Supplementary Materials and Methods
Sample Collection:
All samples were collected 10 th
September 2008 from Davies reef (18º50.9’S,
5 147º41’E), which is a mid-shelf-reef within the Great Barrier Reef (GBR), Australia. Three replicate samples for each invertebrate species were collected from 5-10 m depth. For
Scleractinea corals ( Acropora millepora, Pocillopora damicornis, Seriatopora hysterix ), ~2 cm branches were broken off the edge of the colonies. For Octocorallia corals ( Nephtea sp.,
Sinularia flexibilis, Sacrophyton sp ) ~2 cm fragments were sliced from each colony using a
10 sterile razor blade. Similarly, samples of Ascidia ( Diademnum molle , Lissoclinum patella,
Polycarpa aurata ) and Bryozoa ( Bryozoan sp.) were obtained by cutting away a ~2 cm
3 tissue fragment underwater with a sterile razor blade. Benthic Foraminifera ( Marginopora vertebralis , Heterostegina depressa , Sorites sp.
) were individually collected by foraging through the benthic reef communities in the sediment. Bivalvia samples ( Tridacna crocea
15 and Tridacna maxima ) were collected by excising a small section of the mantel which consisted of the tissue and symbiotic dinoflagellates ( Symbiodinium) . All invertebrate samples were placed in individual sterile plastic bags or collection tubes underwater. At the surface, samples were rinsed twice with sterile artificial seawater to remove loosely attached organisms. For Scleractinia, samples were airbrushed (80 psi) with 5 mL ASW to removed
20 coral tissue and associated microbes from the coral skeleton. Samples of Octocorallia,
Bivalvia, Ascidia and Bryozoa were crushed with a sterile mortar and pestle in 5 mL sterile
ASW. The slurry from each sample were homogenised to break up aggregates and aliquoted into sterile cryovials and frozen at -80°C. Foraminifera were stored individually at -80°C in cryovials. Finally, two replicate 1 L volumes of seawater were collected in sterile bottles at
25 two arbitrary locations. The replicate seawater samples at each site were then pooled and the

resulting 2 x 2 L samples filtered through Sterivex (0.22 µm) filter columns (Millipore) and stored at -80°C for later analysis. Processing of all samples occurred within one hour of sampling. One sample of the GBR sponge Rhopaloides odorabile was also collected and the
DNA extracted as described previously to compare sequencing results and provide a baseline
30 comparison with a previous 454 tag sequencing study of GBR sponges (Webster et al., 2011).
DNA extraction, PCR and sequencing
Frozen tissue samples were aseptically transferred to 1.5 ml Eppendorf tubes and total
35 genomic DNA was extracted using the MO BIO PowerPlant DNA Isolation Kit as per the manufacturer’s instructions (MO BIO Laboratories, CA, USA). DNA was extracted from seawater filters by addition of 200 ml lysozyme (10 mg ml
-1
), incubation at 37°C for 45 min, addition of 200 ml of proteinase K (0.2 mg ml -1 ) and 1% SDS and incubation at 55°C for 1 h.
Lysates were recovered into fresh eppendorf tubes and DNA was extracted with a standard phenol:chloroform:isoamyl alcohol procedure and precipitated with 0.8 vol. of isopropanol.
40 Extracted DNA was quantified using a GeneQuant Pro spectrophotometer (Amersham
Pharmacia Biotech) and stored at –20 o
C until required.
Eubacterial 16S rRNA genes were amplified by PCR in 50 µL containing 20 ng DNA, molecular biology grade water, 1X PCR Buffer (Qiagen), 200 µM of each of the dNTPs
(Invitrogen), 1 U HotStarTaq DNA Polymerase (Qiagen), 25 pmoles each of the primers 63F
45 (5`-CCATCTCATCCCTGCGTGTCTCCGACTCAGNNNNNNNNCAGGCCTAACACATGCAAGTC) and
533R (5`-CCTATCCCCTGTGTGCCTTGGCAGTCTCAGTTACCGCGGCTGCTGGCAC) modified on the 5’ end to contain the 454 FLX adapters A and B, respectively. The forward primers also contained an eight base barcode sequence positioned between the primer sequence and the
50 adapter. A unique barcode was used for each sample. Thermocycling conditions were as follows: 95°C for 5 min; then 30 cycles of 94°C for 1 min, 55°C for 1 min, 72°C for 1 min;

then 72°C for 10 min. Five amplicons were performed per sample and then pooled to give a final quantity of ~1 µg DNA per sample. Amplicons were purified using a MO BIO PCR purification kit as per the manufacturer’s instructions. One of the Nephyta sp . failed to amplify and a second replicate failed to produce pyrosequencing reads and therefore these
55 samples were excluded from subsequent analysis resulting in only one of the replicates samples being included in the study. The amount of DNA is each sample was quantified using the Quant-iT PicoGreen assay (Invitrogen, Carlsbad, CA). All samples with their respective bar codes (46 samples in total) were pooled in eqimolar amounts for 454 pyrosequencing on a Roche GS-FLX system at the Australian Genome Research Facility
60 (AGRF) Brisbane, Australia.
Data analyses
Sequences were quality filtered and dereplicated using the QIIME script split_libraries.py with the homopolymer filter deactivated (Caporaso et al ., 2010) and then
65 checked for chimeras against the GreenGenes database using UCHIME ver. 3.0.617 (Edgar,
2011). Homopolymer errors were corrected using Acacia (Bragg et al ., 2012). Sequences were then subjected to the following procedures using QIIME scripts with the default settings: 1) sequences were clustered at 97% similarity using UCLUST, 2) cluster representatives were selected, 3) GreenGenes taxonomy (De Santis et al ., 2006) was assigned
70 to the cluster representatives using BLAST, 4) tables with the abundance of different operational taxonomic units (OTUs) and their taxonomic assignments in each sample were generated.
The mean number of OTUs (observed richness) and Simpson’s diversity index values
(Simpson, 1949) corresponding to 2000 sequences per sample was calculated using QIIME.
75 Generalised linear modelling (GLM) was used to assess whether variation in observed

richness and Simpson’s Diversity Index values could be explained by the presence/absence of photosynthetic symbionts or different groups of invertebrate species. Rarefaction curves were generated using QIIME (Supplementary Fig. S3). Differences in the composition of invertebrate-associated microbial communities were assessed using Permutational
80 Multivariate Analysis of Variance (PERMANOVA), and Redundancy Analysis (RDA) with
Monte Carlo permutations tests (999 permutations). All analyses were implemented using R, version 2.12.0.
85 References
90
Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N,
Pena AG, Goodrich JK, Gordon JI, Huttley GA, Kelley ST, Knights D, Koenig JE, Ley
RE, Lozupone CA, McDonald D, Muegge BD, Pirrung M, Reeder J, Sevinsky JR,
Tumbaugh PJ, Walters WA, Widmann J, Yatsunenko T, Zaneveld J, Knight R. (2010)
QIIME allows analysis of high-throughput community sequencing data. Nature Methods
7:335-336.
Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. (2011) UCHIME improves sensitivity and speed of chimera detection. Bioinformatics doi: 10.1093/bioinformatics/btr381.
95
Bragg L, Stone G, Imelfort M, Hugenholtz P, Tyson G.W. (2012). Fast accurate errorcorrection of amplicon pyrosequences using Acacia. Nature Methods 9:425-426
De Santis TZ, Hugenholtz P, Larsen N, Rojas M, Brodie EL, Keller K, Huber T, Dalevi D,
Hu P, Andersen GL. (2006). Greengenes a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Applied and Environmental Microbiology 72:5069–
5072.

100 Simpson EH. (1949) Measurement of diversity. Nature 163:688.
105
Webster NS Cobb RE Soo R Anthony SL Battershill CN Whalan S Evans-Illidge E. (2011)
Bacterial community dynamics in the marine sponge Rhopaloeides odorabile under in situ and ex situ cultivation. Marine Biotechnology 13:296-304.