S1. Methods
Genomic database searches: ITmD37E sequences were identified in the Aedes aegypti
(Ae. aegypti) (NIAID, Broad Institute, project accession AAGE02000000 at NCBI) and
Anopheles gambiae (An. gambiae) (HOLT 2002) whole-genome sequences by the use of
RepeatScout, TBLASTN, and BLASTN (ALTSCHUL et al. 1997; PRICE et al. 2005).
Culex pipiens quinquefasciatus (C. pipiens) genome trace files (>5X coverage, Sep.
2006) and ESTs (Oct. 2006) were searched by TBLASTN using ITmD37E sequences as
queries. Searches were performed through the VectorBase website
(www.vectorbase.org). The conceptually translated Open Reading Frame (ORF) from
AgamITmD37E_ele1.1 was used as the query for TBLASTN search of databases through
NCBI to find ITmD37E sequences from other taxa.
Representative ITmD37E sequences from Ae. aegypti and An. gambiae genomic
database searches, as well as sequences from PCR and genomic library screens (see
below) were submitted to the TEfam website
(http://tefam.biochem.vt.edu/tefam/index.php). TEfam is a relational database that was
created to facilitate storage and retrieval of mosquito TE information for the TE research
community. An element is defined as those sequences having 70% or greater nt identity
to a query element copy (e.g. the element AaegITmD37E_Ele4 can have multiple copies
described as AaegITmD37E_Ele4.1, AaegITmD37E_Ele4.2, etc.) Element boundaries
were determined by alignment and viewing with CLUSTAL_W and CLUSTAL_X
(THOMPSON et al. 1997; THOMPSON et al. 1994). Information regarding sequences used in
this study can be found in S2.
Polymerase chain reaction and cloning: ITmD37E sequences were obtained by
Polymerase Chain Reaction (PCR) (Ae. albopictus not shown here) and genomic library
screening (described in Shao and Tu, 2001). Genomic DNA used for PCR was isolated
using DNAzol (Molecular Research Center). PCR and primers used for amplification of
AgITmD37E_Ele1.2 were described previously (SHAO and TU 2001). A single primer
AAGYYTGCTYCRTTTARDMTTGG, corresponding to the consensus sequence of the
terminal inverted repeats (TIRs) of ITmD37E elements, was used to amplify sequences
from Ochlerotatus togoi (O. togoi) and Armigeres subalbatus (Ar. subalbatus). PCR was
performed using an AirClean 600 PCR workstation to minimize the possibility of
contamination. PCR was also performed in another laboratory de novo to verify that the
products were valid. That laboratory had never worked with mosquitoes prior to this
time. PCR products were purified from agarose gel after electrophoresis using the
Sephaglass Bandprep Kit (Amersham Pharmacia Biotech) and cloned into pGEM-T Easy
vector using a TA cloning kit (Promega). Cloned products were sequenced at the Virginia
Bioinformatic Institute Sequencing Facility at Virginia Polytechnic Institute and State
University (Virginia Tech).
Genomic library screening: The source and methods for screening genomic libraries
from O. atropalpus, O. epactius, and O. triseriatus were previously described (SHAO and
TU 2001). The genomic library of An. gambiae was provided by Shirley Luckhart in the
Department of Biochemistry at Virginia Tech (now at UC Davis, CA). The average insert
size of this library is approximately 15 kilobases (kb). Libraries for Ae. aegypti, Ae.
polynesiensis, O. bahamensis, and Toxorhynchites amboinensis (T. amboinensis) were
provided by the laboratory of Dr. Henry Hagedorn at the University of Arizona. All
libraries of different species were screened using three different probes (L, M, and N).
Probe L was prepared corresponding to the C-terminal coding region of ITmD37E in O.
atropalpus (AY038030, primers CGACCRTCCMGTAATGYTTTSGCC and
CATTAGGCGGCGGACACC). Probe M corresponds to the entire ORF of an ITmD37E
transposon in An. gambiae, which was obtained by PCR using primers
ATGGAAGCCGAAAGAAGGGA and GCAAATGTAGCGTTTTCTTCAT, designed
according to AL150661 and AL143513 in the STS database. Probe N corresponds to
AI637402 (sites from 11 to 252) from the Ae. aegypti EST database, and was obtained by
PCR using primers GCCGGTAATTTGTTTGGTG and CCTTTCCACCCGAGACG).
All probes were single stranded and labeled using asymmetric PCR. The labeling
conditions were performed as described in Tu and Hagedorn (1997). Hybridization and
signal detection were performed as in (SHAO and TU 2001). Genomic sequences flanking
ITmD37E elements isolated from non-Aedes aegypti and non-Anopheles gambiae
genomic libraries were compared and no match to either the Ae. aegypti genome
assembly nor the An. gambiae assembly was found.
Phylogenetic inference: Phylogenetic inference was performed using MrBayes version
3.1.2 (HUELSENBECK and RONQUIST 2001; RONQUIST and HUELSENBECK 2003).
Sequences were aligned with CLUSTAL_X version 1.83 (THOMPSON et al. 1997) using
the following parameters: pairwise alignment gap opening=10, gap extension=0.1;
multiple alignment gap opening=10, gap extension=0.2. For the ITmD37E phylogeny
based on conceptual translations of the ORFs, MrBayes was allowed to pick the best of
10 fixed-rate evolutionary models, resulting in choosing Blosum as the best model
(posterior probability = 1.0). 200,000 generations were run to achieve an average
standard deviation of split frequencies below 0.01, evidence of convergence of two
independent tree searches. The potential scale reduction factor (PSRF) was 1.0 for all
parameters, demonstrating an attainment of a good sample from the posterior probability
distribution. Alignments used for phylogenetic inference can be found in S3. Only those
mosquito sequences that had intact coding regions were included in the phylogeny,
except for AaegITmD37E_Ele4.1, AgamITmD37E_Ele2 and AgamITmD37E_Ele3, which
were obtained from whole-genome sequence projects.
Whole ORFs were used for ITmD37E phylogenetic inference when available. Of
the 38 previously submitted ITmD37E sequences, only those that could be aligned with
confidence were included. The 7 excluded sequences contained indels or were too
divergent for alignment. The accessions and species for the excluded sequences are:
AY09079, Ae. aegypti; AY09061, Ae. albopictus; AY09068, Ae. polynesiensis;
AY09073, Ar. subalbatus; AY09051, AY09052, Ae. atropalpus; AY09054, T.
amboinensis. The Modeltest server version 3.7 (POSADA and BUCKLEY 2004; POSADA
and CRANDALL 1998) was used to determine the best nt evolutionary model according to
a calculated Aikaike Information Criteria (AIC) score (ITmD37E: Hasegawa-KishinoYano plus Gamma, Vg-C: General Time Reversible plus gamma). To obtain ITmD37E
and Vg-C phylogenies, MrBayes was run for 1,000,000 and 100,000 generations,
respectively. For these runs, the average standard deviation of split frequencies was
below 0.01 and the PSRF was 1.0.
For construction of host phylogeny a 987 bp region (excluding intron sequence)
of vitellogenin C (Vg-C), a single copy yolk protein-encoding gene, was obtained from
previous work (ISOE 2000) and by PCR. All Vg-C sequences except for Ae. simpsoni and
O. togoi were obtained from (Isoe 2000). Ae. simpsoni and O. togoi Vg-C sequences were
amplified by PCR in our laboratory according to the methods of Isoe 2000. The following
describes methods according to Isoe’s 2000. Degenerate primers were designed to
amplify a 1.1 kb region that is specific for the Vg-C ortholog that includes the second
intron. Primers Vg-C-specific forward (5’(A/G)A(T/C)(A/G)TNAA(A/G)CA(T/C)CCNAA(A/G)G-3’), Vg-C-specific reverse (5’TC(A/G)TT(T/C)TG(T/C)TT(A/G)TA(T/C)TG(A/G/T)CC-3’), and Aedes universal
reverse (5’-C(A/G)T(A/G)CCA(A/G)CANTCNCCCAT-3’) were used in nested PCR.
The first PCR used the Vg-C-specific forward and reverse primers for 1 cycle at 94˚C for
3 minutes, 32 cycles at 94˚C for 1 minute, 50˚C for 1.5 minute, and 1 extension cycle at
72˚C for 10 minutes. The second PCR used the Vg-C-specific and Aedes universal
reverse primers with the same conditions except that the annealing temperature was
increased to 54˚C. PCR products were cloned into pGEM-T Easy (Promega) and
sequenced at the VBI core facility (Virginia Tech).
Literature Cited
ALTSCHUL, S. F., T. L. MADDEN, A. A. SCHAFFER, J. ZHANG, Z. ZHANG et al., 1997
Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res 25: 3389-3402.
HOLT, 2002 The genome sequence of the malaria mosquito Anopheles gambiae. Science
298: 129-149.
HUELSENBECK, J. P., and F. RONQUIST, 2001 MRBAYES: Bayesian inference of
phylogenetic trees. Bioinformatics 17: 754-755.
ISOE, J., 2000 Comparative Analysis of the Vitellogenin Genes of the Culicidae, Ph.D.
Dissertation, pp. 201 in Insect Science. University of Arizona, Tucson.
POSADA, D., and T. R. BUCKLEY, 2004 Model selection and model averaging in
phylogenetics: advantages of akaike information criterion and bayesian
approaches over likelihood ratio tests. Syst Biol 53: 793-808.
POSADA, D., and K. A. CRANDALL, 1998 MODELTEST: testing the model of DNA
substitution. Bioinformatics 14: 817-818.
PRICE, A. L., N. C. JONES and P. A. PEVZNER, 2005 De novo identification of repeat
families in large genomes. Bioinformatics 21 Suppl 1: i351-i358.
RONQUIST, F., and J. P. HUELSENBECK, 2003 MrBayes 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics 19: 1572-1574.
SHAO, H., and Z. TU, 2001 Expanding the diversity of the IS630-Tc1-mariner
superfamily: discovery of a unique DD37E transposon and reclassification of the
DD37D and DD39D transposons. Genetics 159: 1103-1115.
THOMPSON, J. D., T. J. GIBSON, F. PLEWNIAK, F. JEANMOUGIN and D. G. HIGGINS, 1997
The CLUSTAL_X windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res 25: 4876-4882.
THOMPSON, J. D., D. G. HIGGINS and T. J. GIBSON, 1994 CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res 22: 4673-4680.