Microbiology 2
Lecture Exam #2
GOOD LUCK!!
Answer questions 1-66 on the scantron
Multiple choice: Select the best answer
1.
Amino acids are brought to the site of protein synthesis by binding to the _____ site on the _____.a) 5’, mRNA b) 3’,
rRNA c) anticodon, mRNA d) 5’, tRNA e) 3’, tRNA
2.
A great number of antibiotics are derived from members of the genus
d) Escherichia e) Corynebacterium
3.
A nucleotide found only in DNA is a) thymine b) adenine c) guanine d) uracil e) cytosine
4.
Which of the following types of RNA molecules are eventually translated
above e) none of the above
5.
The site on an enzyme which provides a surface for the attachment of substrate molecules is the
b) substrate site c) primary site d) conjugated site e) none of the above
6.
The microbial form with the LEAST resistance to chemical methods of microbial control is
b) bacterial vegetative cells c) fungal zygospores d) naked viruses e) protozoan cysts
7.
Sulfonamides a) are metabolic analogs b) inhibit cell wall synthesis c) affect ribosome function d) two of the above
e) none of the above
8.
The sticky ends of two DNA molecules can be joined using the enzyme
transcriptase e) polymerase
9.
A plastic bag containing plastic petri dishes to be used in the future would be best sterilized using a/n
b) dry oven c) pasteurization d) ionizing radiation e) freezing
a) Bacillus b) Pseudomonas c) Streptococci
a) mRNA b) rRNA c) tRNA d) two of the
a) active site
a) bacterial endospores
a) primase b) gyrase c) ligase d) reverse
10. In a double stranded DNA molecule, thymine would bind to what base using hydrogen bonds
c) guanine d) uracil e) cytosine
11. Which DNA fragment would end up closest to the positive end of an electrophoretic gel
bp c) 2,200 bp d) 10,000 bp e) 12,234 bp
a) autoclave
a) thymine b) adenine
a) 350 bp (base pairs) b) 750
12. A holoenzyme is a combination of a _____ and a _____ a) apoenzyme, cofactor b) cofactor, coenzyme c) simple
enzyme, complex enzyme d) substrate, cofactor e) substrate, coenzyme
13. Which of the following is NOT essential to carry out the polymerase chain reaction
DNA c) primers d) gel electrophoresis e) high temperature
a) DNA polymerase b) template
14. A drug with which of the following cellular targets would be most likely to produce undesirable side effects a) 50S
ribosomal subunit b) cell wall c) cell membrane d) 30S ribosomal subunit e) all would produce equal side effects
15. Which of the following factors would affect the germicidal activity of a chemical a) the concentration of the chemical
b) length of exposure c) composition of the material being treated d) two of the above e) all of the above
16. Which of the following sequences of DNA would be most likely to be a recognition site for a restriction endonuclease
(only one strand is shown) a) GATTCC b) AAGCTT c) GAAT d) TTTTTT e) GCGTAT
17. The process of duplicating a DNA molecule to produce a second, identical DNA molecule is referred to as
a) transcription b) translation c) duplication d) replication e) copying
18. Which of the following is NOT a characteristic of enzymes a) they speed up chemical reactions b) they have a unique
shape c) they work within a limited pH range d) they increase the energy required for a chemical reaction to proceed
e) they are not used up during the course of a reaction
19. Majors limitations of chlorine based compounds as antimicrobics include a) lack of effectiveness at high pH b) their
activity is greatly inhibited by organic matter c) they are toxic to humans even at low concentrations d) two of the above
e) all of the above
20. In both inducible and repressible operons, when the operon is “off”, The RNA polymerase is blocked by the
b) structural genes c) lactose d) promoter e) repressor
a) operator
21. A plasmid usually contains a) an antibiotic resistance gene b) a high content of uracil nucleotides c) an origin of
replication d) two of the above e) all of the above
22. The enzyme used in the polymerase chain reaction is isolated from a/n _____ bacteria
c) thermophilic d) psychrophilic e) none of the above
23. Which of the following drugs works by inhibiting cell wall production
c) erythromycin d) chloroquine e) cephalosporin
a) osmophilic b) mesophilic
a) sulfonamides b) streptomycin
24. Synthesizing DNA requires a/an _____ primer which is synthesized by _____
c) protein, primase d) RNA, primase e) DNA, helicase
a) RNA, gyrase b) DNA, ligase
25. The speed of chemical reactions can be increased by a) adding heat to the reaction b) increasing the concentration of
the reactants c) adding a catalyst d) two of the above e) all of the above
26. The process which occurs when DNA is transferred from one organism to another using a bacterial virus is known as
a) conjugation b) transduction c) transformation d) sexduction e) none of the above
27. Compared to a typical bacterial chromosome, a typical plasmid is about
larger d) 10 times smaller e) 1000 times smaller
28. The temperature/pressure combination for an autoclave is
d) 1150C and 3 psi e) 1340C and 10 psi
29. A cofactor may be a
a) the same size b) slightly larger c) 100 times
a) 1000 C and 14 psi b) 1210 C and 15 psi c) 1310C and 9 psi
a) coenzyme b) metal ion c) holoenzyme d) two of the above e) all of the above
30. Resistance to antibiotics may be spread from one bacterium to another by means of
c) transformation d) two of the above e) all of the above
a) conjugation b) transduction
31. DNA fragments of different sizes can be separated using a) restriction enzymes b) gel electrophoresis c) polymerase
chain reaction d) reverse transcriptase e) none of the above
32. Unwinding of the DNA helix is accomplished using the enzyme
polymerase III e) helicase
a) gyrase b) ligase c) DNA polymerase I d) DNA
33. What characteristic of plasmids makes it possible to isolate bacteria carrying plasmids using selective media a) an origin
of replication b) the plasmids small size c) antibiotic resistance d) restriction enzymes e) none of the above
34. An effective method of sterilizing heat sensitive liquids is a) UV irradiation b) exposure to ozone c) autoclaving
d) beta propiolactone e) filtration
35. Which of the following would be the best choice of drug for treatment of a viral infection
b) ketoconazole c) cephalosporin d) azidothymidine e) sulfonamide
a) thiabendazole
36. Enzymes are used for a) duplicating DNA b) hydrogen peroxide detoxification c) RNA transcription d) two of the
above e) all of the above
37. In a viable plate count, each _____ represents a _____ from the sample population
c) hour, generation d) cell, generation e) generation , cell
38. Alcohols suitable for antimicrobial control include
above
39. DNA is found in (or in the form of)
e) all of the above
a) cell, colony b) colony, cell
a) methyl b) ethyl c) isopropyl d) two of the above e) all of the
a) bacterial chromosomes b) plasmids c) chloroplasts d) two of the above
40. Which of the following is a major participant in the cloning of a gene
c) host organism d) two of the above e) all of the above
a) restriction endonuclease b) cloning vector
41. When using gel electrophoresis, DNA moves toward the a) positively charged end of the gel b) top of the gel
c) bottom of the gel d) negatively charged end of the gel e) center of the gel
42. Alteration of the 50S ribosomal subunit is responsible for resistance to
d) polymixin e) erythromycin
a) penicillin b) chloramphenicol c) rifampin
43. Drawbacks to the use of heavy metals as microbial control agents include a) toxicity to humans b) propensity for
causing allergic reactions c) development of microbial resistance d) two of the above e) all of the above
44. Sterilization of culture media containing blood serum or eggs (which break down at slightly more than 100 0C) may be
accomplished using a) pasteurization b) a dry oven c) UV irradiation d) sonication e) intermittent sterilization
For questions 45-49 mark a if the statement refers to penicillin, b for aminoglycosides, c for chloramphenicol, d for rifampin
and e for ketoconazole
45. Useful for fungal infections.
E
46. Drug of choice for sensitive Gram (+) cocci.
A
47. Used to treat mycobacterial infections. D
48. Very potent broad spectrum drug whose side effects include fatal aplastic anemia.
49. Isolated from the genus Streptomyces
C
B
True/False:
50. Sterilization would be the preferred method of preparing a metal dinner fork for re-use.
F
51. The polymerase chain reaction is used to increase the number of copies of a specific piece of DNA.
52. Under most conditions, the lactose operon is turned off (i.e. not active).
T
T
53. Antiviral drugs are usually aimed at destroying extracellular virus particles. F
54. Disinfection will destroy bacterial endospores.
F
55. Old cells which are no longer actively dividing tend to be much easier to kill than younger cells.
F
56. Enzymes are able to make reactions proceed that would not proceed in the absence of the enzyme.
F
57. A side effect commonly seen with tetracycline is photodermatitis. T
58. Pasteurization is used to sterilize beverages.
F
59. In the arginine synthesis operon, arginine causes the repressor to assume an inactive form.
60. A cofactor may be either organic or inorganic.
F
T
61. All mutation cause harm to the organism in which they occur.
F
62. Betapropiolactone is the only gas generally accepted for sterilization.
63. A therapeutic index of 20 is better than a therapeutic index of 50.
F
F
64. Reverse transcriptase is used to synthesize mRNA using DNA as a template.
F
65. Because they are essential to the survival of the cell, enzymes are usually found in very high concentrations.
66. Cold temperatures are generally microbicidal.
F
F
Fill in: Please provide the word or phrase that best completes the phrase or definition.
67. ___Translation____________ The process of producing protein from an RNA molecule.
68. ___Exoenzymes___________ Enzymes which are exported from the cell after their initial synthesis.
69. ___Antibiotics____________ Substances produced by the natural metabolic processes of microorganisms which inhibit
or destroy other microorganisms.
70. ___Introns_______________ Intervening sequences of bases found in eukaryotic genes which do not code for a protein.
71. ___Germicide____________ Name for a chemical applied directly to exposed body surfaces to destroy or inhibit
vegetative pathogens.
72. ____Broad_______________ Drugs effective against a wide variety of microorganisms would be described as being
_____ spectrum.
73. ____Retroviruses__________ RNA is used as a template for the production of DNA in this specific group of organisms.
74. ____Anti-parallel__________ The type of arrangement found in DNA, in which one strand runs in the opposite direction
of the other strand.
75. ____Surfactants___________ Group of chemicals (primarily detergents) which act as microbicidal agents by lowering
the surface tension of cell membranes.
76. ____Generation time_______ The time between two successive cell divisions.
77. ____Okazaki______________ Each small piece of DNA which is synthesized discontinuously is known as a/n _____
fragment.
78. ____Prophylactic___________ Drugs used to prevent disease (the operative word here is prevent).
79. ____Tinctures______________ Antimicrobial chemicals dissolved in alcohol.
Short Answer:
80. What are the four general cellular targets of physical and chemical agents of microbial control? (2 points)
Cell Wall
Cell membrane
DNA, RNA and protein synthesis
Protein function
81. Define the term “microbial death”. (1 point)
Complete loss of reproductive capacity, even under ideal conditions of growth.
82. Given a bacterium with a generation time of 30 minutes and starting with ten viable cells in your culture, how many
bacteria would you have in three hours? (3 points)
Nf=(Ni)2n
=(10)26
(six hours divided by thirty minutes is six generations)
=640
83. Briefly describe the two major methods used to test for drug susceptibility of microorganisms. For each method, provide
one advantage and one disadvantage. (3 points)
Kirby-Bauer test: Quick and easy but does not provide MIC and is difficult to use for slow growing and anaerobic species.
Tube dilution test: Provides MIC but requires more time, tubes etc.
The following questions refer to the mRNA molecule seen below.
5’
AUGGGAAUUAGAUCCUGUGCAUAAGACCAGAGUCAA
84. What would be the first three amino acids synthesized upon translation of the mRNA. (2 points)
Met-Gly-Iso
85. How long (how many amino acids) would the protein produced from this mRNA be. (2 points)
Seven (note the UAA stop codon).
86. What is the name of the part of the tRNA which would bind to the triplet AUU in the mRNA above. (1 point)
Anticodon
3’
87. Would a mutation which caused the triplet GGA to be changed to GGU be a serious problem to a microorganism in most
cases? Why or why not? (2 points)
No. GGA and GGU both code for the amino acid glycine.
Answer the next three questions assuming that because of exposure to UV radiation, a single “A” was introduced into the fourth
position of the mRNA above (so that the sequence now reads 5’ AUGAGGAAUUAGAUCCUGUGCAUAAGACCAGAGUCAA 3’).
88. What would be the first three amino acids produced? (1 point)
Met-Arg-Asp
89. What type of mutation could this be characterized as (could it be characterized as more than one type)? Why? What is the
most serious aspect of this type of mutation? (2 points)
This is both an insertion and a frameshift mutation. The most serious aspect is the fact that the reading frame of the ribosome is changed, resulting in a
change in every amino acid in the protein after the point of the mutation.
In the process of testing new antibiotics, you have taken a small sample from the growth-free portion of the zone of inhibition in
the Kirby-Bauer test and used this sample to inoculate a plate of non-selective media.
90. What does it say about your antibiotic if growth occurs on the non-selective plate? (2 points)
That the antibiotic was microbistatic
91. What if there is no growth on the non-selective plate? (2 points)
That the antibiotic was microbicidal
92. How would you determine the therapeutic index for this drug? Provide the equation you would use and define any terms in
the equation. (3 points)
Toxic dose to humans
Minimal inhibitory concentration