Supplementary material
Methods
Genotyping of HervK18 7086 and HervK18 8146 was performed by carrying out an initial outer
PCR followed by Taqman genotyping. The outer PCR, amplifying a 2750bp fragment containing
both SNPs, was performed to ensure the specificity of the Taqman reaction as HERV elements
share a high degree of sequence similarity. The outer PCR was carried out in a 10 µl reactions
containing 5-10 ng of genomic DNA, 1xhigh Fidelity PCR reaction bufferII (Roche), 0.2 µl High
Fidelity Enzyme mix (Roche), 0.2 mM PCR grade nucleotide mix (Roche) and 0.3 µM of each
primer (K18-UTR:5’-CCCATCAGAGATGCAAAGAAAAGC and K18-FLR: 5’CCCCAAACCTTTAAATATTGTCTCATG). PCR conditions were 94 ºC for 2 min followed by
35 cycles of 94 ºC for 20 s, 55 ºC for 40 s and 72 ºC for 2 min. The PCR amplicon was diluted
1:100 with water and used as a template for the Taqman reaction. The Taqman genotyping was
carried out on a LC480 Lightcycler (Roche) in 10 µl reactions containg 1 µl diluted PCR
product, 5 µl Taqman GT master mix (2x) (Applied Biosystem), and 0.25 µl 40xAssay Mix
(Applied Biosystems, Assay on demand, Original sales #185279985 (HervK18 7086) (also called
hervk1asnp-SNP3), Original sales #185280116 (HervK18 8146) (also called hervk10-SNP8).
Cycling conditions were 95 ºC for 10 min followed by 20 cycles of 92 ºC for 15 s and 60 ºC for 1
min. H2O were used for negative controls.