Materials
The antibodies used were anti-S100A7 (Imgenex, San Diego, CA), anti- phosphotyrosine-PY20 (BD
Biosciences), anti-PCNA clone PC-10 (DAKO, Copenhagen, Denmark), anti-E-Cadherin, Snail, p65
and c-Myc (Santa Cruz Biotechnology), anti-Flag tag (clone M2, Sigma), -Catenin (Cell Signaling),
anti- HA tag (Roche). TO-PRO-3 iodide and Alexa Fluor 488-conjugated rabbit anti-mouse and 594conjugated goat anti-rabbit IgG were from Molecular Probes (Eugene, Oregon); Other secondary
antibodies were from Jackson ImmunoResearch Laboratories. Recombinant human EGF was from
Cell Sciences (Canton, MA).
Plasmids
pTOPFLASH, pFOPFLASH were generously provided by Dr. Pierre D. McCrea (UT. MD Anderson
Cancer Center), GSK3β and pcDNA-HA-AKT were kindly provided by Dr. Mien-Chie Hung (UT.
MD Anderson Cancer Center). The plasmids encoding Flag-tagged wild-type and mutant β-Catenin,
pcl-Flag-Siah, pcDNA3-HA-SIP were been described (Matsuzawa & Reed, 2001). Mutant β-CateninpBabe retroviral vector was from Dr. Xiangwei Wu (UT. MD Anderson Cancer Center). For
construction of retroviral luciferase vector, a PCR product of luciferase cDNA was amplified from
PGL3 vector (Promega) and cloned into pBMN-I-GFP (Dr. Garry. P. Nolan, Stanford University) to
generate pBMN-I-Luc-GFP.
Cells
Tu167 cell, generated from a patient’s floor of mouth SCCOC (Swan et al., 2003), is a cell line with
indolent local growth lacking metastasis when injected into mouse tongue. The JMAR cell line was
derived from growth of Tu167 in suspension culture for 6 cycles to generate an anoikis-resistant cell
line (Swan et al., 2003), which displays aggressive local growth and occasional metastasis to cervical
lymph nodes when injected into mouse tongues. The DM14 line was generated from the Tu167 cell
line by picking colonies grown in soft agar and is the most aggressive cell line amongst these three cell
lines, which is characterized by rapid local growth and frequent metastasis to cervical lymph nodes
and lungs when injected into mouse tongue. Cell were cultured in DMEM medium with 10% FBS. For
cell detachment, 2 x106 cells were cultured in 15 ml conical tube with constant rotation for 24 h before
harvested.
Transient DNA, and siRNA transfections
Lipofectamine 2000 (Invitrogen) was used for DNA transfection in 293T cells and siRNA
transfections in JMAR cells. For siRNA transfection assays, S100A7-specific small RNA (sense: 5’GGGCACAAAUUACCUCGCCtt) and Silencer negative control siRNA (cat# 4611) were purchased
from Ambion (Austin, TX). Nucleofector Kit V and program #U-31 (Amaxa biosystems) were used
for Tu167, JMAR transfection.
Generation of adenovirus and retrovirus expressing S100A7, luciferase (Luc)
The AdEasy XL adenoviral vector system (Stratagene, CA) was used to generate Flag-tagged
S100A7-expressing adenovirus according to manufacture’s protocol. pBMN-I-Luc-GFP vector was
transfected into Phoenix cells to generate Luc-expressing retrovirus that was subsequently used to
infect JMAR cells. Luc-transduced stable JMAR cells were obtained by sorting GFP-positive cells for
green fluorescence with a FACSscan (Becton Dickinson).
Cell proliferation , migration and colony formation assays
Cell proliferation was determined using either the tetrazolium-based (i.e., MTT) assay as described in
ref. (Yigitbasi et al., 2004) or cell number counting. The Biocoat cell inserts (BD, MA) were used for
cell migration assay. Essentially, 48 h after virus infection (10 moi), cells were serum-starved for
another 16 h before plated onto the upper side of transwells (25,000 cells/well) in a 0.1 ml of a serumfree medium. After 0.5 ml of the medium containing 10% serum or 100 ng/ml EGF was added to the
lower chamber, the cells were allowed to migrate overnight at 37oC. At the end of the experiment, the
transwell insertd were washed with PBS, fixed with methanol/acetone, and stained with crystal violet.
Cells on the upper chamber side of the membrane were removed with cotton swabs, and cells that
migrated through the membrane were counted. For the colony formation assays, 1,000 virus-infected
cells (48 h after infection) were plated in 10-cm dishes. Colony numbers were counted 3 weeks later
using 0.1% crystal violet staining.
Generation of small hairpin RNA (shRNA)-expressing lentivirus and establishment of stable clones
under-expressing S100A7 or β-Catenin
To stably knockdown the expression of S100A7, the three independent small hairpin DNAs targeting
S100A7 (#1-3) and two control DNAs (#4-5) were cloned into pRNAT-U6.2/lenti vector (GenScript):
#1: 5’GATCCGGGCACAAATTACCTCGCCTTCAAGAGAGGCGAGGTAATTTGTGCCCTTTTTTGG
AAC-3’; #2: 5’GATCCGGACAAGAATGAGGATAAGTTCAAGAGACTTATCCTCAT
TCTTGTCCTTTTTTGGAAC-3’; #3: 5’GATCCGCTCAAGCTGAGAGGTCCATAATTCAA
GAGATTATGGACC TCTCAGCTTGAGTTTTTTGGAAC-3’; #4: 5’-GATCCGAGCACAAC
TTACCTCGCCTTCAAGAGAGGCGAGGTAAGTTGTGCTCTTTTTTGGAAC-3’; #5: 5’-G
ATCCGCCAATATTGAAACCCACGGTTCAAGAGACCGTGGGTTTCAATATTGGCTTT
TTTGGAAC-3’. Targeting vectors were then co-transfected with ViraPowerTM Packaging Mix
(Invitrogen) into 293FT cells to generate lentivirus. To stably knockdown the expression of β-Catenin,
the two independent small hairpin DNAs targeting β-Catenin (#A and B) and one control DNAs (#C)
were cloned into pLVTHM vector (Addgene): #A: 5’CGCGTGTGG GTGGTATAGAG
GCTCTTCAAGAGAGAGCCTCTATACCACCC ACTTTTTGGAAAT-3; #B:
CGCGTGCAAGCTCATCATACTGGCTTCAAGAGAGCCAGTATGATGAGCTTGCTT TTTGG
AAAT; #C: CGCGTGCCAATA TTGAAACCCACGGTTCAAGAGA CCGTGGGTT
TCAATATTGGCTTTTTGGAAAT. Targeting vectors were then co-transfected with pCMV-dR8.2
and pMD2.G (Addgene) into 293FT cells to generate lentivirus. Recombinant shRNA lentivirus were
then used to infect cells and stable clone pools were obtained 2 weeks after infection by sorting GFPpositive cells for green fluorescence with a FACSscan (Becton Dickinson). Knockdown effects of
shRNA in stable pools of cells were further examined by Western blotting.
Luciferase reporter assay
For 293T cell transfection, 5 ng pRL-CMV, 50 ng reporter (TopFlash or FopFlash), 15 ng -Catenin in
combination with different amount of S100A7 (100 ng, 200 ng, and 400 ng, respectively) (Fig. 3D,
lanes 6-8), or 100 ng TopFlash, 15 ng -Catenin, 100 ng of S100A7, GSK3 Siah-1, and Sip (Fig.
4D) were co-transfecetd into cells in 12-well plate with Lipofectamine 2000. In Fig. 4C, transfection
was done using 50ng -Catenin, 50 ng HA-AKT or 400 ng S100A7 separately. In Fig. 4E, transfection
was done using 25ng wild-type or mutant -Catenin together with increasing amount of S100A7 (100,
200, and 400 ng). In all above transfections, empty vector pCDNA3.1 DNA was used to normalize
total DNA to 480 ng in each transfection. For Tu167 and JMAR trasfections, 0.5 g reporter
(TopFlash or FopFlash), 0.2g -Catenin in combination with 1 g or 2g of S100A7 (Fig. 3D, lanes
12-13 and 17-18) were transfected into 1 x 106 cells in 6-well plate, and empty vector pCDNA3.1
DNA was used to normalize total DNA to 2.7 g in each transfection. 48 h after transfection, cells
were lysed in Passive Lysis buffer (Promega), and then subjected to luciferase assay using the Sirius
luminometer (Berthold Detection Systems). Relative luciferase activities were normalized using either
renilla luciferase activity or the equal amounts of total lysate proteins. The remaining lysats were
further analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
Western blotting for transfected protein expressions.
Western blotting, immnoprcipitation and quantitative real-time RT-PCR
Unless indicated, cell samples were prepared in lysis buffer [10 mM Tris-HCl, 1% Triton-X 100, 0.5%
NP-40, 150 mM NaCl, 2 mM CaCl2, 0.1 mM sodium orthovanadate, and protease inhibitor cocktail
(Roche)], and subjected to SDS-PAGE and western-blotting as described in ref. (Yigitbasi et al.,
2004). SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL) was used as ECL
substrate. For detecting S100A7 expression in JMAR, Tu167 and DM14 cells, SuperSignal West
Femto maximum sensitivity substrate system was used. For isolation of the Triton X 100-insoluble
fraction, cells were prepared in the lysis buffer. After centrifugation, cell pellets were retrieved and
further dissolved in 1% SDS buffer (1% SDS, 100 mM NaCl, 10 mM HEPES, 2 mM EDTA, and
protease inhibitor cocktail). After sonication and incubation on ice for 20 min, samples were
centrifuged, and the supernatant represents the Triton-insoluble fraction, which was subjected to SDSPAGE and Western blotting with appropriate antibodies.
For IP, 400 l of cell lysate was incubated with 2 g of specific antibody (anti--Catenin, or
anti-S100A7 antibody) overnight, and then 40 l of protein A/G-Sepharose beads was added for 1 h.
Subsequently, the beads were washed three to five times in lysis buffer before the addition of SDS
sample buffer for SDS-PAGE and western blotting.
Relative quantities of mRNA expression were analyzed using real-time PCR (Applied
Biosystems ABI Prism 7700 Sequence Detection System, Applied Biosystems). The SYBR green
(Bio-rad) fluorescence dye was used in the study. After normalizing against endogenous Actin, the
amounts of transcripts were compared to those untreated samples, which were arbitrarily defined as
1.0.
Orthotopic injections of oral tumors
Male athymic nude mice of 6- to 12-weeks age were purchased from the animal production area of the
National Cancer Institute-Frederick Cancer Research Facility (Frederick, MD) and kept in a pathogenfree animal facility approved by the American Association for Accreditation of Laboratory Animal
Care. To produce tongue tumors, cells were harvested from subconfluent cultures and orthotopically
injected to mouse tongues. The procedures for cell injection, tumor measurements and subsequent
analyses were conducted as described in ref. (Yigitbasi et al., 2004). For JMAR virus-infected tumors
(Fig. 2F-I), forty-eight hours after infection with 10 moi of S100A7 or control GFP adenovirus, 0.5 x
106/mouse cells were injected orthotopically into tongues of male nude mice, and tumor sizes were
measured thereafter. Five mice in each group were injected. *P<0.05, was determined by two-sample
Wilcoxon rank-sum test. For S100A7 shRNA stable JMAR and Tu167 tumor (Fig. 7D-E, Fig. S3), 0.2
x 106 (JMAR), 0.5 x 106 (Tu167) cells/mouse were injected orthotopically into the tongues of 4 male
nude mice per group, and tumor sizes were measured with calipers thereafter. *P<0.05. was
determined by two-sample Wilcoxon rank-sum test.
Tumor specimens, IHC, and immunofluorescence microscopy
Archival human paraffin slides including normal and dysplastic mucosa and invasive SCCs of the oral
cavity were obtained from the Department of Head and Neck Surgery at The University of Texas M.
D. Anderson Cancer Center. All these specimens and the tissues of mouse tongue tumors were
processed for routine histological, IHC and Immunoflorescent analyses as previously described
(Yigitbasi et al., 2004). Two pathologists scored tumor cells expressing S100A7 in human specimens
independently. The average of two readings was used for statistical analysis. Wilcoxon rank-sum test
was used and P values < 0.05 were considered significant.
For tissue culture cell staining, cells grown in 6-well plates with glass coverslips were
transfected with or without siRNA or infected with virus for the indicated times. Cells were fixed in
4% formaldehyde in PBS before permeabilization in 0.2% Triton X-100 in PBS. After reactions were
blocked with 1% bovine serum albumin in PBS for 30 min at room temperature, indirect
immunofluorescent analysis was carried out with different primary antibodies for 1 h followed by
fluorescence-conjugated analysis with secondary antibodies for 1 h at room temperature in 1% bovine
serum albumin and 0.1% Tween 20 in PBS. Images were acquired using a Zeiss LSM 510 laser
confocal microscope.
References
Matsuzawa SI, Reed JC. (2001). Siah-1, SIP, and Ebi collaborate in a novel pathway for beta
catenin degradation linked to p53 responses. Mol Cell 7: 915-26.
Swan EA, Jasser SA, Holsinger FC, Doan D, Bucana C,Myers JN. (2003). Acquisition of anoikis
resistance is a critical step in the progression of oral tongue cancer. Oral Oncol 39: 648-55.
Yigitbasi OG, Younes MN, Doan D, Jasser SA, Schiff BA, Bucana CD, et al. (2004). Tumor cell
and endothelial cell therapy of oral cancer by dual tyrosine kinase receptor blockade. Cancer Res
64: 7977-84.