Supplemental Research Design and Methods:
advertisement
Supplemental Research Design and Methods: Transgenic Animals. Transgenic Pdx1cre, Ins2cre and Z/EG offspring were genotyped by tail biopsy genomic DNA PCR using Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA) with the GAPDH, Z/EG, Ins2cre and Pdx1cre primer sets (See Supplemental Table 1.), as per manufacturers conditions using the following cycling protocol: 1) 94C – 2 min, 2) 94C – 30sec, 59C – 30sec, 72C – 30sec (35 cycles), 3) 72C – 10 min. PCR products were visualized on a 2% agarose gel. For Cre recombinase-mediated lineage tracing, Ins2cre or Pdx1cre and Z/EG animals were bred and resultant double transgenic offspring were used in the described experiments. Isolation and culture of mouse islet-enriched pancreatic fractions. Adult mice (10-24 weeks) were anesthetized by an IP dose of Avertin (250mg/kg), after which the abdomen was opened and the pancreas was perfused via the duct with 2.5mL Liberase RI (Roche, Indianapolis, IN) in HBSS (Mediatech, Herndon, VA) + 0.1mg/mL DNase I (Roche), 25mM HEPES (Mediatech) and digested at 37C for 14min. Digested pancreata were washed 3X in HBSS + 10% fetal bovine serum (FBS) (HyClone, Logan, UT) and islets were purified using a continuous density gradient as described (1). Harvested Islet-enriched fractions were cultured overnight in culture medium (CM) consisting of 60:40 low-glucose DMEM (Mediatech):MCDB201 (Sigma, St. Louis, MO) + 2% FBS (HyClone, Logan, UT), 10ng/ml human EGF (Sigma), 10ng/ml human PDGF-BB (R&D Systems, Minneapolis, MN), 1000U/mL Lif (Chemicon, Temecula, CA), 10,000 I.U. Penicillin/mL, 10,000 µg/mL Streptomycin (Mediatech), 10-4 M ascorbic acid 2-phosphate (Sigma), 25mM HEPES, 0.1mM 2-Mercaptoethanol (Invitrogen) and 1mg/ml bovine serum albumin (Sigma) in 60mm hydrophobic dishes (Sarstedt, Newton, NC) at 37C and 5% CO2. For fibroblast-like cell expansion, overnight cultured islet fractions were seeded at 1020 islets/cm2 in tissue cultured treated dishes (BD Biosciences, San Jose, CA) coated with 10µg/mL fibronectin (Sigma). Total islet counts were determined by staining with Dithizone (Sigma). To test fibroblast-like cell growth under published media conditions, islet were harvested and purified as described above and were cultured using media as described (2; 3) in uncoated tissue culturetreated dishes. For both media formulations, complete media changes were made every 2-3 days. For differentiation of Sca1+ fibroblast-like progenitors, 5x104 cells/cm2 were seeded in expansion media overnight, followed by serum and cytokine-free CM supplemented with 20ng/ml human HGF (Sigma), 200nM dexamethasone (Sigma), and 0.25X ITS (Sigma). Alternatively, individual or combinations of growth factors were added to serum and cytokine-free CM including 100ng/ml Activin, 50ng/ml BMP4, 50ng/ml Betacellulin, 50ng/ml GDF11 (all from R&D Systems), and 10nM Exendin-4 (Sigma). Differentiations revealing robust lipid structures were evaluated by light microscopy and Oil red O staining (Chemicon) as per the manufacturer’s protocol. Standard PCR and Quantitative Real-Time-PCR. For real-time RT-qPCR, 510ng cDNA was amplified using SYBR Green PCR Master mix with an ABI Prism 7700 (Applied Biosystems, Foster City, CA) under the following conditions: 1) 50C – 2min 2) 95C – 10min 3) 95C – 15sec , 59C – 60sec (40 cycles), 4) 95C – 15sec, 59C – 20sec, 95C – 15sec (Dissociation Curve Analysis). In addition, PCR products were verified by gel electrophoresis. Primers used for standard and real-time qPCR are listed in Supplemental Table 1 (below). For detection of genomic excision within the Z/EG reporter construct, standard PCR was performed on purified genomic DNA using Platinum Taq DNA Polymerase (Invitrogen) with the GAPDH, CAAGS-LacZ and CAAGS-GFP primer sets under the following conditions: 1) 95°C – 2 min, 2) 95°C – 30sec, 59°C – 30sec, 72°C – 60sec (40 cycles), 3) 72°C – 10 min. PCR products were visualized on a 2% agarose (Invitrogen) gel. For real-time qPCR quantitation of excision, 100ng genomic DNA was amplified using Platinum SYBR Green PCR Master mix (Invitrogen) with the GAPDH and CAAGS-GFP primer sets under the following conditions: 1) 50C – 2min 2) 95C – 10min 3) 95C – 15sec , 59C – 30sec, 72C – 30sec (40 cycles), 4) 95C – 15sec, 59C – 20sec, 95C – 15sec (Dissociation Curve Analysis). References 1. Guo Z, Wu T, Sozen H, Pan Y, Heuss N, Kalscheuer H, Sutherland DE, Blazar BR, Hering BJ: A substantial level of donor hematopoietic chimerism is required to protect donor-specific islet grafts in diabetic NOD mice. Transplantation 75:909-915, 2003 2. Gershengorn MC, Hardikar AA, Wei C, Geras-Raaka E, Marcus-Samuels B, Raaka BM: Epithelial-to-mesenchymal transition generates proliferative human islet precursor cells. Science 306:2261-2264, 2004 3. Ouziel-Yahalom L, Zalzman M, Anker-Kitai L, Knoller S, Bar Y, Glandt M, Herold K, Efrat S: Expansion and redifferentiation of adult human pancreatic islet cells. Biochem Biophys Res Commun 341:291-298, 2006 Supplemental Table 1. PCR primers Target Sequence Actb F: TGTTACCAACTGGGACGACA R: GGGGTGTTGAAGGTCTCAAA F: GCCCTACAGACCATGAAACAAG R: GTGAAACAGACTTCCTGGTCCT F: CTTTATGGTGTGGGCCAAAG R: CTTCTCTGCCAAGGTCAACG F: CCGCAATCTCAGAACCTCAT R: AGGCTGCTAGCCACACTGTT F: CCCGGGACTTAACTGTAACG R: TCATGTTGCTCACGGAAGAG F: AGGCTGAGAACTCTCGCTTG R: ATTAGGCAAGGGGGAAGAGA F: CTCCCTGGACTTGGATGGTA R: ACGCTGGTTCTTCAAGGTGT F: ATCGAGATCACCACCTACCG R: TGAAGCCAGGGCTAGTGAGT F: CGAGGCACTCAAGGAAGAAC R: GCTGAGGTCCTGAGATTTGG F: ACCCTCCCGAGATTACAACC R: CAAGGCGTGTTCTGTCTCAA F: ACTGTGAAGGGACGGTCAAC R: GGAGCAGCAGGATCAGAATC F: TCAGGGAGCCCATTACTGTC R: GTTGTCCACCATCGCTTCTT F: CCACTACCAGCAGTCGATGA R: GCCTGTCTGTCCTCTTCCAG F: AGCACAGGTCAGATGCAGTG R: GTCTCGTCCTCCATGCAGTT F: CGGTACAGCAGCAATGGTAA R: TGGATATTCCCTGACCCAGT F: GGTTGCTTTGGCTATCGTCT R: ATTACCTGCCGAAACCTCCT F: AACTTAACCTAGGCGTCGCA R: CATTCGCTTGGCATCAGAAGC F: CAAAGCCACGGATCAATCTT R: CCCGGGAATAGTGAAACTGA F: TCTACGACAGCAGCGACAAC R: GCTTTGGAGAAGAGCACTCG F: ACTTGGCAGGACCAGAGAGA Afp Sox17 Hnf1β Hnf3β Nes CK7 CK8 CK18 CK19 Cdh1 Car2 Cldn3 Cldn4 Ocldn Muc1 Pdx1 NeuroD Nkx2.2 Nkx6.1 Amplicon Size (bp) 165 149 121 116 152 167 229 151 130 160 123 98 126 164 165 119 145 168 220 Pax6 Ins1 Ins2 Vim Acta2 Cdh2 Csf1 Zeb Snail1 Snail2 CAAGS-LACZ CAAGS-GFP GAPDH Z/EG Ins2cre Pdx1cre R: AGAGTTCGGGTCCAGAGGTT F: AACAACCTGCCTATGCAACC R: ACTTGGACGGGAACTGACAC F: TGTTGGTGCACTTCCTACCC R: CACTTGTGGGTCCTCCACTT F: GACCCACAAGTGGCACAAC R: TCTACAATGCCACGCTTCTG F: ATGCTTCTCTGGCACGTCTT R: AGCCACGCTTTCATACTGCT F: CTGACAGAGGCACCACTGAA R: CATCTCCAGAGTCCAGCACA F: ATCAAAGCCTGGGACGTATG R: TGATGATGTCCCCAGTCTCA F: GCTGGATGATCCTGTTTGCT R: TCATGGAAAGTTCGGACACA F: CCACTGTGGAGGACCAGAAT R: CTCGTGAGGCCTCTTACCTG F: TGGAAAGGCCTTCTCTAGGC R: CTTCACATCCGAGTGGGTTT F: TGCCCAGTCTAGGAAATCGT R: GAGAAAGGCTTTTCCCCAGT F: GTTCGGCTTCTGGCGTGT R: GTTGCACCACAGATGAAACG F: GTTCGGCTTCTGGCGTGT R: GTAGGTCAGGGTGGTCACGA F: CATGGCCTTCCGTGTTCCTA R: CTGGTCCTCAGTGTAGCCCAA F: ACTATCCCGACCGCCTTACT R: CTGTAGCGGCTGATGTTGAA F: CTCTGGCCATCTGCTGATCC R: CGCCGCATAACCAGTGAAAC F: ACTACATCTTGAGTTGCAGGC R: CCTGTTTTGCACGTTCACCG 224 206 182 101 206 160 158 198 164 148 186 750 500 151 175 550 700
