Supplemental Movie Legends
Movie 1: PC3 cells expressing ControlshRNA, random migration in response to HGF.
Movie 2: PC3 cells expressing PAK4shRNA, random migration in response to HGF
Supplemental Materials and Methods
Cell culture and motility assays
PC3 cells (European Tissue Culture Collection) were grown in RPMI-1640 (Sigma),
supplemented with 10% FBS, L-glutamine and 100 U/ml penicillin and streptomycin.
To generate stable control and PAK4-knockdown cell lines, cells were transfected
with control or PAK4-specific pGIPz lentiviral vectors using Fugene 6 transfection
reagent according to the manufacturers protocol (Roche). Stable mixed clones were
puromycin selected (1 μg/ml) prior to cell sorting to isolate tGFP-expressing cells and
maintained in media supplemented with 700 ng/ml puromycin). In migration assays,
cells were serum starved for 24 h in low serum media consisting of RPMI-1640
(Sigma), supplemented with 0.5% FBS, 50 mM Hepes, L-glutamine and penicillin
and streptomycin prior to stimulation with 10 ng/ml HGF. Where necessary, 5×104
cells/ml were transiently transfected with 1 μg DNA in 6 cm dishes using Fugene 6,
prior to imaging. 24 h after transfection, cells were seeded on 6-well plates at a
density of 1×104 cells/ml and assayed as described above. The chemotatic potential of
PAK4-depleted cells was measured using a Dunn chemotaxis chamber and the
method described in (Ahmed et al., 2008). HEK 293 cells were grown in DMEM
(4.5g/L glucose) (Sigma, Dorset, UK), supplemented with 10% FBS, L-glutamine and
100 U/ml penicillin and streptomycin.
1
Antibodies and reagents
Rabbit polyclonal PAK4 specific antibody has been described elsewhere (9). PAK4i
was a kind gift from Cancer Research Technology Ltd (CRT compound 102882) and
prepared using the method detailed in the Pfizer patent application WO 2007/072153.
Vectors encoding HA-Cdc42G12Vand HA-Gab-1 were kind gifts from Maddy Parsons
(King’s college, London) and Stephanie Kermorgant (Bart’s and the London). Unless
indicated, primary antibodies were used at a dilution of 1:1000 for western-blotting.
Mouse anti-HA.11 was purchased from Covanance (Princeton, NJ, USA). Mouse
anti-Myc (clone 4E10) was purchased from Biolegend (San Diego, CA). Rabbit antiPAK1 (C19) was purchased from Santa Cruz laboratories (CA). Goat polyclonal antiGST was purchased from Roche Diagnostics (West Sussex, UK) and used at a
concentration of 1:5000. Living colours rabbit anti-dsRed/mRFP1 was purchased
from Clontech. Rabbit polyclonal anti-TurboGFP(d) antibody was purchased from
Evrogen JSC (Moscow, Russia) and used at a dilution of 1:30000. Anti-C-met/HGFR
(clone 4AT44) was purchased from Abgent (San Diego, CA). Anti-GAPDH was
purchased from Millipore and used at a dilution of 1:10000. Rabbit anti-PAK2, Rabbit
anti-phospho-PAK4 (S474) and rabbit anti-PAK4, which also recognises PAK6 [1],
were purchased from Cell Signalling Technology (Danvers, MA). Rabbit polyclonal
PAK4
specific
antibody
(raised
against
PAK4
peptide
sequence
CRRAGPEKRPKSSREG) has been described elsewhere [2]. HRP-conjugated
secondary antibodies were purchased from DAKO (Cambridge, UK) and diluted
1:5000. Lentiviral pGIPZ vectors encoding PAK4 (Oligo ID V2HS_197812) and
control, non-targeting shRNA and turboGFP were purchased from Openbiosystems
(Huntsville, AL). Vectors encoding HA-Cdc42G12Vand HA-Gab-1 were kind gifts
from Maddy Parsons (King’s college, London) and Stephanie Kermorgant (Bart’s and
2
the London). pENTR-PAK4, -PAK4r (containing silent, shRNA refractory
mutations), -PAK4∆kinase, -PAK4 kinase domain and -LIMK1 have already been
described [1] and [2]. PAK4∆CRIB (encoding amino acids 30-591), PAK4 GBD
(amino acids 1-30), PAK4132 (amino acids 1-132), PxxP8 (amino acids 31-323) and
PAK4∆N (amino acids 132-591) cDNA was cloned into pDONR207 using BP
Gateway® recombination to generate pENTR- PAK4∆CRIB, pENTR-GBD, PAK4132, -PxxP8 and -PAK4∆N respectively. PAK4 derivatives were then transferred
into a mammalian eGFP-expression vector using LRGateway® recombination. All
constructs were verified by sequencing. Point mutations were introduced into
pENTR-PAK4 or –PAK4r using Primers designed with the QuikChange mutagenic
primer design program and Quikchange® mutagenesis (Stratagene/Agilent,
Wokingham, UK). Clones were screened by sequencing and alignment to wild-type
sequences to confirm mutagenesis. Sequence verified mutants were then transferred
into mammalian mRFP-, eGFP-, or GST-expression destination vectors using LR
Gateway® recombination. All constructs were verified by sequencing.
To pENTR-PAK4∆PxxP8 was engineered by overlapping PCR. Two PAK4
fragments, whose sequences overlap each other in the region flanking PxxP 8, were
PCR-amplified
using
primer
(ggggacaagtttgtacaaaaaagcaggcttgatgtttgggaagaggaagcgg)
(gttgtccaggtaccccgtgaacttctgctcgtgctg)
pairs
PAK4-F1
and
∆PxxP-GBD-R1
∆PxxP-K-F1
and
(aagttcacggggtacctggacaacttcatcaagatt)
and
(ggggaccactttgtacaagaaagctgggtctcatctggtgcggttctggcgcat)
PAK4-R1
from
pENTR-PAK4
plasmid DNA. The two PCR fragments were gel-purified (Qiagen) and equal
quantities of each were mixed together. DNA was denatured at 95 8C for five minutes
and allowed to cool slowly at room temperature to allow single-stranded DNA of each
3
fragments to bind and overlap. Synthesis of double-stranded DNA was performed at
37 8C in the presence of Klenow enzyme and 1 μl of the Klenow reaction was used as
a template to PCR-amplify full-length PAK4∆PxxP8 using PAK4-F1 and PAK4-R1
primers. The purified PCR product was then cloned into pDONR207 using BP
Gateway® recombination, sequence verified and then transferred into a mammalian
eGFP-expression vector using LRGateway® recombination. The fidelity of the
resultant pDESTGFP-PAK4∆PxxP8 vector was verified by sequencing.
Leptomycin B was purchased from Merck and was added to cell culture media at a
final concentration of 20 ng/ml.
Purification of GST-fusion proteins
BL21-A1 cells (Invitrogen) were transformed with pDEST15-GST-PAK4, -∆Kinase,
-kinase domain or GST-ΔCRIB expression vectors and cultured in LB broth
supplemented with 0.1% glucose and100 μg/ml ampicillin until OD600 0.4-0.6.
Recombinant protein synthesis was induced overnight at 20 °Cwith 0.2% L-arabinose.
Bacterial pellets were lysed in PBS containing complete mini protease inhibitor, 50
mM NaF and 1 mM Na3VO4 followed by sonication and centrifugation at 15 g for 10
min at 4 °C to remove cell debris. The supernatant was then incubated with prewashed Glutathione Sepharose™ (GSH) 4 Fast Flow beads (GE Healthcare) for 2 h
at 4 °C and the GST fusion protein beads were collected by centrifugation, washed
three times with cold PBS and stored in 50% glycerol, 20mM Tris–HCl pH 7.6,
100mM NaCl and 1mM DTT.
Calculation of persistence in cell migration assays
The persistence of cell migration was determined using cell tracks (sequence of
position coordinates relating to each cell in each frame from time lapse microscopy)
from experiments depicted in Figures x (RNAi and rescue) and y (overexpression in
4
wt PC3 cells). The angle in radians between two consecutive positions for every
position in the cell track was determined. The change in angle between points was
then calculated. A frequency distribution was then plotted for the range –Pi to +Pi
radians containing twenty bins and each bin normalised based on the lengths of
displacement vector that the angles were derived from. The mean resultant vector for
the angle changes was then calculated according to the following equation:
n
i
sin theta i
2
n
i
n2
cos theta i
2
n2
This value represents the angular persistence whereby a cell moving in a uniform
direction tends towards a value of one, whereas one moving randomly tends towards
zero. The data are presented as a histogram showing the number of cells (tracks) with
a specific angular persistence to create a ‘persistence profile’.
Immunoprecipitation
Cells were lysed as previously described, [3]. For immunoprecipitation experiments,
cell lysates were mixed with anti-LIMK1 (Transductions Labs) overnight at 4˚C
followed by 2 h incubation with G-sepharose beads. The immune complexes were
washed three times with lysis buffer and resuspended in 2x SDS loading buffer.
Proteins were resolved by SDS-PAGE as previously described [3]. Autoradiographs
were quantified using Andor IQ software (Andor UK).
References
1.
2.
3.
Ahmed, T., et al., A PAK4-LIMK1 pathway drives prostate cancer cell
migration downstream of HGF. Cell Signal, 2008. 20: p. 1320-1328.
Wells, C.M., et al., PAK4: a pluripotent kinase that regulates prostate cancer
cell adhesion. J Cell Sci, 2010.
Wells, C.M., A. Abo, and A.J. Ridley, PAK4 is activated via PI3K in HGFstimulated epithelial cells. J Cell Sci, 2002. 115(Pt 20): p. 3947-56.
5