Name: ____________________
How Can DNA Sequences Identify Individuals?
1 2 3 4 5
Most people share very similar gene sequences, but some regions of DNA sequence have been found
to vary from person to person with high frequency. Comparing variation in these regions allows us to answer the
question of whether two different DNA samples come from the same person.
The FBI’s forensic DNA identification system probes thirteen such regions in the genome. Sequences in these special
regions involve multiple repetitions of short combinations of letters, such as GATA. Easily detectable differences
between people lie in the number of repeats that occur in both copies of their DNA in these regions. For example, at one
of these regions a person might have inherited four repeats (GATAGATAGATAGATA) from their father and six repeats
(GATAGATAGATAGATAGATAGATA) from their mother at the same location in the genome. Another person might inherit
eight repeats (GATAGATAGATAGATAGATAGATAGATAGATA) from their father and five repeats
(GATAGATAGATAGATAGATA) from their mother.
When two DNA samples match completely in a large number of regions, such as the 13 used in the FBI’s CODIS system,
the probability that they could have come from two unrelated people is virtually zero. This fact makes DNA identification
extremely reliable.
Injustice Corrected
It takes both sequences at all 13 sites to prove a DNA match, but it only takes one sequence to prove a mismatch. DNA
evidence has been used to liberate a growing number of people who were falsely imprisoned for crimes they did not
commit.
What Does A Match Mean?
1 2 3 4 5
DNA identification is based on probabilities. Consider the case of just three CODIS sites. The
probability that someone would match a random DNA sample at any one site is roughly one in ten (1/10). So the
probability that someone would match at three sites would be about one in a thousand:
1/10 x 1/10 x 1/10 = 1/1000
Applying this probability equation to all 13 CODIS sites would mean that the chances of matching a random DNA sample
are about one in ten trillion:
1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x 1/10 x = 1/10,000,000,000,000
Actual probabilities vary, depending on several factors. But the probability of two different people matching at all 13
CODIS sites is virtually zero.
Visit the Marian Koshland Science Museum to learn more.
See how DNA fingerprints are made and hear how the use of
DNA evidence has affected the criminal justice system.
Forensic DNA Evidence
1 2 3 4 5
The science of identifying individuals using DNA sequences is very clear, and the probability of
scientific error is extremely small. As a result, DNA evidence has been used to help identify perpetrators of crimes and
to exonerate innocent people before they become suspects.
The value of the evidence depends on the quality of the DNA samples and how well law enforcement agencies handle
them. Most legal disputes over DNA evidence challenge the handling and storage of DNA samples.
Sources of DNA Evidence
DNA can be left behind in a surprising variety of forms, including saliva, blood, semen, skin, hair, tears, and more. As a
result, crime scene evidence can often be traced to a specific individual even if there were no eyewitnesses, and DNA
tests provide a more powerful tool than fingerprint analyses.
DNA Evidence Is Left Behind In A Variety Of Forms
A skin cell, blood, and the shaft of a hair (shown from left to right) all contain DNA
and can be collected as crime scene evidence. (Microscopic images of the skin cell
and hair shaft courtesy of Joseph A. Brzostowski)
How DNA Determines Guilt Or Innocence
1 2 3 4 5
The science of identifying individuals using DNA sequences is very clear, and the probability of
scientific error is extremely small. As a result, DNA evidence has been used to help identify perpetrators of crimes and
to exonerate innocent people before they become suspects.
https://koshland-science-museum.org/sites/all/exhibits/museuminteractives/dna-criminal.jsp
Link on my website...
Compare the DNA evidence from the crime scene (SAMPLE) to the DNA profiles of the
suspects using CODIS sites. When DNA samples match completely at the 13 regions used in
the FBI's CODIS system, the probability that they could have come from two unrelated
people is virtually zero.
Who appears guilty based on DNA?
Suspect 1 ____________
If not guilty – why?
If guilty – why?
**************************************************************
Suspect 2 ____________
If not guilty – why?
If guilty – why?
**************************************************************
Suspect 3 ____________
If not guilty – why?
If guilty – why?