texas M.D.
Anderson Cancer Center. Tissues were frozen in liquid nitrogen and stored at -80 C. DNA
methylation status was also analyzed in endometrial cancer cells which were manually
dissected from adjacent stroma in paraffin-embedded tumor sections using a 2.0 mm biopsy
punch (Fray Products Corp.).
RNA extraction
Frozen tissues were homogenized in TriReagent® (Molecular Research Center) and RNA was
precipitated with isopropanol, applied to RNeasy spin columns (Qiagen), eluted, and treated
with RNase-free DNase for 30 min at 37 C, followed by heat inactivation at 75 C and storage
at -80ºC.
Quantitative Real Time-RT PCR (QPCR)
QPCR was performed utilizing the 7700 Sequence Detector (Applied Biosystems) as
previously described (Xie et al., 2007). Taqman real-time quantitative assays for survivin
and 18S rRNA were developed using Primer Express software (Applied Biosystems) based
on sequences from GenBank. The assays were developed and all QPCR reactions were
completed at the Quantitative Genomics Core Laboratory (UT-Houston Medical School,
Houston, TX, USA). The primer and probe sequences and accession number for the survivin
assay are: 181+CCACTGCCCCACTGAGAAC, 255-GGCTCCCAGCCTTCCAG, 204+FAMCAGACTTGGCCCAGTGTTTCTTCTGCT-BHQ, NM_001168. The 18s rRNA assay details have
been previously published (Xie et al., 2007). The final transcript values were normalized to
those determined for 18S rRNA and are presented as molecules of transcript/molecules of
18S rRNA.
Cell culture
Ishikawa endometrial cancer cells (ATCC) were maintained in RPMI1640 medium (Gibco)
supplemented with 10% FBS, 1U/mL penicillin/ 1ug/mL streptomycin, and 10mM Hepes.
HCT116wt and HCT116 p53-/- colon cancer cells (a generous gift from Dr. Bert Vogelstein)
were maintained in McCoy’s 5a growth medium (Gibco) supplemented with 10% FBS and
1U/mL penicillin/ 1µG/mL streptomycin. All cells were maintained in a humidified 37ºC
incubator with 5% CO2.
DNA isolation
DNA was isolated according to TriReagent® protocol by phenol and chloroform separation,
ethanol precipitation, and solubilization in 8mM NaOH. HEPES was used to adjust the pH to
8.4 prior to bisulfite treatment.
Bisulfite Treatment of DNA
Bisulfite modification of 2µg of DNA was performed by using the EZ DNA Methylation-Gold
Kit™ (Zymo Research Corp.) according to manufacturer protocol
Methylation Analysis
Metylation specific PCR (MSP) was conducted on bisulfite treated DNA from 5 normal
endometrial tissue and 15 endometrioid adenocarcinomas. Each sample was PCR amplified
in parallel in a 10µL reaction volume under the following conditions: 1X PCR buffer (16.6
mM ammonium sulfate, 67 mM Tris-HCL pH 8.8, 6.7 mM MgCl2, 10 mM -mercaptoethanol),
0.5mM dNTPs, 200nM specific methylated or unmethylated PCR primer pairs and 0.5U
HotStart Taq DNA polymerase (Qiagen). Thermocycler condition were: 15min. at 95ºC, 35
cycles of 30sec. at 95ºC, 30sec. at 55ºC and 30sec. at 72ºC followed by a final extension
step of 10min. at 72ºC. PCR product was subject to gel electrophoresis on a 6% 0.5X TAE
polyacrylamide gel and visualized by ethidium bromide staining. Results were validated by
bisulfite Pyrosequencing™. PCR reactions were carried in 50 µl reaction volume including 2
µl bisulfite treated DNA, 16 mM (NH4)2SO4,67 mM Tris-HCl (pH 8.8), 1 mM 2mercaptoethanol 2 mM MgCl2, 0.125 mM dNTP, 1 unit Taq polymerase, and 200 nM
primers. Results were quantitated using the PSQ HS 96Pyrosequencing System
(Pyrosequencing Inc) at the UCLA Sequencing Core in the Department of Human Genetics.
Three of the samples were spiked with 100%, 25% and 10% in vitro methylated DNA to
monitor the efficiency of the pyrosequencing reaction. The assay is biased against
methylation such that the measured percentages for the 100%, 25% and 10% methylated
samples were 32%, 6% and 3% respectively. We conducted linear regression analysis and
generated a standard curve with a 99% correlation coefficient to correct for this assay bias.
Sss1 in vitro Methylation
DNA samples were methylated in vitro using the CpG Methylase M.SssI (New England
Biolabs) according to manufacturer protocol.
Gel-shift assay
Single stranded oligonucleotide probes were duplexed, methylated, then labeled with the
Biotin 3' End DNA Labeling kit (Pierce Biotechnology) according to manufacturer’s protocol.
Binding reactions (RT, 20 min) contained 20ng purified p53 protein (Active Motif), buffer (10
mM Tris pH 7.5, 50 mM KCl, 5 mM MgCl2, 1 mM dithiothreitol, 0.05% TX-100, 2.5%
glycerol), 1 µg poly(dI-dC), and 2 nM of biotinylated survivin probe (5'-
3':senseGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCG anti-senseTGGCGCGCCGCGGGGCATGTC GGGAGCGCACGCCCTCTTA). The probe is designed such that
duplex will contain 3nt overhangs on the 3’ ends. Biotinylation efficiency was estimated by
dot blot analyses against control oligonucleotides. Protein-DNA complexes were resolved on
5% Tris borate-EDTA gels, transferred to nylon membranes, and visualized utilizing the
Chemiluminescent Nucleic Acid Detection Module (Pierce Biotechnology) according to
manufacturer’s protocol. Some reactions were preincubated for 10 min with 200-fold excess
of unlabeled probe and/or an anti-p53 antibody (Active Motif) before adding biotinylated
probe.
For the E2F1 gel shift, HCT116 p53-/- cells were transfected with a CMV-E2F1
overexpression vector (Addgene plasmid 10736- 408 pSG5L HA E2F1) and nuclear lysates
were prepared with NE-PER nuclear and cytoplasmic extraction kit (Pierce). Probes were
then incubated with 5µg nuclear lystae and analyzed as described above. Some reactions
were preincubated for 10 min with 200-fold excess of unlabeled survivin probe or anti-E2F1
antibody (Santa Cruz) before adding biotinylated survivin.
Drug treatment
Cells were grown to 60% confluency then treated with 0.5µM, 1µM or 2µM doxorubicin
(Sigma) for 48hrs.
Cells treated with decitabine (5-Aza-2-deoxycytidine) were seeded to 20% confluency then
maintained in 2µM decitabine (Sigma) for 4 days. Media was changed daily with fresh drug
application.
Western Blot
Cells were lysed by incubation for 1 hour at 4°C in 100 µL Triton lysis buffer [1% Triton X100, 150 mmol/L NaCl, 25 mmol/L Tris (pH 7.5), 1 mmol/L glycerol phosphate, 1 mmol/L
sodium fluoride, and 1X Complete Mini Protease Inhibitor Cocktail (Roche Applied Science,
Indianapolis, IN)]. Lysates were centrifuged for 10 minutes at 14,000 x g at 4°C.
Supernatants were saved and boiled for 5 minutes with SDS-PAGE sample buffer (50
mmol/L Tris-HCL, 2% SDS, 0.1% bromophenol blue, 10% glycerol, and 5% ßmercaptoethanol). Samples then resolved by SDS-PAGE, and electrophoretically transferred
to nitrocellulose membranes. Membranes were incubated overnight at 4°C with primary
antibodies specific for survivin (Cell Signaling Technology), p53 (Calbiochem) and B-actin
(Millipore). Membranes were incubated with species-specific secondary antibodies then
visualized by chemiluminescence.
Microarray Analysis Using BeadChip Arrays
Microarray experiments were done on two independent RNA samples from HCT116 cells.
RNA was isolated as described above and microarray analysis was conducted using
HumanRef-8 BeadChip arrays from Illumina. RNA was amplified and hybridized according to
the manufacturer’s protocol. Following scanning, Bead Studio 3 (Illumina) was used for data
analysis.
Statistical Analysis
Statistical differences for QPCR analysis were calculated by Kruskal-Wallis non-parametric
one-way ANOVA followed by Dunn’s multiple comparisons post test. Differences for
pyrosequencing analysis were calculated by two-tailed Mann-Whitney non-parametric t-test.
Differences for QPCR microarray validation analysis were calculated by unpaired t-test.
Differences were considered significant if p<0.05. For microarray analysis, after background
subtraction arrays were normalized to each other by quantile normalization. Changes in
gene expression were tested using a modified t-test that employs estimates of variation that
include sequence specific biological variation (sbio), nonspecific biological variation (sneg) and
technical error (stech) ( Illumina User Guide, rev B. page 6-11 – 6-12, 2005, Illumina Inc) .
Genes were considered differentially regulated at p<0.001.