1
Online Resource
Ivana Vrhovac, Daniela Balen Eror, Dirk Klessen, Christa Burger, Davorka Breljak, Ognjen
Kraus, Nikola Radović, Stipe Jadrijević, Ivan Aleksic, Thorsten Walles, Christoph Sauvant,
Ivan Sabolić, Hermann Koepsell
Localizations of Na+-D-glucose cotransporters SGLT1 and SGLT2 in
human kidney and of SGLT1 in human small intestine, liver, lung and
heart
Methods
Isolation of RNA and RT-PCR
A detailed protocol of these methods has been described previously [1]. In short, three months
old male rats were sacrificed by decapitation. The kidneys, lungs
and hearts were
immediately submerged into the RNAlater solution (Sigma St. Louis, MO, USA). Total
RNAs were isolated using Trizol (Invitrogen) as recommended by the manufacturer. Reverse
transcriptase PCR was performed with “First Strand cDNA Synthesis Kit“ obtained from
Fermentas Int., Ontario ( Canada) following the manufacturer's instructions. For amplification
of
rSglt1
cDNA-fragments,
the
following
primers
were
used:
forward
5'ATTCATCAATCTGGCCTTGG3' (GenBank Accession No. NM_013033; Invitrogen;
fragment 628–648); reverse 5'TATTCCGAGACCCCATTACG3' (GenBank Accession No.
No. NM_013033; Invitrogen; fragment 920–940). The housekeeping gene β-actin was used as
control. The PCR conditions were: initial denaturation for 3 min at 94°C, denaturation for 30
s at 95°C, annealing for 30 s at 59°C and elongation for 45 s at 72°C, with 30 cycles for
rSglt1 in lung and β-actin, and 40 cycles for rSglt1 in heart. The optimal number of PCR
2
cycles within the exponential phase of the PCR reaction was determined in preliminary
experiments. RT-PCR products were resolved by electrophoresis in 1% agarose gel, stained
with ethidium bromide, visualized under ultraviolet light, and photographed with a digital
camera.
Immunocytochemistry
Immunocytochemistry in tissue cryosections was performed using protocols and primary and
fluorescent-labeled secondary antibodies as described and documented in the main
manuscript. Immunostaining of human lung for SGLT1 (Fig. S1, A and C) was performed
with the commercial, goat-raised hSGLT1-Ab (hSGLT-comAb; Everest Biotech Ltd,
Oxfordshire, UK, #EB09310) and the secondary antibody CAG-CY3, as described in the
main manuscript. To test the staining specificity in Fig. S1, B and D, the hSGLT1-comAb
was preincubated with the commercial immunizing peptide (0.5 mg/mL; #EBP09310) at room
temperature 4 h prior to immunostaining. For double staining of rat lung for rSglt1 and
tubulin (Fig. S2, B and C) we used a previously characterized rabbit-raised polyclonal
antibody againsed rat Sglt1 (rSglt1-Ab) [1] and a commercial monoclonal antibody against αtubulin (tubulin-Ab), and the respective secondary antibodies GAR-CY3 and GAM-FITC.
Double staining for Na/K-ATPase with monoclonal antibody and AQP1 with polyclonal
antibody in rat heart (Fig. S3, B) was performed with the antibodies that cross-react between
human and rat, and the respective secondary antibodies GAM-FITC and GAR-CY3 (c.f. Fig.
11 in the main manuscript). For double staining of AQP1 and rSglt1 in rat heart (Fig. 3S, C)
we used the non-commercial rabbit-raised polyclonal antibody for AQP1 and a commercial,
goat-raised polyclonal antibody for rSglt1 (rSglt1-comAb) from Everest Biotech, Oxfordshire,
UK (#EB11236), and the respective secondary antibodies GAR-CY3 and CAG-FITC.
3
Results
To confirm the localization of hSGLT1 in Clara cells of bronchioli and alveolar type 2 cells in
human lung obtained with the hSGLT1-Ab that was generated in our laboratory (Figs. 9 and
10 of the manuscript) we also performed immunostaining of cryosections from human lung
with a commercial antibody against hSGLT1 (hSGLT1-comAb) raised in goat that was
delivered by Everest Biotech (Oxfordshire, UK). With hSGLT1-comAb the same location of
hSGLT1 in human lung was obtained as with our hSGLT1-Ab. In bronchioli, the hSGLT1comAb immunoreactivity was observed in some epithelial cells (Fig. S1A); in most of these
cells the staining was apical (arrows), but some cells showed a vesicular intracellular staining
(inset in Fig. S1A; arrowheads). In alveoles, hSGLT1-comAb immunoreactivity was observed
in individual round cells (Fig. S1C, arrows). The immunoreactivity at the described locations
could be blocked with antigenic peptide (Fig. S1B and D).
Fig. S1. hSGLT1 localizations in human lung, as found with hSGLT1-comAb (Everest
Biotech product No. EB09310). A) Immunostaining of individual epithelial cells in
4
bronchioli. In most stained cells apical/subapical staining was observed (arrows) whereas
some epithelial cells showed intracellular hSGLT1-comAb immunoreactivity (arrowheads in
the inset). C) Immunostaining of individual alveolar cell (arrows) in peripheral lung tissue.
Immunostaining of epithelial cells in bronchioli (B) and of cells in peripheral lung tissue (D)
with hSGLT1-comAb was blocked with the antigenic peptide (Everest Biotech., product No
EBP09310). Bar, 20 µm.
We have also investigated the expression and location of rSglt1 in rat lungs. With RT-PCR,
using RNA isolated from rat lung and rSglt1-specific primers, we demonstrated the presence
of rSglt1 mRNA in the lung tissue (Fig. S2A). Double staining of the rat lung tissue
cryosections with a previously characterized antibody against rat Sglt1 (rSglt1-Ab) [1] and an
antibody against α-tubulin (tubulin-Ab) revealed similar results as in the human lung. In
bronchioli, rSglt1-Ab (Fig. S2B, arrows) and tubulin-Ab (Fig. S2B, arrowheads) stained
different epithelial cells. Also similar to data in human lung, in some epithelial cells we
observed a strong intracellular rSglt1-Ab immunoreactivity. Because α-tubulin is located in
the ciliated epithelial cells, the cells showing immunoreactivity for rSglt1-Ab were identified
as Clara cells. In alveoles, the rSglt1-Ab immunoreactivity was observed in individual round
cells (Fig. S2C, arrows) whereas the green background staining was obtained with tubulin-Ab.
The rSglt1-Ab positive cells in the alveoles are probably alveolar type 2 cells. The staining of
epithelial cells in bronchioli and of cells in alveoli with rSglt1-Ab could be blocked with
antigenic peptide (data not shown). The data indicate the same localization of rSglt1 in lungs
of rat as in human.
5
Fig. S2. Expression and localization of Sglt1 in rat lung. A) Demonstration of rSglt1 mRNA
in the lungs from 3-months old male rats by RT-PCR using rSglt1-specific primers. The
housekeping gene β-actin was used as loading control. B) Localization of rSglt1 in epithelial
cells of bronchioli. Double staining was performed with rSglt1-Ab (red) and tubulin-Ab
(green). Clara cells (arrows) and ciliated cells (arrowheads) are indicated. C) Localization of
rSglt1 in alveoles employing double staining with rSglt1-Ab (red) and tubulin-Ab (green).
rSglt1-Ab immunoreactivity was observed in individual round cells (arrows) whereas
background staining was observed with tubulin-Ab. Bar, 20 µm.
To determine whether SGLT1 is expressed in capillaries of heart muscle in different species
we determined by RT-PCR whether rat heart contains rSglt1 mRNA and performed
immunostaining of the rat heart cyrosections with a commercial antibody against rat Sglt1
(rSglt1-comAb). rSglt1-comAb was raised in goat and allowed double staining with the
rabbit-raised AQP1-Ab. Using the rSglt1-specific primers we obtained a rSglt1-specific
amplification product indicating the presence of rSglt1 mRNA in the rat heart (Fig. S3A). At
variance to humans the amounts of rSglt1 amplification product in rat heart was smaller
compared to kidney. The amounts of rSglt1 amplification product varied among animals.
Double staining of cryosections from rat heart with Na/K-ATPase-Ab and rSglt1-comAb
revealed different localizations of Na/K-ATPase-Ab and rSglt1-comAb immunoreactivities;
whereas Na/K-ATPase-Ab bound to plasma membranes (Fig. S3B, thick arrowheads) and
6
intercalated discs (Fig. S3B, thin arrows) of myocytes, rSglt1-comAb bound to tubular
structures (Fig. S3B, thick arrows).
Double staining with rSglt1-comAb and AQP1-Ab
revealed localization of both proteins in the same tubular structures which represent heart
capillaries (Fig. S3C, arrows). In summary, the data indicate lower amounts of rSglt1 mRNA
in rat hearts compared to human hearts but that in both species SGLT1 protein is expressed in
heart capillaries.
Fig. S3. Expression and localization of rSglt1 in rat heart. A) Demonstration of rSglt1 mRNA
in hearts from 3-months old male rats by RT-PCR using rSglt1-specific primers. The
housekeping gene β-actin was used as loading control. B) Double staining of a cryosection
from rat heart with Na/K-ATPase-Ab (green) and rSglt1-comAb (read). Staining of
sarcolemma (arrowheads) and intercalated discs (small double arrows) by Na/K-ATPase-Ab
and staining of tubular structures by rSglt1-comAb (large arrows) is indicated. C) Double
staining of a cryosection from rat heart with AQP1-Ab and rSglt1-Ab. Colocalization of red
AQP1-Ab immunoreactivity and green rSglt1-Ab immunoreactivity is indicated by yellow
staining of tubular structures (arrows). Bar, 20 µm.
Reference
1.
Balen D, Ljubojevic M, Breljak D, Brzica H, Zlender V, Koepsell H and Sabolic I (2008)
Revised immunolocalization of the Na+-D-glucose cotransporter SGLT1 in rat organs
with an improved antibody. Am J Physiol Cell Physiol (295):C475-C489