Protein Synthesis Picture Book (80 pts)
Materials: 3 pieces of construction paper, 1 pairs of scissors, crayons, glue or tape, model for
tRNAs, construction paper (ribosomes),toothpicks or yarn for peptide bonds.
Pre-Activity : BEFORE Beginning Poster: List the following steps of Translation (Protein
Synthesis) in order on the back of this sheet. This will be marked and corrected by your teacher
for 20 points of this project before starting your poster, so make sure that this is correct!
DO NOT just write the letters in order.
STEPS OF TRANSLATION: (these are out of order)
a. Ribosome binds to the start codon, AUG, of mRNA.
b. Completed protein is released.
c. tRNAs bond to their correct amino acid and bring them over to mRNA
d. mRNA leaves the nucleus and enters the cytoplasm
e. tRNA anticodon is matched to the mRNA codon
f. Ribosome encounters the stop codon and falls of the MRNA.
g. Chain of amino acid forms with each new tRNA matching its mRNA codon
Directions for Protein Synthesis Poster:
1. Fold a piece of construction paper so that you have 8 blocks (the first block is the front of
the book. You may use a folded-book style or a flip-book style.
2. Use the steps in order from the Pre-Activity and label each of the blocks with one step.
The First step goes on the front cover (hint: it should be mRNA leaves the nucleus). Make
sure your steps are in order.
3. Make a picture in each block for each step: cut out the tRNAs and glue them where they
belong in any of the steps, use construction paper or draw ribosomes, cut out construction
paper boxes or other shapes for amino acids. In each step, draw an mRNA strand with the
following base sequence AUGCACGAGUAG ( You must use this sequence in every
block).
4. Ensure that all the main pieces are shown in each step: mRNA, ribosomal units, tRNAs,
and amino acids.
5. Your last block should show that a protein which is 4 amino acids long has been made.
6. You will be graded upon accuracy and % completion. Ensure all of your group members
names are on the back of your picture book.
Part 2 Translation into protein “sentences” (this is similar to our activity in class!) (10pts)
Use the Codon  Word chart to translate the following DNA codes into sentences:
1. GATGAGTTTTGCTGA;
2. ATTAGGTGGGAAGCCGCA:
3. CGAGCCTCTCCTCCGTCTCCC:
Part 3: Complete the Puzzle provided for by your teacher