Supporting Materials and Methods
RNA silencing
The lentiviral-based short hairpin RNAs (shRNA) vectors (pLKO.1 vectors) used to silence
-arr1 were purchased from Sigma-Aldrich, as previously described (22). The 22-mer
targeting sequences that resulted in efficient knockdown (>85% of silencing) included
TRCN0000230150 (#3) and were used for transient and stable -arr1 knockdown.
Transient transfection was performed by adding shRNA plasmid along with LipofectAMINE
2000 (Life Technologies) in 6-well plates for 72 hrs. Each knockdown experiment was
detected for specific reduced expression of -arr1 by IB using anti--arr1 Ab (Santa Cruz
Biotechology). Stable clones expressing the shRNA plasmids were selected using medium
containing 2 μg/mL puromycin (Invitrogen), and cell clones were stocked and screened for
protein expression by IB analysis. In the rescue experiments, we performed transient
transfection of pcDNA3 plasmid or 2 μg/ml of FLAG epitope-tagged WT -arr1 expression
plasmid, a ‘‘wobble’’ mutant construct encoding rat -arr1 sequence resistant to siRNA
targeting, kindly provided by Robert Lefkowitz (Howard Hughes Medical Institute, Duke
University, Durham, NC, USA), using LipofectAMINE 2000 reagent (Life Technologies
Italia).
For silencing of RhoA, two selected pre-designed and validates siRNAs (s759 and s760)
were tested for their knockdown efficiency (Life Technologies Italia). The silencer s760 and
silencer selected negative control #1 were used for transient transfection (72 h), using
LipofectAMINE 2000 reagent.
For silencing of RhoC, cells were transiently transfected with On-TARGET PLUS human
RhoC siRNA, or negative control (#D-001810-10-20) (GE Healthcare) for 72 h, using
LipofectAMINE 2000 reagent.
For silencing of PZD-RhoGEF, we performed transient transfection for 72 h using
pSUPER shRNA plasmid targeting PDZ RhoGEF (kindly provided by Kensaku Mizuno,
Department of Biomolecular Science, Graduate School of Life Science, Tohoku University,
Aramaki Aza Aoba, Sendai), using LipofectAMINE 2000 reagent.
Each knockdown experiment described here was detected for specific reduced expression
of specific protein target (75–90%).
Quantitative real-time PCR
Total RNA was isolated using the Trizol (Life Technologies Italia) according to the
manufacturer’s protocol. 1 μg of RNA was reversed transcribed using the SuperScript®
VILO™ cDNA synthesis kit (Life Technologies Italia). The expression of RhoA, RhoB,
RhoC, ETAR, PDZ and cyclophilin-A mRNA was evaluated in the 7500 Fast Real-Time
PCR System (Applied Biosystems, Branchburg, NJ, USA), using Power SYBR Green PCR
Master Mix (Applied Biosystems). The levels of gene expression were determined by
normalizing to cyclophilin-A mRNA expression and expressed in relative mRNA level
(2^ΔΔct), using the lower number of expression in one cell line as calibrator. The values
obtained from triplicate experiments were averaged, and data are presented as means ±
SD. The primers employed for real-time PCR were as follows:
RhoA F: CTTGCAGAGCAGCTCTCGTAG
RhoA R: GAGCACACAAGGCGGGAG
RhoB F: CGAGGTAGTCGTAGGCTTGG
RhoB R: CGACGTCATTCTCATGTCT
RhoC F: TGCAGCCTGGAACTTCAG
RhoC R: ACCAGCTTCTTTCGGATTGC
ETAR F: GTCTGCTGTGGGCAATAGTTG
ETAR R: GCTTCCTGGTTACCACTCATCAA
PDZ-RhoGEF F: TCCCTGAGATGCTACAGGCT
PDZ-RhoGEF R: TGTGCGCTTCGTTCTGTAGT
cyclophilin-A F: TTCATCTGCACTGCCAAGAC
cyclophilin-A R: TCGAGTTGTCCACAGTCAGC
RT-PCR
Total RNA was isolated using the Trizol (Invitrogen) according to the manufacturer’s
protocol. The semiquantitative PCR was conducted in the automated DNA Thermal Cycler
GeneAmp PCR System 9700 (Applied Biosystem) using AmpliTaq DNA Polymerase
(Applied Biosystem). The PCR products were analysed by electrophoresis on agarose gel
containing ethidium bromide. The primers sets used were as follows:
Cyclophilin F: TTCATCTGCACTGCCAAGAC;
Cyclophilin R: TCGAGTTGTCCACAGTCAGC.
p63RhoGEF F: GACCGGATACTGGGGGTCAT
p63RhoGEF R: TCCCTCCGTACGTTCAGACT
p114RHOGEF F: TTTCCGTGGCAGTGAGGAAC
p114RHOGEF R: CTAACCCTTGGCTCCACTG
p115RHOGEF F: ACAGTTCTGGGCCCCTTACA
p115RHOGEF R: ATAGTGTTCAGCCAGGGACAC
VSM F: TCTACCAGACCTACCGAGCA
VSM R: TGGGTGCATCTCCAGCATTT
p190RHOGEF F: GACATCAGTTTGCCCCAGGA
p190RHOGEF R: GAAGGGTGCAAGGAGAGACC
TRIO F: AGACCTCCTCGCTGGGAATA
TRIO R: TTCTTCCGATCCGGGTTTCG
LARG F: CAAACCTGCCCCACATGCTA
LARG R: GGAACCAAGCATGTGACTTTTACT
Immunoblotting and Immunoprecipitation
For immunoblotting analysis, cells were detached by scraping, collected by centrifugation
and lysed in Chaps Cell Extract Buffer (Hepes 40mM, Sodium chloride 120mM, Chaps
0.3%, Sodium pyrophosphate tetrabasic 10mM, Glycerol phosphate 10mM). Before
performing IB analysis, all lysates were sonicated, three times for 7 seconds, to enrich
protein extraction. Protein content of the extracts or conditioned medium was determined
using Bio-Rad protein Assay Kit. Whole cell lysates were resolved by SDS/PAGE and
transferred to nitrocellulose membranes (GE, Healthcare). The membranes were blocked
in TTBS (TBS with 0.1% Tween 20) containing either 5% dry milk or BSA. Primary
antibody incubations were performed in TTBS with either 5% dry milk or BSA overnight at
4 °C. After washing, the membranes were incubated with the appropriate secondary
peroxidase conjugated antibody for 1 hour in TTBS with either 5% dry milk or BSA. For
the immunoprecipitation, (IP), precleared whole cell lysates were incubated with indicated
Abs, or with irrelevant IgG (Santa Cruz Biotechnology) and protein G-agarose beads
(Amersham Pharmacia Biotech) at 4°C overnight. Following antibodies were used for IB
and IP: anti-RhoA, B, C (Millipore), anti-RhoA (Cytoskeleton), anti-RhoC (Abcam), antiROCK1 (BD Transduction Laboratories), anti-PDZ-RhoGEF (OriGene Technology), antiphospho-cofilin (pSer3) (Thermo Fisher Scientific), anti-cofilin (Cell Signaling Technology),
anti-phospho-Tyrosine
(Cell Signaling Technology), anti-β-arrestin 1 (Abcam), anti-tubulin (Santa Cruz
Biotechnology), anti-phospho-LIMK (Cell Signaling Technology), anti-LIMK (Cell Signaling
Technology) and anti-GAPDH (Santa Cruz Biotechnology). For the IP assay, the IP and
input (3% of the total extracts) samples were boiled for 5 minutes in SDS loading buffer,
loaded into 10% SDS/PAGE, and transferred to nitrocellulose membrane and IB with
different Abs as before. Blots were developed with the enhanced chemiluminescence
detection system (Clarity Western Blotting Substrate, Bio-rad) and quantified using NIH
image program (Image J).
Gelatin zimography
Cell supernatants were electrophoresed for analysis in 9% SDS-PAGE gels containing 1
mg/ml gelatin. The gels were washed for 30 min at 22°C in 2.5% Triton X-100 and then
incubated in 50 mM Tris (pH 7.6), 1 mM ZnCl2, and 5 mM CaCl2 for 18 h at 37°C. After
incubation the gels were stained with 0.2% Coomassie Blue. Enzyme-digested regions
were identified as white bands on a blue background.
ROCK kinase assay
ROCK kinase assay was performed by using ROCK Activity Immunoblot Kit (Cell Biolabs,
Inc.) which utilizes recombinant MYPT1 as ROCK substrate. Briefly, after incubating the
substrate with ROCK sample (cell lysate), the phosphorylated MYPT1 is detected by IB
analysis using an anti-phospho-MYPT1 (Thr696) and anti-MYPT1 (Thermo Scientific).
Rho activation Assay
RhoGTP levels were assessed using a Rho-binding domain (RBD) affinity precipitation
assay (Cytoskeleton, Inc.). Briefly, cells were lysed in 300 μl of ice-cold MLB lysis buffer
(25 mM 4- (2-hydroxyethyl)-1-piperazineethanesulfonic acid, 150 mM NaCl, 1% Nonidet P40, 10 mM MgCl2, 1 mM EDTA, 10% glycerol, and 0.3 mg/ml phenylmethylsulfonyl
fluoride complemented with protease inhibitors and 1 nM sodium orthovanadate).
Glutathione Stransferase (GST)–Rhotekin coupled to glutathione agarose was added to
each tube, and samples were rotated at 4ºC for 60 min. Beads were washed, and proteins
were eluted in 25 μl of 2x laemmli reducing sample buffer by heating to 95ºC for 5 min.
Detection of Rho-GTP was performed by immunoblot analysis using anti-RhoA-B-C
(Millipore) or specific anti-RhoA or anti-RhoC antibody.
Chemoinvasion assay
Chemoinvasion assays were carried out using BD BioCoat growth factor reduced Matrigel
Invasion Chamber (BD Biosciences). Cells (1x105) were stimulated with serum-free
medium alone or with ET-1, added to the lower chamber. The cells were left to migrate for
12 h at 37°C. Cells on the upper part of the membrane were scraped using a cotton swab
and the migrated cells were stained using Diff-Quick kit (Merz-Dade). The experiment was
performed in triplicates for all conditions described. From every transwell, several images
were taken under a phase-contrast microscope at x10 magnification and two broad fields
were considered for quantification. The results of the analysis of the individual photos are
depicted as dots in the various graphs, normalized to control and shown as fold of control.
Student’s t-test was performed to check for the significance.
In vivo assays
Female athymic (nu+/nu+) mice, 4–6 weeks of age (Charles River Laboratories Milan,
Italy) were injected s.c. with 1.8x106 viable HEY cells following the guidelines for animal
experimentation of the Italian Ministry of Health. Two weeks after, animals were
randomized into two different groups of 10 mice undergoing the following treatments for 5
weeks: (i) vehicle, (ii) macitentan (30 mg/kg, oral daily). By the appearance of the
subcutaneous tumors, its size was measured. Tumor volume was calculated using the
formula: π/6 larger X diameter X (smaller diameter)2. At the end of treatment, all mice were
euthanized; subcutaneous tumors were removed, measured, and snap frozen for further
analysis. For metastasis assay, 2x106 parental A2780 cells or clonally derived cells stably
expressing sh-SCR or shRNA β-arr1 were injected i.p. into female athymic nude mice. In
all experiments, each group consisted of 10 mice. Two weeks after, mice inoculated with
parental A2780 cells were treated with macitentan as above. At the end of the treatment
mice were euthanized; the number of visible metastases were counted and the removed
tumors were measured, carefully dissected, and frozen and analyzed for IB analysis.
Values represent the mean ± S.D. of ten mice for group from three independent
experiments.
Supplementary Figure Legends
Figure S1. (A). EOC cells express RhoA and RhoC and different RhoGEFs.
Endogenous RhoA, RhoB and RhoC mRNA levels analysed by qPCR. (B). IB analysis
for endogenous RhoA and RhoC expression in different EOC cell lines. GAPDH was used
as loading control. (C). Rhotekin beads were used to pull down Rho-GTP from lysates of
SKOV3 cells, induced with ET-1 and/or MAC for 5 min. The samples were then
immunoblotted (IB) with RhoA and RhoC Abs. Input, IB for the total cell lysates for loading
control. (D). Rhotekin beads were used to pull down Rho-GTP from lysates of CAOV3
cells, induced with ET-1 and/or MAC for 5 min. The samples were then immunoblotted (IB)
with RhoA,B,C Abs. Input, IB for the total cell lysates for loading control. (E). Rho-kinase
activity measured by IB of HEY cell lysates using Abs against phosphorylated MYPT1
(Thr696) and MYPT1 in cells induced with ET-1 and/or or ROCK inhibitor Y-27632 at
indicated doses. (F). Endogenous p115-RhoGEF, p114-RhoGEF, p190-RhoGEF, TRIO,
Vsm-RhoGEF, p63-RhoGEF, LARG and cyclophilin mRNA levels analysed by RT-PCR.
Figure S2. ET-1-driven -arr1 interaction with PDZ-RhoGEF and analysis of gene
silencing. (A). HEY cells were transfected with SCR or PDZ-RhoGEF-shRNA and lysates
were analysed by IB analysis for protein expression. Tubulin was used as loading control.
(B). HEY cells were transfected with scramble (SCR) or -arr1-shRNA or rescued with arr1-FLAG. Lysates were analysed by IB for -arr1 and FLAG expression. GAPDH was
used as loading control. SKOV3 cells induced with ET-1 were lysed, and IP were
performed using irrelevant immunoglobulin G (IgG) (C), or anti--arr1 Ab (D) and IB were
performed using anti-PDZ-RhoGEF and anti--arr1 Abs. (E). Lysates of HEY cells
transfected with -arr1-FLAG expression vectors and treated with ET-1 were IP with antiFLAG Ab and IB with anti-PDZ-RhoGEF and anti-FLAG Abs. (F). Lysates of HEY cells
transfected SCR or sh--arr1 and treated for 24 h with ET-1 were IP with anti-PDZRhoGEF Ab and IB with anti-pTyr Ab. HEY cells were transfected with SCR or RhoAsiRNA (G) or RhoC-siRNA (H) and lysates were analysed by IB analysis for protein
expression. Tubulin was used as loading control.
Figure S3. Analysis of focal adhesion in EOC cells. Representative images of CLSM
analysis of untreated SKOV3 cells were grown on coverslips coated with 100 g/ml
collagen type I, fixed and stained with F-actin (red) and anti-phosphopaxillin (green) Abs
(Scale bar, 30 μm).
Figure S4. ET-1/ETAR axis promotes cortactin and F-actin colocalization. SKOV3
cells were treated for 3 h with ET-1 or MAC, stained for F-actin (red) or cortactin (green) or
and analyzed by CLSM examination (Scale bar, 30 μm). Arrows indicate invadopodia
dots. Right, Columns show the mean ± SD of quantification of Pearson's correlation
between cortactin and F-actin (*,p<0.001 vs Ctr cells; **, p<0.05 vs ET-1-treated cells).
Figure S5. ET-1/ETAR through -arr1/PDZ-RhoGEF controls MMP-9 production and
macitentan controls tumor growth in EOC xenografts. (A). HEY cells were transfected
with SCR or sh--arr1 or sh-PDZ-RhoGEF and treated with ET-1 alone or with MAC for 24
h. Media were collected and analyzed by IB for the secretion of MMP-9. Ponceau staining
was used as loading control. (B) Female nude mice were s.c. injected with HEY cells were
treated after two weeks with vehicle control (Ctr), or macitentan (MAC) for 5 weeks. Values
represent the average ± SD of ten mice for group from three independent experiments
(p<0.001). Bottom, representative subcutaneous tumors. (C). Female nude mice were i.p.
injected with A2780 cells and treated with macitentan as shown in Fig. 8A. At the end of
treatment, all mice were euthanized and intraperitoneal organs were examined for visible
metastases.