Restriction Digestion and Analysis of Lambda DNA Kit (BioRad)
Introduction
In this laboratory activity, your task will be to cut (digest) lambda DNA, the genomic DNA of a bacterial
virus, and then determine the size of the DNA pieces using a produced called gel electrophoresis.
This involves separating a mixture of the DNA fragments according to the size of the pieces. Once this is
accomplished, you will compare your pieces of DNA with pieces of DNA whose size is already known (a
marker or ladder).
You will be provided with lambda DNA and three different restriction enzymes. The DNA restriction
analysis that you are about to perform is fundamental to a variety of genetic engineering techniques,
including gene splicing, DNA sequencing, gene localization, and forensic DNA matching or fingerprinting.
Procedure Background
Restriction Enzymes
Viruses called bacteriophages inject their DNA into bacterial cells, forcing the bacteria to multiply the
DNA. Bacteria have responded by evolving a natural defense, called restriction enzymes, to cut up and
destroy the invading DNA. Bacteria prevent digestion of their own DNA by modifying certain bases
within the specific enzyme recognition sequence. Restriction enzymes search the viral DNA for specific
palindromic sequences, and then cut the DNA at these sites. The actual recognition site is called a
restriction site. Some restriction sites may leave a short length of unpaired nucleotide bases, called a
“sticky” end, when cut, while other enzymes make a cut across both strands at the same location,
creating fragments with “blunt” ends.
Enzymes are named for the organism that the enzyme was first discovered in. For example, EcoRI was
first isolated from E. coli. Each enzyme has a specific restriction site. Some enzymes may have the same
restriction site, but vary in their actual cutting site. A palindromic sequence can be repeated a number
of times on a strand of DNA, and the specific restriction enzyme will cut all those palindromes, no
matter what species the DNA comes from.
Each enzyme has a specific optimal temperature. This is usually 37°C since most enzymes are from
bacteria that live inside warm-blooded animals.
All of the enzymes used in today’s lab form sticky ends:
Palindromic sequence
G٧AATTC
CTTAA٨G
Enzyme
EcoRI
A٧AGCTT
TTCGA٨A
HindIII
CTGCA٧G
G٨ACGTC
PstI
“٧” and “٨” indicate cutting site
Gel Electrophoresis
DNA is colorless, so DNA fragments in the gel can’t be seen during electrophoresis. A sample loading
dye containing two blue dyes is added to the DNA solution before it is loading onto the gel. The loading
dyes do not stain the DNA itself, but makes it easier to lead the gels and monitor the progress of the
DNA electrophoresis. The dye fronts migrate toward the positive end of the gel, just like the DNA (since
DNA is negatively-charged). The “faster” dye comigrates with DNA fragments of approximately 500bp,
while the “slower” dye comigrates with DNA fragments approximately 5kb, or 5,000bp in size. Loading
dye is usually either a glycerol or saturated sucrose solution. Not only does loading dye allow you to
visualize the sample, it weighs the sample down so it sinks to the bottom of the well when being
loaded. Otherwise, it would simply diffuse through the running buffer and be lost.
Agarose gel electrophoresis separates DNA fragments by size. DNA fragments are loaded onto a gel
slab, which is placed in a chamber with a conductive buffer solution. A direct current is passed between
wire electrodes at each end of the chamber. Negatively-charged DNA is drawn towards the positive
pole. The matrix of the agarose gel acts like a molecular sieve through which smaller DNA fragments
can move more easily than larger ones. Agarose gels are usually made in 1%-4% concentrations,
depending on the fragment size. This particular lab requires only a 1% gel, since the fragments tend to
be larger. 4% gels can separate fragments that are as little as 4bp different in size. The rate at which
DNA fragments migrate through the gel is inversely proportional to its size in base pairs. Fragments of
the same size will stay together and migrate in single bands of DNA. Where the migrating band is
located on the gel not only depends on the size of the fragment, but also the running time of the gel.
Therefore, gels are always run with a marker or ladder. The marker/ladder contains DNA fragments of
known size, and are used to determine the size of the unknown fragments.
Making DNA visible
Fast Blast stain contains positively-charged dye molecules that are attracted to and bind to the
negatively-charged phosphate groups of DNA molecules. A quick staining for 2 minutes is followed by
several de-staining rinses with warm water.
Fast Blast stain will permanently stain your clothing – so dress accordingly!!!!!!!
Group questions (each group is to submit ONE set of typed answers to the following
questions)
1. Consider the following DNA molecule
AATTCGCGAATTCGGTACCGAATTGGCAGAATTCCCGAATTGCCGTACGGAATTC
TTAAGCGCTTAAGCCATGGCTTAACCGTCTTAAGGGCTTAACGGCATGCCTTAAG
How many bp is the original fragment? (1 point)
If digested with EcoRI, how many fragments are formed if the DNA is linear? (1 point)
If digested with EcoRI, how many fragments are formed if the DNA is circular? (1 point)
2. What does it mean if the DNA in tube “L” becomes fragmented at the conclusion of the reaction?
(2 points)
3. Describe the two functions of loading dye. (4 points)
4. Where would the larger fragments, those with the greater number of base pairs, be located;
toward the top of the gel or the bottom? Why? (3 points)
5. Suppose you have 4 fragments of 500bp each. How many bands would appear on the gel? (2
points)
6. What is the purpose of using a marker or a ladder? What is the difference between the two? (4
points)
7. The marker used for this lab is actually Lambda DNA digested with a particular enzyme. This
enzyme is identical to one of the enzymes used in the lab. Based on your results, which enzyme
is it? (1 point)
8. Some of the smaller fragments formed by your digestion are “lost” and can not be visualized.
Give two conditions that can be changed in electrophoresis that will allow you to see these
fragments. (4 points)
9. Using the results from question #1 (for linear DNA), draw the results on a gel, where A is uncut
—“ = well. (4 points)
fragment, and B is digested sample. “
A
—
B
—
10. Were expected results seen in all wells? If not, explain findings and offer some potential reasons
for obtained results. (3 points)