Name:_____________
DNA Gel Electrophoresis
A number of prokaryotic bacterial species produce enzymes to fight invading viral DNA.
These special enzymes cut up the viral DNA into fragments so that it won’t be able to harm
the bacterial cell. If these enzymes are extracted from the bacterial cells, they can be used
to cut up DNA from other sources. These special enzymes are restriction enzymes. The
sites on DNA were the enzymes cut it are specific to each enzyme. These are called
restriction sites. Each restriction enzyme has a specific sequence of bases where it cuts
the DNA. These sequences are random throughout the DNA. The enzyme “scans” the
DNA and cuts the DNA each time it finds the specific base sequence. Using restriction
enzymes on DNA cleaves DNA into smaller fragments or pieces.
Here are some examples:
Eco RI is a restriction enzyme that cuts DNA at the following restriction site: GAATTC
5’ …..ATCGAATTCTA…. 3’
3’ …..TAGCTTAAGAT…. 5’
5’ …..ATCG
3’ …..TAGCTTAAG
AATTCTA…. 3’
AT …. 5’
Use Eco RI to cut the DNA segment below.
5’ TTCTAGGAATTCTAAAACGCTATTCAGTGTGAATTCCGCGCGAATTCTAC 3’
3’ AAGATCCTTAAGATTTTGCGATAAGTCACACTTAAGGCGCGCTTAAGATG 5’
How many restriction sites are there for Eco RI?______ How many fragments did it cut
the DNA segment into?_______ Are all of the fragments the same length?_________
To analyze these DNA segments, they can be separated by size using a technique called
gel electrophoresis. After running the DNA on a gel, a banding pattern is produced that
has distinct bands, with each band containing similar size DNA fragments.
How does gel electrophoresis work?
An agarose gel is made by dissolving agarose powder in a buffer solution. This mixture is
heated and poured into a mold. A plastic “comb” is inserted to create wells, or depressions
in the gel. The wells are where the DNA samples will be placed. DNA is naturally clear. A
dye is mixed with the DNA to make it visible. This allows you to make sure that the sample
is loaded into the well and to track the movement of DNA across the gel.
The gel is placed into the electrophoresis chamber such that the wells are at the end with
the negative (black) electrode. Why?______________________________________ At
the opposite end of the chamber is the positive (red) electrode. A buffer solution is added
to cover the entire gel. This buffer has ions in it to conduct an electrical current. Since the
gel was made with buffer, it also has the ability to conduct a current. Once the DNA is
loaded into the wells, the chamber is connected to a power source and the voltage is
turned up. This power source is what creates the negative and positive poles.
Since opposite charges attract, the negatively charged DNA (due to phosphate group) will
start to migrate across the gel towards the positive electrode. Since the DNA sample is
composed of many fragments of different sizes, the fragments will migrate at different
speeds across the gel. Larger fragments will be slowed down by the gel and move more
slowly than smaller fragments. Since DNA is clear, the bands formed will remain clear
until staining is done. The gel will soak in a positive stain to dye the DNA bands. Why will
the stain stick to the DNA?__________________________________ The gel will then be
destained to lighten the agarose and make the bands easier to see. Therefore after
running the gel, a visible pattern of bands will be produced for each DNA sample.
A Closer Look
Uncut DNA sample made of 48,413 base pairs
Same DNA sample cut with HindIII
5 - 23,130 base pairs
4 - 4,361 base pairs
3 - 9, 416 base pairs
2- 2,322 base pairs
8 - 2,027 base pairs
6 - 6, 557 base pairs
4 - 507 base pairs
All of these fragments are mixed up in the sample. We run the sample in the gel to
separate the fragments into groups, or bands, of the same size. The following gel is
obtained from running the uncut and cut with HindIII DNA samples.
(-)
(+)
Understanding gel electrophoresis basics
1. If a two DNA samples are taken from the same person and treated with the same
restriction enzyme, will the size of the DNA fragments formed in each sample be the
same or different? Why?
For the rest of the questions use the following DNA gel.
2. Looking at sample A, which band (#) is the largest? How do you know?
3. Looking at sample A, which band (#) is the smallest? How do you know?
4. If you could look at the molecules in a single band, for instance sample C band # 3,
what would you find?
5. Looking samples B and F, if you were to analyze the DNA fragments found in band
#8, what would you expect to find?
6. Looking at sample A, if the number of base pairs of the fragments found in band #2
is 20,000 and the number of base pairs of the fragments found in band #5 is 10,000,
estimate how many base pairs are in each fragment found in sample A band #4.
_________ base pairs. Estimate how many base pairs are in each fragment found
in sample B, band #3. ____________ base pairs
7. Using sample A and that fact that the DNA was only cut with one kind of restriction
enzyme, how many restriction sites existed in the uncut DNA strand? _________
Are you ready to run your gel???
Procedure:
We will use viral DNA that is 48,514 base pairs long. Its entire DNA sequence is
known.
CAUTION: The materials and equipment used in this lab are extremely expensive.
It is important that you understand what you are doing before running the gel.
Any student found using materials and/or equipment in any way other than as
directed by your instructor may result in failure of participation in this lab.
DAY 1
1. Obtain an agarose gel from your instructor. Carefully support it as you take it to
your lab station as it is fragile and make break.
2. Place the gel holder in the chamber. The red side of the holder should be on the
red side of the chamber. The black side of the holder should be on the black side of
the chamber. This will help you remember which side is positive (red) and negative
(black).
3. Place the gel on the gel holder with the wells on the black side of the holder and
chamber. Do you remember why the wells must be at the negative end of the
chamber?
4. Obtain approximately 400mL of TBE buffer solution from a stock solution prepared
by your instructor. Use a beaker to measure the buffer and carry it back to your lab
station. Pour the solution into your chamber. The buffer should cover the entire
gel.
5. Obtain centrifuged DNA samples from your instructor.
(-)
(+)
Figure 1. DNA sample location in wells.
6. See figure 1 before loading the DNA into the wells. Use the micropipette to
obtain a 10ul volume from one DNA sample. The micropipette is preset to 10ul.
Load the uncut DNA into the first well as demonstrated by your instructor. Be sure
to immerse the micropipette tip into the buffer solution before loading the DNA into
the well. This helps to ensure that there are no air bubbles in the tip. Obtain
another 10ul volume of the SAME DNA sample and load it into the second well.
7. Discard the micropipette tip into your “trash” cup. Skip the third well, get a new tip
on the micropipette, and load the HindIII DNA samples into the fourth and fifth
wells.
8. Discard the micropipette tip into your “trash” cup. Skip the sixth well, get a new tip
on the micropipette, and load the EcoRI DNA samples into the seventh and eighth
wells. Discard the micropipette tip into your “trash” cup.
9. Place the cover on the chamber and connect the electrodes to the power pack.
Remember black connects to black and red connects to red. Turn the power on
and set the voltage to maximum. Why do we set the voltage on maximum?
10. Label a plastic dish with your group members’ names.
11. The gel will run for approximately 60 minutes. How do you know when the gel is
done running?
12. Your instructor will turn off the power packs and stain your gels. The gel will be
immersed in stain for 60 minutes and will then be flooded with distilled water for 24
hours.
DAY 2
1. Obtain your group’s dish with your stained gel.
2. Carefully place your gel on a light box to view the DNA bands. For EACH sample,
measure (cm) the distance traveled. Measure from the front of the well to the front
of each band. If you have six bands from one well sample, you should have six
measurements. Record this information in Tables 1, 2 & 3. What do you notice
about the 2 samples of uncut DNA? HindIII DNA? And EcoRI DNA?
3. Draw an EXACT copy of your gel on figure 2.
(-)
(+)
Figure 2. Banding patterns of uncut DNA, DNA cut with HindIII, and DNA cut
with EcoRI.
4. Use table 2. Use the average distance traveled and fragment size for DNA cut with
HindIII and the average distance traveled by DNA cut with EcoRI to make a rough
estimate of how big you think each EcoRI fragment is. Record this in table 3.
5. Create a standard curve using HindIII data. Graph your average distance traveled
and fragment size for DNA cut with HindIII. Use this graph to again estimate the
size of each EcoRI fragment is.
6. Copy the actual EcoRI fragment sizes from your instructor. Answer the questions at
the end of this lab packet.
Table 1. Distance traveled per fragment size for uncut DNA.
Distance
Distance
Avg.
Fragment size (#
Traveled (cm) Traveled (cm) Distance
base pairs)
(Well 1)
(Well 2)
Traveled (cm)
Table 2. Distance traveled per fragment size for DNA cut with HindIII.
Distance
Distance
Avg. Distance
Fragment size
Traveled (cm)
Traveled (cm) Traveled (cm)
(# base pairs)*
(Well 4)
(Well 5)
23, 130
9, 416
6, 557
4, 361
2, 322
2, 027
570
* These are the actual sizes of the fragments. These will be used to determine the size
of the fragments made from cutting the DNA with EcoRI.
Table 3. Distance traveled per fragment size for DNA cut with EcoRI.
Distance Distance
Avg.
Rough
Estimate of
Actual size of
Traveled
Traveled
Distance
Estimate of
Fragment size fragments (#
(cm)
(cm) (Well Traveled
Fragment
using graph (# base pairs)
(Well 7)
8)
(cm)
size (# base
base pairs)
pairs)
1. Using your knowledge from the DNA isolation activity, why is there a dye added
to the DNA for gel electrophoresis?
2. How many bands are produced by the uncut DNA sample? Why?
3. Do the bands produced by the DNA samples cut with HindIII and EcoRI differ?
Why?
4. Which bands contain the smallest fragments? How do you know?
5. Which bands contain the largest fragments? How do you know?
6. Why are some bands darker than others?
7. Why are you able to estimate the size of the fragments in the EcoRI bands?
8. How would each of the following factors affect the results of the electrophoresis:
a. Voltage used (power):
b. Running time:
c. Amount of DNA:
Now that you understand DNA gel electrophoresis, can you apply what you’ve
learned?? 
What is the real world application? *THINK*
1. If the positive and negative electrodes were reversed such that the wells where at
the positive end rather than the negative end, how would the result of the DNA gel
change?
2. 2. A blood splatter is found at a crime scene. It is used as a source of DNA.
Samples of DNA from four suspects are also taken. All three samples of DNA (1
from the scene, 4 suspect samples) are cut with Eco RI and analyzed using gel
electrophoresis. The gel is shown below. ANSWER BOTH QUESTIONS Who
committed the crime? How do you know?
(-)
(+)
3. Scientists are trying to isolate the gene for cystic fibrosis. They ran two DNA
samples on the same gel. One sample contains DNA without cystic fibrosis, the
other is a sample with cystic fibrosis. Determine which band contains the cystic
fibrosis gene.
(-)
(+)
4. If a restriction enzyme digest resulted in DNA fragments of the following sizes:
4,000, 2,500, 2,000, and 400 base pairs, sketch the resulting separation by
electrophoresis. Show the wells, positive and negative electrodes, and the resulting
bands.
5. If, using the fragments from question 4, there were 4 fragments that were 400 base
pairs instead of only one, how would your gel sketch be different?
6. Use your log graph to predict how far (in cm) a fragment of 8,000 base pairs would
migrate.
7. If a band migrated 4.0 cm, approximately how many base pairs long is the
fragment?