(Supplementary Materials and Methods)
Generation of lentivirus
Firefly-luciferase gene under PGK promoter was cloned into the lentiviral transfer
vector pRRL.sin-18.PPT.PGK.MCS.IRES.GFP.pre (provided by Dr. Murre at
University of California, San Diego). Firefly luciferase gene (Fluc) and GFP coexpressing constructs were prepared from the lentiviral transfer vector by inserting the
Firefly-luciferase gene ORF into multiple cloning sites (MCS) with the NheI and PstI
sites using PCR. Lentivirus was produced by transient cotransfection into the human
293T17 cell line with appropriate transfer and lentiviral helper plasmids (pCMV
ΔR8.74 packaging vector and pMD2.VSVG envelope-encoding vector) using the
calcium phosphate coprecipitation method. Eighteen hours later, growth media (DMEM
containing 10% FBS and 1% penicillin/streptomycin) were changed. Lentiviral
supernatant was harvested at 48 h and 72 h post transfection and filtered though a 0.45μm filter (Ministar). Some lentiviral supernatants were concentrated 20- fold by
ultracentrifugation at 4°C for 10 h at 10,000 g. Harvested lentiviruses were stored at 80°C. To assess the activity of virus encoding the firefly-luciferase reporter gene, the
human 293T cells were infected by adding thawed lentivirus-containing supernatant at a
1
final concentration of 8 g/ml Polybrene (Sigma). Luciferase expressions were confirmed
by determining luciferase activities using a luminometer (Applied Biosystems, Forster,
CA) and GFP co-expression was assessed by flow cytometry.
Stable murine tumor cells co-expressing human MUC1, Firefly luciferase and GFP
Firefly luciferase and GFP expressing lentivirus supernatants were transduced
immediately into B16F1/MUC1 cells (H-2b type MHC), which had been seeded 18 h
before infection at a density of 5 X 104 cells/well into 24 well plates. To infect cells,
medium was removed and replaced by a mixture of lentivirus supernatant and 8 μg/ml
Polybrene (Sigma), and then incubated for 10 min on ice. Cells were then spin-infected
by centrifugation at 30°C for 1.5 h at 1,000 g. After centrifugation, cells were placed in
fresh growth medium and cultured. Single cell selection in 96 well plates was performed
at 48 h after infection. Fourteen days later, individual clones were picked from plates of
the recombinant lentivirus-infected cells, transferred to 24 well plates, and expanded to
generate cell clones stably expressing Firefly luciferase and GFP. Stable clones
(B16F1/hMUC1-Fluc-GFP referred to as BMF cells) were assayed for luciferase activity
using a microplate luminometer (Applied Biosystems, Forster, CA), and confirmed to
express human MUC1 and GFP by flow cytometry.
2
Transfection in vitro
For transfection, BMF cells were plated on either six-well plates (2×105 cells per well)
or 100mm dishes (2×106 cells) and allowed to adhere for 24 hours. Lipofectamine 2000
(Invitrogen, Carlsbad, CA, US) was used for the transfectants. pSilencerTM3.1-H-1 puro
mANT2 siRNA vector (mANT2 shRNA, 1μg/1μl) or pSilencerTM3.1-H-1 puro
scrambled siRNA vector (scrambled shRNA, 1μg/1μl) were transfected into the cells
using a Lipofectamine 2000. Transfected cells were then cultured for 4 hours, and media
were then replaced with fresh media supplemented with 10% FBS. Cells were harvested
at 48 hours after transfection.
Reverse transcription-polymerase chain reaction
After 48 hours of transfection, BMF cells were collected and total RNA was extracted
using Trizol (Invitrogen), according to the manufacturer’s instructions. For RT-PCR
analysis, 5μg of total RNA was reverse-transcribed using RT-PCR kits (Promega,
Madison, WI). PCR was used to amplify target cDNA using the following conditions;
35 cycles of 95°C for 1 minute, 54°C for 1 minute, and 72°C for 2 minutes. PCR
products were analyzed by standard agarose gel electrophoresis. The primers used for
RT-PCR were; mANT1 forward 5’ – GCTGATATTATGTACACGGGGAC – 3’ and
3
reverse 5’ – GCTAGCCTGTTTTCTGTGGGAATC – 3’; mANT2 forward 5’ –
CTTTCAACATGACAGATGC -3’ and reverse 5’ – TGTGTATTTCTTGATCTCATC 3; and β-actin forward 5’ – CATGTTTGAGACCTTCAACACCCC -3’ and reverse 5’ –
GCCATCTCCTGCTCGAAGTCTAG – 3’.
ATP assay
ATP assays were conducted using CellTiter-GloTM Luminescent Cell Viability assay kits
(Promega), which quantify ATP levels in viable cells. This bioluminescence assay
utilizes the light emitted during the interaction between ATP and luciferin. Lyophilized
enzyme/substrate mixtures (250μl) were transferred to opaque 96-well microplates
containing cell lysates. The microplates were then incubated at room temperature for 10
minutes to stabilize luminescence signals, which were then measured using a
luminometer (Applied Biosystems, Forster, CA).
DNA fragmentation assays
Approximately 2×105 BMF cells were transfected with scrambled shRNA (1μg/1μl),
mANT2 shRNA-1 (1μg/1μl), mANT2 shRNA-2 (1μg/1μl), and mANT2 shRNA-3
(1μg/1μl) for 48 hours. Transfected cells were harvested and washed twice with PBS.
4
Genomic DNA was extracted using genomic DNA extraction kits (G-DEXTMIIc; Intron,
Seoul), electrophoresed in 2% agarose gels, and then DNA fragmentation was analyzed.
Cell-proliferation assays
Cell-proliferation assays were performed to analyze the proliferation of scrambled
shRNA (1μg/1μl), mANT2 shRNA-1 (1μg/1μl), mANT2 shRNA-2 (1μg/1μl), and of
mANT2 shRNA-3 (1μg/1μl) transfected cells using a Cell-Counting Kit (CCK)-8
(Dojindo, Kumamoto, Japan). Cells were harvested and plated in 96-well plates at
1×103 cells per well and maintained at 37°C in a humidified incubator. After 2 days of
transfection, 10μl of the CCK-8 solution was added to triplicate wells, and incubated for
1.5 hours. Absorbance was measured at 450 nm to determine viable cell numbers in
wells.
In vitro active caspase-3 assays
Approximately 2×105 BMF cells were transfected with scrambled shRNA (1μg/1μl),
mANT2 shRNA-1 (1μg/1μl), mANT2 shRNA-2 (1μg/1μl), and with mANT2 shRNA-3
(1μg/1μl) for 48 hours using a Lipofectamine 2000. The transfected cells were then
harvested and washed twice with PBS. Apoptotic cells were detected using
5
phycoerythrin-conjugated rabbit anti-active caspase-3 antibody (BD Biosciences, San
Diego, CA), according to the manufacturer’s instructions. To characterize MUC1
expressions, cells were stained with MUC1-specific monoclonal antibody. Percentages
of apoptotic cells were determined by flow cytometry (Epics XL; Coulter, Marseille,
France).
In vitro Annexin V and PI staining assays
Approximately 2×105 BMFs were transfected with scrambled shRNA (1μg/1μl),
mANT2 shRNA-1 (1μg/1μl), mANT2 shRNA-2 (1μg/1μl), and with mANT2 shRNA-3
(1μg/1μl) for 48 hours. Transfected cells were then harvested, washed twice with PBS,
and incubated for 15 minutes at room temperature with a solution of Annexin V
conjugated with fluorescein isothiocyanate (2.5 μg/ml) and propidium iodide (PI) (5
μg/ml) (BD Pharmingen, San Diego, CA). Levels of apoptosis were determined by flow
cytometry.
In vivo active caspase-3 assays in tumors
C57BL/6 mice (eight per group) were injected in right rear limbs with 1×105 BMF cells.
mANT2 shRNA-1, 2, and 3 (100μg/100μl) were injected intratumoral (i.t.) at 14, 16,
6
and 18 days after tumor challenge when tumor size reached ~25mm2. After emulsifying
tumors isolated into single-cell, apoptotic cells were determined using phycoerythrinconjugated rabbit anti-active caspase-3 antibody (BD Biosciences, San Diego, CA) at
25 days after tumor challenge, according to the manufacturer’s instructions. To
characterize MUC1 expression, isolated tumor cells were stained with MUC1-specific
monoclonal antibody. Numbers of apoptotic cells in isolated tumor sections were
determined by flow cytometry.
In vivo Annexin V and PI staining assays in tumors
C57BL/6 mice (eight per group) were injected s.c. in right hind limbs with 1×105 BMFs.
mANT2 shRNA-1, 2, and 3 (100μg/100μl) were injected i.t. at 14, 16, and 18 days after
tumor challenge when tumor size reached ~25mm2. After emulsifying tumors isolated
into single-cell, single cells of isolated tumors were incubated for 15 minutes at room
temperature with a solution of Annexin V conjugated with fluorescein isothiocyanate
(2.5 μg/ml) and propidium iodide (PI) (5 μg/ml) (BD Pharmingen, San Diego, CA) at 25
days after tumor challenge. Levels of apoptosis were determined by flow cytometry.
Quantification of CD8+T cells and DCs in splenocytes and tumors
7
Splenocytes (5×106) or single cells of isolated tumors (5×106) were harvested from
pcDNA3, scramble shRNA, pcDNA3/MUC1 plus scramble shRNA (MUC1 alone),
pcDNA3 plus mANT2 shRNA-1 (mANT2 shRNA-1 alone), and pcDNA3/MUC1 plus
mANT2 shRNA-1 (combined therapy) treated mice (eight per group) at 33 days after
tumor challenge. Cells were then incubated for 66 hrs in the presence of human
interleukin-2
(50units/mL)
and
10μg/mL
hMUC1
peptide
(PDTRPAPGSTAPPAHGVTSAPDTRPAPGST). To stain intracellular cytokines,
stimulated splenocytes were treated with Golgistop (PharMingen, San Diego, CA) and
incubated for a further 6hr. The cells were then harvested and stained with FITCconjugated anti-CD8 antibody (BD Pharmingen, NJ) and PE-conjugated anti-IFNgamma antibody (BD Pharmingen, NJ). To determine the numbers of tumor-infiltrating
DCs, prepared tumor cells were stained with FITC-conjugated monoclonal rat
antimouse CD11c (BD Pharmingen, NJ) and PE-conjugated monoclonal rat antimouse
CD86 (BD Pharmingen, NJ). Flow cytometric analysis was performed using a BectonDickinson FACScan using CELLQuest software (Becton Dickinson Immunocytometry
System, CA).
8
In vitro Splenocyte Cytotoxicity Assays
For the in vivo tumor protection and long-term tumor growth inhibition experiment, the
CytoTox 96 nonradioactive cytotoxicity assay (Promega) was used to measure the
cytotoxic activities of splenocytes in treated mice (8 mice per group), according to the
manufacturer's protocol with minor modification. Briefly, splenocytes (5×106) were
harvested from pcDNA3 (100μg/100μl), scramble shRNA (100μg/100μl), MUC1 alone
(100μg/100μl), mANT2 shRNA-1 alone (100μg/100μl), and pcDNA3/MUC1
(100μg/100μl) plus mANT2 shRNA-1 (100μg/100μl) treated mice (eight per group) 33
days or 54 days (to determine long-term CTL activity) after tumor challenge.
Splenocytes were then incubated in the presence of human interleukin-2 (50 units/mL)
and 10 μg/mL of hMUC1 peptide(PDTRPAPGSTAPPAHGVTSAPDTRPAPGST).
Three days later, irradiated B16F1 and BMF target cells were plated at 1 x 104 per well
on 96-well U-bottomed plates (Costar), and splenocytes (effectors) were added to a final
volume of 100 µL in a 1:30 radio. Plates were then incubated for 4 h in a humidified 5%
CO2 chamber at 37°C, and centrifuged at 500 x g for 5 min. Aliquots (50 µL) were then
transferred from all wells to fresh 96-well flat-bottomed plates, and equal volumes of
reconstituted substrate mix were added to each well. Plates were then incubated in the
dark at room temperature for 30 min. Stop solution (50 µL) was then added, and
9
absorbance values were measured at 492 nm. Cell death percentages at each effector-totarget cell ratio (30 : 1) were calculated using [A (experimental) - A (effector
spontaneous) - A (target spontaneous)] x 100 / [A (target maximum) - A (target
spontaneous)].
Monitoring of tumor growth inhibition in living mice
We recently have reported on in vivo visualization of anti-tumor effect using
bioluminescent imaging technique.47 Based on previous reports, current study was done.
IVIS200 imaging system (Xenogen, Alameda, CA), which includes an optical CCD
camera mounted in a light-tight specimen chamber, was used for data acquisition and
analysis. D-luciferin potassium salt (Fluc substrate) was diluted to 3 mg/100 ul in PBS
before use, and mice were injected i.p. with 100 μl of this D-luciferin solution and
anesthetized with isoflurane. Mice were then placed individually in the specimen
chamber containing the CCD camera, and light emitted by luciferase in mice was then
measured. Images were acquired for 1 sec, beginning 10 min after D-luciferin
administration. Grayscale photographic images and bioluminescent color images were
superimposed using LIVINGIMAGE V. 2.12 (Xenogen, Alameda, CA) and IGOR
image analysis software (WaveMetrics, Lake Oswego, OR). Bioluminescent signals
were expressed in photons per cm3 per second per steradian (P/cm2/s/sr).
C57BL/6 mice (eight per group) were s.c. challenged with 1×105 BMFs per mouse.
mANT2 shRNA-1 (100μg/100μl) or scrambled shRNA (100μg/100μl) were injected
10
into tumor at 14, 16, and 18 days after tumor challenge, and then mice were vaccinated
intramuscularly (i.m).with pcDNA3 (100μg/100μl) or pcDNA3/MUC1 (100μg/100μl)
at 19 and at 26 days after tumor challenge. Tumor volumes were measured and recorded
at 14, 26, 33, and 40 days. Mice were imaged at 14 and 40 days post-BMF challenge
using IVIS 200, 10 min after injecting D-luciferin. To quantify emitted light, regions of
interest were drawn over tumor region and total photon effluxes over an exposure time
of 10 sec were determined.
Histopathology
Lung tissues obtained from the in vivo experiments described above were fixed in 10%
neutral buffered formalin, embedded in paraffin, sectioned at 4μm, and stained with
hematoxylin and eosin (H&E). Histopathological reviews of lung tissues were
performed independently by two pathologists.
In vivo Tumor Re-challenge Experiment
Mice in the combined treatment (pcDNA3/hMUC1+mANT2 shRNA) group were rechallenged with 1×105 BMF cells via a tail vein at 40 days after the initial challenge.
Mice were imaged at 7 and 14 days post-rechallenge using IVIS 200.
11
Restimulation of hMUC1-Associated CD8+ T cells by Enriched CD11c+ Cells from
Immunized Mice
Ten days after the termination of pcDNA3 (100μg/100μl), scramble shRNA
(100μg/100μl), MUC1 alone (100μg/100μl), mANT2 shRNA-1 alone (100μg/100μl),
and pcDNA3/MUC1 (100μg/100μl) plus mANT2 shRNA-1 (100μg/100μl), splenocytes
were harvested and CD8+ T cells were separated using CD8 (Ly-2) microbeads
(Miltenyi Biotec). Enriched CD8+ T cells were analyzed by fluorescence-activated cell
sorting and restimulated in vitro for 72 h with 10 µg/mL hMUC1 peptide
(PDTRPAPGSTAPPAHGVTSAPDTRPAPGST) and interleukin-2 (50 units/mL).
Thirteen days after the termination of pcDNA3 (100μg/100μl), scramble shRNA
(100μg/100μl), MUC1 alone (100μg/100μl), mANT2 shRNA-1 alone (100μg/100μl),
and pcDNA3/MUC1 (100μg/100μl) plus mANT2 shRNA-1 (100μg/100μl), inguinal
draining lymphoid cells were harvested and CD11+ cells were enriched using CD11c
(N418) Microbeads (Miltenyi Biotec). Enriched cells were then analyzed by
fluorescence-activated cell sorting. Restimulated CD8+ T cells [treated with Golgistop
for 6 h (BD PharMingen)] were then harvested for co-culture with the enriched CD11c+
cells. Enriched CD11+ cells (1 x 105) were cocultured with restimulated 1 x 106 hMUC1assoicated CD8+ T cells for 16 h. Restimulated CD8+ T cells were then stained with
12
CD8 and IFN- γ antibody (BD PharMingen) and analyzed by flow cytometry.
In vitro CTL assays after mANT2 shRNA treatment
Splenocytes (effector cells) of mice vaccinated with pcDNA3/MUC1 (100μg/100μl)
were prepared and stimulated with IL-2 (50 U/ml) and MUC1 peptides (10 µg/mL) for
72h. Before this, luciferase-expressing BMF cells (target cells) had been incubated for 2
days after transfection with scrambled (100μg/100μl) or mANT2 shRNA (100μg/100μl).
Transfected BMF cells (target cells, 5×104 per well) were then incubated with
splenocytes (effectors, 1×106) in 24-well plates. After incubation, D-luciferin
(potassium salt; Xenogen Corp.) was added to each well at 150 µg/mL in media for 7 to
8 min before imaging with the Xenogen IVIS 200 system. CTL-mediated killing was
assessed using bioluminescence imaging systems quantitating the decrease of
luminescence from baseline.49
Statistical analysis
All data are expressed as means±SDs and are representative of at least three separate
experiments. Flow cytometric intracellular cytokine staining and tumor treatment results
13
were evaluated by ANOVA. Comparisons between individual data points were made
using Student’s t test. Kaplan-Meier curves were used to determine mouse survival rates,
and were compared using the log-rank test. P values of <0.05 were considered
statistically significant.
14