Evaluation of Midbrain
Dopaminergic Neuron Specification
in Rat ES Cell Derived Neurons
Research internship, Sept.-Dec. 2010
Veterinary Medicine, Utrecht University
Leonie Bekhuis (3277151)
Supervisors:
The Roslin Institute (University of Edinburgh)
Utrecht University
Dr. Tom Burdon
Dr. Stephen Meek
Dr. Bernard Roelen
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Preface
All students of Veterinary Medicine at Utrecht University have to fulfil a research
internship as part of the Master of Science degree. This research project was executed
by Leonie Bekhuis at the department of Developmental Biology at The Roslin
Institute, part of the University of Edinburgh. The results of the project are described
in this final report.
Research Internship: Leonie Bekhuis
1
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Table of Contents
Abstract
Page 3
1. Introduction
 1.1 Parkinson’s disease
 1.2 A treatment for Parkinson’s disease?
 1.3 Why use rat ES cells?
 1.4 Derivation of rat ES cells
 1.5 Midbrain development in vivo
 1.6 Neural differentiation in vitro
 1.7 This project
Page 4
Page 4
Page 8
Page 8
Page 11
Page 14
Page 16
2. Materials and Methods
 2.1 Materials
 2.2 Experimental outline
 2.3 RNA and cDNA purification
-2.3.1 Purification of total RNA from rat brain
-2.3.2 Purification of total RNA from rat ES cells
-2.3.3 cDNA synthesis from purified total RNA


2.4 RT-PCR
2.5 Rat ES cell lines
-2.5.1 Culture of rat ES cells


2.6 Neural differentiation
2.7 Immunohistochemistry
3. Results
 3.1 Optimization of RT-PCR conditions for primers of
mDA neuronal markers
-3.1.1 RT-PCR analysis of adult rat brain and day 10.5 rat embryo
cDNA samples for several markers of midbrain specification
-3.1.2 Optimization of RT-PCR conditions


3.2 RT-PCR analysis of PD0325901 titration samples
3.3 Neural differentiation
-3.3.1 The undifferentiated rat ES cells
-3.3.2 Neural differentiation using and
-3.3.3 Neural differentiation using
-3.3.4 Neural differentiation using RIRIF4.1 and RIDA6.8
Page 17
Page 17
Page 17
Page 17
Page 18
Page 19
Page 20
Page 20
Page 20
Page 21
Page 22
Page 23
Page 23
Page 23
Page 26
Page 28
Page 28
Page 29
Page 30
Page 31
4. Discussion
 4.1 Analysis of PD0325901 titration samples by RT-PCR
 4.2 Neural differentiation experiments
 4.3 Future directions
Page 32
Page 34
Page 35
Acknowledgements
Appendices
References
Page 37
Page 38
Page 42
Research Internship: Leonie Bekhuis
2
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Abstract
Parkinson’s disease (PD) is a chronic, neurodegenerative disorder, which arises as a
result of the progressive loss of midbrain dopaminergic (mDA) neurons in the
substantia nigra. The severity of the symptoms negatively influences the patients’
quality of life and comprises an economic burden to the government. Although many
treatments have been developed over time, these therapies only reduce symptoms and
often have side effects. Since PD results from the loss of a specific cell type, it lends
itself to cell replacement therapy. A very promising source for cell replacement
therapy are embryonic stem (ES) cells. The use of rat ES cells in this perspective,
offers some advantages compared to the utilization of mouse, human or primate ES
cells. Rat ES cells have been reported to differentiate into neurons by means of
adjusting the level of MEK/ERK inhibition. With regard to PD, it would be
interesting to know if these neurons have differentiated toward a midbrain or even
mDA neuronal fate. During this project, the RT-PCR conditions for markers for
midbrain specification and mature mDA neurons were optimized and neuronal
samples, previously generated by modulation of the level of MEK/ERK inhibition,
were evaluated for midbrain marker expression by RT-PCR analysis. Indeed markers
of mDA neuronal specification were identified in rat ES cell derived neurons. This
result provides useful knowledge for future experiments.
Research Internship: Leonie Bekhuis
3
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
1. Introduction
1.1 Parkinson’s disease
Parkinson’s disease (PD) is a chronic, neurodegenerative disorder.1 PD arises as a
result of the progressive loss of midbrain dopaminergic (mDA) neurons in the
substantia nigra.2 Degeneration of these neurons leads to a decrease in dopamine
concentration in the striatum, although other areas may also be affected.3 Dopamine is
an important catecholamine neurotransmitter in the brain of mammals.4 It regulates a
number of functions including cognition, emotion, food intake, positive
reinforcement, endocrine regulation and locomotor activity.4 Dopamine plays
numerous roles in the periphery of the body as well, for example in cardiovascular
and renal function.4 Dopamine acts by activating dopamine receptors, of which
several subtypes exist.4 Dopaminergic neurons in the substantia nigra that project into
the striatum give rise to the nigrostriatal pathway (figure 1).4 The striatum controls
motor function through activation of dopamine receptors.4 As much as 80% of the
mDA neurons within the substantia nigra have been lost by the time symptoms first
appear.3 Symptoms generally consist of motor problems, including resting tremor,
bradykinesia or akinesia, muscle rigidity and postural instability.3
It is commonly known that the prevalence of PD increases with age.5 It is hard to
estimate the exact prevalence of PD and a lot of studies exclude the population below
the age of 40 years, where the prevalence is lower.5 A study in the Netherlands found
a prevalence of 6 per 1000 people in those between the age of 65 and 69 years and 26
per 1000 people in those aged 85 to 90 years.5 The prevalence of PD in the general
population worldwide varies, with for example a prevalence of 57 per 100,000 people
in China and 371 per 100,000 people in
Sicily.5
PD is not fatal by itself.5 Nevertheless,
PD results in physical disabilities that
predispose patients to pneumonia,
pulmonary embolism, deep venous
thrombosis, falls and consequential
complications.5 Furthermore, the
severity of the symptoms significantly
lowers the quality of life of the patient.3
Besides the negative impact of PD on
the patient’s life, PD is also an economic
burden. It has been estimated that the
total direct costs of PD in Europe were
10.7 billion euro’s in 2004.3
Figure 1: Nigrostriatal pathway6
1.2 A treatment for Parkinson’s disease?
At present, there is no cure for PD.3 Current treatment focuses on the relief of
symptoms and maintenance of the patient’s quality of life, independence and
mobility.3 So far, pharmacological treatment is mainly based on increasing the amount
of dopamine available for the striatum in order to reduce motor problems.3
Unfortunately, it is not possible to administer dopamine itself to the patient as a
treatment, because dopamine is unable to cross the blood-brain barrier.7
Research Internship: Leonie Bekhuis
4
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
For that reason, levodopa (L-dopa) has been the ‘golden standard’ in drug therapy for
a long time.3 L-dopa is a dopamine precursor, which is transformed to dopamine in
the neurons projecting from the substantia nigra to the striatum.3 This way, the
availability of dopamine in the striatum is increased.3 L-dopa is often administered in
combination with carbidopa, which facilitates the accessibility of L-dopa into the
brain.3 Treatment with L-dopa however, has limitations; patients treated with L-dopa
at high doses for a long time are likely to develop motor fluctuations and dyskinesias.3
Therefore, other drugs are often used to diminish the use of L-dopa.3 Catechol-Omethyltransferase (COMT) inhibitors for example, are able to lengthen the clinically
effective period of L-dopa.3 COMT is an enzyme which degrades dopamine and Ldopa in the periphery of the body.7 COMT inhibitors provide a higher level of L-dopa
in the plasma, thereby allowing a decrease in the drug dosage of L-dopa.7 The
problem is that COMT inhibitors combined with L-dopa enhance dopaminergic side
effects, such as hallucinations, nausea or dyskinesias.3 Dopamine agonists are also
administered as an adjunct to L-dopa, but they are used as monotherapy as well.3
Dopamine agonists stimulate dopamine receptors on striatal neurons.3 Although
dopamine agonists are reported to be effective, they have side effects too.3 There are
also drugs available which limit the breakdown of dopamine.1 Monoamine oxidase
type B (MAO-B) inhibitors, for example selegiline, exert their effect by restricting the
degradation of dopamine and they are used to alleviate symptoms.1,7
Amantidine is an antiviral drug known to be effective as a treatment for PD.7 The
knowledge about the precise mechanisms of action of amantidine is limited.7 A
number of side effects, for instance anxiety and hallucinations, are associated with the
use of this drug.7 The effects of amantidine may diminish within only 3 to 6 months.7
The sites of action of the various drug treatments are summarized in figure 2.
Figure 2: Site of action of the main drug treatments for PD8
Research Internship: Leonie Bekhuis
5
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Besides drug treatment, surgical therapies are applied as well.5 At present, the primary
surgical treatment employed is deep brain stimulation (DBS) of certain areas in the
brain, such as the internal segment of the globus pallidus, the ventral intermediate
nucleus of the thalamus or the subthalamic nucleus.5 A lead is implanted in the target
area and connected to a pulse generator, which is located under the skin of the chest
wall and delivers electrical stimulation to the targeted regions in the brain.5 DBS
debilitates symptoms of PD, such as tremor.5 There are, however, severe risks
associated with DBS.5 The surgery itself is invasive and the lead and pulse generator
can cause problems like infections.5 Neuropsychiatric, cognitive and other
complications have been described as well.5
The treatments mentioned above are only symptomatic therapies.1 They are unable to
deal with the progressing neural degeneration.1 Moreover, these therapies often have
side effects and are incapable of entirely improving later-stage symptoms.1 There is
therefore a clear need for new treatments.
Since PD results from the loss of a specific cell type, namely mDA neurons, it lends
itself to cell replacement therapy.9 The main goal of cell replacement therapy is to
replace the degenerated and lost dopaminergic neurons, in order to restore the
neuronal innervation between the substantia nigra and the striatum.9 There are
different sources available for dopaminergic cell replacement therapy.9 For example,
fetal ventral mesencephalic transplants.9 Freed et al. performed a double-blind,
placebo controlled trial, in which PD patients received a transplant or imitation, sham
surgery.10 The ventral mesencephalic tissue was obtained from 7 to 8 weeks old
aborted embryos.10 The results indicated that human embryonic dopaminergic neuron
transplants are able to survive in PD patients.10 Some clinical benefit was shown in
younger patients, but not in older ones.10 For many reasons however, fetal tissue
grafting does not seem to be the ideal replacement therapy. Only a very low
percentage of the human embryonic cells survives after transplantation, approximately
10 %.2 Furthermore, the use of embryonic tissue obtained from abortions is
surrounded by ethical issues and the availability of tissue is restricted.2
The use of stem cells in cell replacement therapy seems more promising. Stem cells
are generally defined by two important properties: the ability for continuous selfrenewal and the capacity to differentiate into one or more specific cell types.11 In
theory, stem cells can provide an unlimited supply of cells for purposes like
transplantation therapies.11 Stem cells can roughly be divided in two groups; adult
stem cells and embryonic stem cells.12 Adult stem cells are present in various tissues
of the foetus and the organism after birth.12 These cells are multipotent, which means
that they are able to differentiate into several, but not all, cell types of the body.12
Adult stem cells have an important function in the repair and replacement of tissues.12
With regard to cell replacement therapy, adult stem cells can be used to derive
dopaminergic neurons.13 For instance, Lévesque et al. obtained cortical and
subcortical tissue samples from the brain of a PD patient, during a neurosurgical
procedure.14 The neural stem cells were isolated, expanded and differentiated in
vitro.14 After nine months, a cell suspension containing differentiated dopaminergic
neurons was transplanted back into the patient’s brain.14 The treatment produced a
long lasting motor improvement.14 Although this approach seems to have potential,
harvesting of the brain samples from the patient is very invasive and might be difficult
to use in regular therapy.13
Embryonic stem (ES) cells are intensively studied as a source for cell replacement
therapy, since they exhibit numerous characteristics required for that purpose.15
Research Internship: Leonie Bekhuis
6
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
ES cells are derived from the inner cell
mass (ICM) of the pre-implantation
blastocyst (figure 3).11 This blastocyst
consists of an outer layer of trophoblast
cells, which form the placenta, and the ICM.
Cells of the ICM will eventually give rise to
the embryo and for that reason, these cells
are capable of forming all types of tissue in
the body.11 Therefore, ES cells are truly
pluripotent cells and although their lifespan
in the embryo in vivo is comparatively short,
they can be proliferated infinitely in vitro in
an undifferentiated state.11
The derivation of ES cells was first
described in 1981, from mouse species.16, 17
ES cells provide the perfect tool for cell
Figure 3: Derivation of ES cells18
replacement therapies for diseases like PD,
because of their proliferative competence and the way in which their differentiation
can be manipulated in vitro.9 The generation of dopaminergic neurons from ES cells
is a complicated process, involving the formation of neural stem or precursor cells and
ultimately the development of mature dopaminergic neurons.9 Several research groups
have already established differentiated mDA neurons from mouse, primate and human
ES cells, but with limited success.15 Although the generated dopaminergic neurons
show morphological, functional and electrophysiological properties of mDA neurons,
after transplantation into a rat model of Parkinson’s Disease, survival and phenotypic
stability of the cells seems to be poor.15 Furthermore, some studies have reported
tumour formation following transplantation of ES cell derived dopaminergic
neurons.15
Recently, it has been discovered that adult somatic cells can be reprogrammed to
pluripotent, ES cell like cells.19 These cells are called induced pluripotent stem (iPS)
cells.19 Takahashi and Yamanaka first demonstrated molecular reprogramming of
mouse fibroblasts into iPS cells by introducing four genetic factors, namely Oct4, cMyc, Sox2 and Klf4.19 In the following year, they successfully induced human
pluripotent stem cells by using the same four factors.20 Like ES cells, iPS cells can be
used in the development of cell replacement therapy for PD. Genetic studies have
reported a linkage between several mutations in certain genes and L-dopa responsive
PD.21 Many PD patients are associated with carrying of the predisposed genes.21 It
would be ideal to generate iPS cells from somatic cells from a PD patient, modify the
genome to correct the mutant gene, differentiate the iPS cells into dopaminergic
neurons and use these for treating the same patient.21 Also, the cells of healthy
individuals and PD patients, or from different developmental stages can be
compared.21 This will help in elucidating the pathogenesis of PD.21 Wernig et al. have
already taken some steps in the use of iPS technology for PD.22 They derived iPS cells
from mouse fibroblasts, differentiated them towards a mDA neuronal fate and
transplanted the differentiated cells into the striatum of rat models of PD.22 This
resulted in improved behaviour of the rats.22
iPS cells could solve the problem of ethical issues surrounding the use of ES cells and
immune rejection.21 However, despite the potential of iPS cells in therapies for PD,
their clinical use cannot be considered yet, as there are many problems that need to be
Research Internship: Leonie Bekhuis
7
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
resolved.9 For instance, the efficiency of derivation of iPS cells is poor, and the iPS
cell derived grafts cause a high risk of tumour formation.9
This project revolves around the use of ES cells in generating mDA neurons. The
specific and efficient generation of mDA neurons from ES cells would provide
knowledge that can be used in cell replacement therapies and drug discovery.
1.3 Why use rat ES cells?
The Burdon group is one of only a few in the world that are experienced in the
derivation and culture of rat ES cells.23 Using rat ES cells has some advantages
compared to the use of mouse, primate or human ES cells. While the use of human ES
cells in cell replacement therapy shows great prospective, the fact that these cells are
derived from human pre-implantation embryos makes their use highly controversial.12
The supply of human ES cells is very restricted as well.12 Non-human primate ES
cells could be a proper alternative for the utilization of human ES cells, however,
primates are very expensive to use and the majority of researchers do not have access
to them.24 The benefits of rat ES cells in relation to mouse ES cells can partly be
explained by their history as research models.25 The mouse became the research
model for mammalian geneticists, because of its smaller size, which made their
housing easier, and the availability of many mutants displaying Mendelian patterns of
inheritance.25 The rat became the model of choice for biomedical researchers, like
physiologists and nutritionists.25 The rat has been used to develop disease models and
as such a rat model of PD exists.26 Generally, these Parkinsonian rats are generated by
administration of the neurotoxin 6-hydroxydopamine (6-OHDA) to the rat brain.26
The specificity of 6-OHDA is due to its uptake by dopaminergic and noradrenergic
transporters and it damages the neurons by oxidative stress.26 Another reason why rats
are preferred above mice is that the rat, because of its larger size, provides a more
practical model for experimental interventions.25
1.4 Derivation of rat ES cells
Although mouse ES cells have been consistently derived over the past three decades,
the derivation of rat ES cells has remained elusive for a long time.27 In order to
establish rat ES cells, researchers applied conditions developed for the culture of
mouse ES cells.27 For culturing any ES cell, it must be considered that stem cells
choose at each division whether to continue self-renewal or to differentiate.28 The
signals that regulate this decision come from growth factors in the microenvironment
of the stem cells.28 To facilitate maintenance of ES cells, long-term self-renewal must
be promoted and differentiation must be suppressed.28 Mouse ES cells were originally
derived and maintained by cocultivation with feeder cells, typically mitotically
inactivated mouse embryo fibroblasts (MEFs), and serum.28 The main function of the
fibroblast feeder cells is the secretion of the cytokine leukemia inhibitory factor
(LIF).28 LIF supports self-renewal of ES cells through activation of the transcription
factor STAT3.28 Serum, usually fetal calf serum, is important for the viability of
undifferentiated ES cells.28 In the absence of serum, LIF is insufficient to completely
inhibit differentiation and promote self-renewal.28 Serum can be replaced by bone
morphogenetic proteins (BMPs).28 BMPs antagonize neural differentiation of ES
cells, but promote differentiation into non-neural destinies.28 Therefore, BMPs seem
unlikely to use as a factor to support self-renewal.28 However, Ying et al. showed that
the combination of LIF and BMP enhances self-renewal and inhibits differentiation.28
BMPs act through binding their receptors, which main effectors are the Smad
Research Internship: Leonie Bekhuis
8
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
BMPs
Cytoplasm
Smad1,5,8
P
Smad1,5,8
P
Smad4
Smad1,5,8
P
Smad4
Nucleus
Id genes
Figure 4: BMP/Smad pathway
transcription factors.28 Smad1, 5 and 8 are phosphorylated by the BMP receptor and
then joined with Smad4. This complex translocates to the nucleus, where the
transcription factors exert their function.28 Important targets of BMP/Smad signalling
are the Inhibitor of differentiation (Id) genes (figure 4).28 Id proteins are factors that
repress gene transcription required for differentiation and promote cell growth.28 Id
genes are induced by serum as well.28
The combination of LIF, to activate STAT3,
and either serum or BMP, to stimulate Id
proteins is commonly used for the
maintenance of mouse ES cells.27 Rat ES
cells, adversely, have never been established
using similar culture conditions.27 A few
years ago, Ying et al. found that maintaining
self-renewal of mouse ES cells does not
necessitate activating signals from
LIF/STAT3 and BMP/Smad signalling,
but only that the exposure of ES cells to
inductive differentiation stimuli must be
prevented.29 Differentiation of ES cells
involves fibroblast growth factor-4 (FGF4),
which is produced by undifferentiated ES
cells in an autocrine way.29, 30 FGF4
stimulates the mitogen-activated protein
kinase (MAPK) pathway (figure 5).29
MAPK is often confused with extracellular
regulated kinase (ERK), but ERK is in fact
the name for one specific group of isoforms Figure 5: FGF stimulation of the
within the MAPK family and one of the
MAPK pathway31
important molecules in the MAPK
Research Internship: Leonie Bekhuis
9
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
signalling cascade.32 Mitogen-activated ERK-activating kinase (MEK) is another
important factor in this cascade and functions as an upstream molecule of ERK.32
Stimulation of the cascade by FGF4 forces ES cells to stop self-renewal and induces
differentiation.30 Therefore, Ying et al. used selective small-molecule inhibitors to
inhibit the MAPK pathway and thus inhibit differentiation.29 The inhibitor SU5402
was used to inhibit FGF receptor tyrosine kinases and the inhibitor PD184352 was
applied to inhibit the ERK cascade.29 By application of low doses of SU5402 and
PD184352 together, undifferentiated ES cells expanded and differentiation was
restricted.29 Nevertheless, a high level of cell death was observed and the viability of
the cells seemed to be compromised.29 For that reason, a third inhibitor was added.29
CHIR99021 is a selective inhibitor of glycogen synthase kinase-3 (GSK3).29 GSK3
mediates negative regulation of biosynthetic pathways.29 Inhibition of GSK3 might
reinstate ES cell growth to cells cultured with SU5402 and PD184352.29 CHIR99021
on its own improves cell survival, but induces non-neural differentiation as well.29 In
the combination of all three inhibitors, also referred to as 3i, the inhibiting effect of
SU5402 and PD184352 on differentiation is superior and undifferentiated ES cells can
be proliferated efficiently.29 An overview of the effects of LIF/BMP and 3i on ES cell
self-renewal is given in figure 6.
In 2008, it was shown for the first time that rat ES cells can be established using 3i
conditions.23, 27 The rat ES cells could be derived and maintained in the 3i conditions
and they remained undifferentiated.23, 27 The use of the inhibitor SU5402, however,
might not be most favourable, because it is less specific than the other two
inhibitors.23 Another consideration is that inhibition of the FGF receptor not only
restrains the MEK/ERK cascade, but might affect other pathways downstream of the
FGF receptor as well.23 These pathways may have a positive effect on ES cells and
therefore blockade by SU5402 may have conflicting downstream functions.23
Figure 6: Schematic
representation of
maintenance of selfrenewal by either
LIF/BMP or 3i.
In order to avert the unwanted side effects of inhibiting the FGF receptor, SU5402
was excluded and PD184352 was replaced by the more potent MEK inhibitor
PD0325901.23, 27 It was found that PD0325901 combined with the GSK3 inhibitor
CHIR99021, also referred to as 2i, is sufficient to derive and maintain rat ES
Research Internship: Leonie Bekhuis
10
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
cells.23, 27 At present, the Burdon lab has actually derived rat ES cells using only one
inhibitor, namely PD0325901.(Unpublished data)
1.5 Midbrain development in vivo
To facilitate the differentiation of ES cells into mDA neurons in vitro, it is important
to understand the mechanisms of mDA neuron differentiation in vivo.
In the mature brain, mDA neurons are separated into different subgroups based on
their location in the midbrain and the structures that they innervate.33 There are the
neurons of the substantia nigra compacta (SNc) and the neurons of the ventral
tegmental area (VTA).33 The VTA neurons project to the ventromedial striatum,
cortical areas and the limbic system.33 These neurons are involved in emotional
behaviour and mechanisms of reward and defects of the VTA neuron system lead to
psychiatric disorders.33 The dopaminergic neurons of the SNc mainly project into the
dorsolateral striatum and are responsible for motor function.33 PD arises as a result of
the degeneration of SNc neurons.33
Differentiation of SNc neurons in vivo consists of 3 important processes:
regionalisation of the neural plate, determination of midbrain cell fate and terminal
differentiation into mDA neurons.33
Regionalisation of the neural plate
In an early stage of embryonic development, the lateral edges of the neural plate roll
up and form a tube.33 At the anterior side of the tube a constriction develops, known
as the midbrain hindbrain border (MHB) or isthmus.33, 34 The MHB forms the
boundary between the future midbrain and hindbrain.33 Together with signals from the
mesoderm and endogenous genes that regulate regional patterning, the MHB specifies
certain areas of neural tissue in the developing midbrain and hindbrain.33 There are
two main signals required for the induction of dopaminergic neurons.34 Fibroblast
growth factor 8 (Fgf8) is expressed in the MHB.34 Fgf8 induces anterior-posterior
identity of the midbrain and plays a role in defining midbrain cell fate.33, 34 Sonic
hedgehog (Shh) is expressed by the notochord and is secreted by cells of the floor
plate, located in the ventricular neuroepithelium of the ventral midbrain.33, 34 Shh is
important for dorsal-ventral patterning of the midbrain.33, 34 Ventral cells of the
midbrain acquire a dopaminergic cell fate in response to Shh expression.33 The
intersection of the concentration gradients of Fgf8 and Shh regulates the development
of dopaminergic neurons (figure 7).34
Figure 7: The birth of DA neurons is regulated by the intersection of the
concentration gradients of Fgf8 and Shh.34
Research Internship: Leonie Bekhuis
11
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
The MHB is positioned between the expression domains of the transcription factors
Otx2 and Gbx2.35 Gbx2 is expressed caudally from the MHB and suppresses midbrain
development, whereas Otx2 is expressed on the rostral side of the MHB and
suppresses development of hindbrain.35 Otx2 is a homeodomain transcription factor
which, besides its function in restricting hindbrain development, is also required for
restraining the level of dorsal Shh expression in the ventral midbrain and positioning
Wnt1 and Fgf8 expression in the MHB.36 Wnt1 is a secreted molecule, involved in
ventral midbrain proliferation and instructing differentiation of dopaminergic
neurons.34 It is expressed in the MHB, but primarily on the side of the midbrain.35
Wnt1, and Fgf8 as well, are shown to be induced by Lmx1b.37, 38
Lmx1b, a LIM homeodomain transcription factor, is at first expressed throughout the
ventral mes- and diencephalon, but becomes limited to post-mitotic mDA neurons
later in development.35 Lmx1b is crucial for the induction and maintenance of the
activity of the MHB.38 Around this stage, the Engrailed homeodomain transcription
factors En1 and En2 are also expressed.35 In the developing brain, En1 and En2 are
expressed on both sides of the MHB.35 In the adult midbrain, En1 is expressed at high
levels in the SNc and VTA, while the expression level of En2 is lower and limited to a
subset of the cells expressing En1.35 En1 and En2 are required for the survival of
mDA neurons.35
Determination of midbrain cell fate
At this stage, the neuroepithelium of the midbrain develops and becomes thicker by
cell proliferation.33 Distinct layers can be distinguished at this point.33 The cells
located in a band near the ventricle maintain their properties as proliferative stem
cells.33 Other cells depart this proliferative zone, exit the cell cycle and start
differentiating.33 The mDA neuron progenitors occupy the proliferative zone on the
ventral most side.33 From there, they initially move in a ventral direction followed by
a lateral movement, while they differentiate.33 These cells express Lmx1b, Lmx1a,
Foxa2, Msx1, Msx2, Ngn2 and, at an early stage, Shh.33 When cells reach this stage,
they obtain mDA neuronal specification and enter the last steps of differentiation.33
Shh induces Lmx1a expression.33 Like Lmx1b, Lmx1a is a member of the family of
LIM homeodomain transcription factors.36 Lmx1a expression starts in the ventral
midbrain and then expands progressively towards dorsal.36 Shh and Lmx1a are both
essential and adequate to induce mDA neurons.33 Unlike Shh, Lmx1a is expressed
continually during the production of mDA neuron progenitors.33 Shh is able to
regulate the expression of Foxa2 as well.33 Foxa2 is a forkhead/winged helix
transcription factor.39 Foxa2 positively regulates the expression of Ngn2 and is also
involved in regulating Nurr1 and En1 expression in immature mDA neurons and TH
expression in mature mDA neurons.39 Ngn2 is a proneural basic helix-loop-helix
gene, which is expressed in mDA progenitors, the more dorsally located ventricular
zone and newborn postmitotic immature mDA neurons directly flanking the
ventricular zone.36 Ngn2 mediates the shift of a cell from the proliferative zone to the
intermediate zone, which is situated ventrally from the proliferative zone.33 It is also
needed for the generation of immature, Nurr1 expressing mDA neurons.36 Msx1, a
homeodomain transcription factor, is expressed in the proliferative zone as well.33, 36
Msx1 acts synergistically with Lmx1a to promote the population of mDA neuron
progenitors.33 The cooperation of Msx1 and Lmx1a results in the upregulation of
Ngn2.33
Research Internship: Leonie Bekhuis
12
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Terminal differentiation into mDA neurons
Cells in the intermediate zone begin to express Nurr1 and Pitx3.33 When they migrate
further and reach the ventral peripheral edge of the neuroepithelium, they are
completely differentiated mDA neurons.33 The last step in dopaminergic neuron
differentiation is the expression of tyrosine hydroxylase (TH).33, 36 TH is the first and
also rate-limiting enzyme in the biosynthesis of dopamine.33, 36 Nurr1 is a
transcription factor belonging to the family of orphan nuclear receptors.36 It regulates
TH expression, after it is phosphorylated by ERK, and is important for the survival of
mature dopaminergic neurons as well.33, 36 TH is also regulated by Pitx3, a paired-like
homeodomain protein expressed in both SNc and VTA dopaminergic neurons.33 Pitx3
is positively controlled by Lmx1b and Wnt1.33
Lmx1b plays a role in maintaining TH expressing mDA neurons.36 Maintenance of
the mDA neurons late in embryonic development and in adulthood requires
expression of En1 and En2.33
An outline of the expression of the key players in mDA neuron development is
illustrated in figure 8. The timing of expression of some factors in mouse embryo’s is
shown in figure 9.
N.B.: The current knowledge about the signals controlling the induction of mDA
neuron progenitors and mDA neuronal fate specification is incomplete.33 Further
research in this field is required to elucidate the precise mechanisms of mDA neuron
differentiation.
Figure 8: Schematic illustration of the main factors of mDA neuron development.33
Research Internship: Leonie Bekhuis
13
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Figure 9: The timing of transcription factor expression in mDA progenitors. Dotted
lines point out that the exact timing of shutdown of expression has not been
determined.36
1.6 Neural differentiation in vitro
The generation of mDA neurons from ES cells in vitro involves directing ES cell
differentiation into a neuronal cell fate.33 Kawasaki et al. showed that dopaminergic
neurons can be efficiently induced by culturing ES cells on a layer of bone marrow
derived PA6 stromal cells.40 PA6 cells produce stromal cell-derived inducing activity
(SDIA), which promotes neural differentiation of cocultured ES cells.40
Because ES cell differentiation in vitro largely mimics development in vivo, it is also
possible to apply known extracellular factors during ES cell differentiation and
thereby induce a transcription cascade comparable to normal development.33
Lee et al. used a five step protocol to obtain neurons.41 The first step consisted of
expanding the undifferentiated ES cells in the presence of LIF.41 During the second
step, embryoid bodies (EBs) were generated.41 EBs are ES cell aggregates, which
form when ES cells are cultured in suspension in the absence of LIF.41, 42 They show
many aspects of cell differentiation in early embryonic development and are able to
constitute cells of all three germ layers.42 The third step was to select for stem cells of
the central nervous system (CNS) from the EBs.41 In the fourth step, the CNS stem
cells were proliferated in the presence of basic fibroblast growth factor (bFGF).41
Finally, differentiation of the expanded neuronal precursor cells was induced by
removing bFGF.41 The differentiation of ES cells into mDA neurons in vitro, should
be reliant on the stimulation of the same genes expressed in CNS stem cells and
neurons in vivo, as has been described above.41 Therefore, using the expression of
these genes as a marker helps to identify the nature of the generated neurons.41
Demonstration of TH expression, would indicate terminal differentiated dopaminergic
neurons.41 It has been shown that application of Shh, Fgf8 and ascorbic acid (AA)
increased the yield of ES cell derived TH expressing neurons.41
Ying et al. reported that neither coculture nor cellular aggregation is needed to direct
ES cells to a neural fate.43 They showed that ES cells can be converted into
neuroectodermal precursors in adherent monoculture.43 It has been demonstrated that
ES cells develop into neural precursors, in the absence of serum or supplemented
Research Internship: Leonie Bekhuis
14
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
growth factors.43 This process is not a default pathway, as it requires autocrine FGF.43
Ying et al. induced differentiation in the absence of serum, by withdrawal of LIF.43
The experiments mentioned previously were all conducted on mouse ES cells. Chang
et al. used iPS cells derived from rats to generate dopaminergic neurons in vitro.44 The
potential of the rat iPS cells to differentiate into neural cell types, including
dopaminergic neurons, was examined based on the five step protocol from Lee et al.41,
44
It was shown that the rat iPS cells were able to differentiate into all neural lineage
phenotypes.44 The appliance of Shh, Fgf8 and AA resulted in a high yield of
dopaminergic neurons (9.2±3.7% of total amount of neurons).44
Researchers of the Burdon team found that neural differentiation of rat ES cells can be
established by adjusting the level of MEK/ERK inhibition.(Unpublished data) Rat ES
cells were cultured in the presence of CHIR99021 and different concentrations of
PD0325901. Figure 10 shows the results of a semi-quantitative RT-PCR analysis of
the expression of certain genes at the different inhibitor conditions. No reverse
transcriptase (RT), serves as a negative control. βactin, a gene expressed in all
nucleated cell types, was used as a loading control.45 At lower concentrations
expression of the ESC marker Oct4 is reduced, indicating a loss of pluripotency.46
Conversely, markers of the neural lineage Nestin and Pax6 were both increased.
Nestin is expressed in neuroepithelial stem cells and muscle precursors.47 Pax6 is a
marker commonly found in neural tissue.48 Interestingly, when cells were cultured in
the absence of PD0325901, no Pax6 expression was observed (a condition in which
neural differentiation is expected to be favoured). Rather, there was an increase in
muscle markers myogenin and Myf5 in this condition. These results suggest that
neural differentiation is enhanced by using low concentrations of PD0325901, but
without the presence of PD0325901 muscle differentiation is promoted, probably due
to the effects of CHIR99021.(Unpublished data) These results are supported by an
immunohistochemistry analysis of the cells at a concentration of 0.25μM PD0325901
(figure 11). The green staining indicates the expression of β-ІІІ tubulin, a neuronal
marker.41 The red staining shows Nestin expression and the blue color DAPI, which
stains DNA.49 Figure 11 shows a high amount of β-ІІІ tubulin in a typical
morphology, indicating neural differentiation.(Unpublished data)
Figure 10: RT-PCR analysis of
PD0325901 titration samples for Oct4,
Nestin, Pax6, Myogenin, Myf5, βactin and
a sample without reverse transcriptase.
Research Internship: Leonie Bekhuis
Figure 11: Immunohistochemistry
analysis of differentiated rat ES cells
cultured in the presence of 0.25μM
PD0325901; red stain: nestin, green
stain: β-ІІІ tubulin, blue stain: DAPI .
15
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Figure 12: Immunohistochemistry analysis of rat ES cells cultured without the
presence of PD0325901; green stain: myosin, blue stain: DAPI.
Moreover, an immunohistechemistry analysis of the rat ES cells cultured in the
absence of PD0325901 was performed as well. Figure 12 clearly shows the presence
of myosin (green stain), which indicates muscle differentiation.
1.7 This project
This project continues the work of the Burdon team on neural differentiation of rat ES
cells. The specific and efficient differentiation of rat ES cells into mDA neurons
would provide a tool for modelling cell replacement therapy in PD rat models and
facilitate drug discovery. To assess the degree of mDA differentiation present in the
PD0325901 titration samples, RT-PCR conditions for markers of midbrain
specification and mature mDA neurons will be optimized and the PD0325901 titration
samples will be evaluated for midbrain marker expression by RT-PCR analysis.
Hypothesis:
Rat ES cell neural differentiation induces midbrain specification and generation of
mDA neurons.
Research Internship: Leonie Bekhuis
16
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
2. Materials and Methods
2.1 Materials
N2B27 Base medium:
Component
Company
Catalogue number
100 ml DMEM/F12
Gibco
21331-020
100 ml Neurobasal
Gibco
21103-049
1 ml N2
Gibco
17502-048
2 ml B27 no Vit.A
Gibco
12587-010
2 ml L-glutamine
Roslin stores
N2B27 medium containing 2i or 1i:
2i Media
1i Media
10ml N2B27
10ml N2B27
10µl 1mM PD0325901 (MEK inhibitor)
10µl 1mM PD0325901 (MEK inhibitor)
30µl 1mM CHIR99021 (GSK3 inhibitor)
100µl Pen/Strep (Roslin stores, 100x)
100µl Pen/Strep (Roslin stores, 100x)
N.B.: PD0325901 and CHIR99021 are obtained from University of Dundee
2.2 Experimental outline
The main goal of this project was to examine PD0325901 titration samples, which
were established by Stephen Meek, for the presence of mDA neuronal markers. The
samples were derived from rat ES cells from a Fisher 4.4 line, cultured on laminin
coated wells for 11-14 days in the presence of 1.5μM CHIR99021 and 7 different
concentrations of PD0325901 (2.0μM, 1.5μM, 1.0μM, 0.75μM, 0.5μM, 0.25μM and
0μM). Before RT-PCR analysis of the PD0325901 titration samples was performed,
RNA and cDNA were purified and the RT-PCR conditions for the mDA neuronal
markers were optimized. Meanwhile, rat ES cells were cultured and neural
differentiation experiments were set up.
2.3 RNA and cDNA purification
RNA and cDNA were purified for RT-PCR analysis.
2.3.1 Purification of total RNA from rat brain
RNA purification was performed using the RNeasy® Mini Kit (Qiagen), following
the protocol for ‘purification of total RNA from animal tissues’ in the RNeasy® Mini
Handbook (Fourth edition, april 2006, Qiagen) as described below:
-Remove the brain sample from storage (or excise the sample from the animal)
-Weigh the brain sample and add 30mg to a 7ml bijous
-Add ß-Mercaptoethanol (ß-ME) to Buffer RLT in a fume hood. Add 10µl ß-ME per
1ml Buffer RLT.
Research Internship: Leonie Bekhuis
17
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
-Add 600µl Buffer RLT (+ß-ME) to the 30mg brain sample
-Disrupt and homogenize the sample using a rotor-stator homogenizer. Clean the
rotor-stator homogenizer before use with 4M sodiumhydroxide and water.
-Pipet 600µl of the sample into a QIAshredder spin column placed in a 2ml collection
tube and centrifuge for 2 min. at full speed
-Remove the supernatant by pipetting and transfer it to a new 2ml collection tube
-Add 1 volume of 70% ethanol and mix by pipetting
-Transfer 700µl of the sample to an RNeasy spin column placed in a 2ml collection
tube and centrifuge for 15sec. at 10000rpm
-Discard the flow-through
-Transfer the remaining sample to the spin column and centrifuge again for 15 sec. at
10000rpm
-Discard the flow-through
-Add 350µl Buffer RW1 to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 10µl DNase 1 stock solution to 70µl Buffer RDD and mix by pipetting
-Add 80µl of the DNase 1 incubation mix directly to the spin column membrane and
incubate for ± 30 min.
-Add 350µl Buffer RW1 to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 4 volumes of ethanol (96-100%) to Buffer RPE
-Add 500µl Buffer RPE to the spin column and centrifuge for 2 min. at 10000rpm
-Place the spin column in a new 2 ml collection tube and centrifuge for 1 min. at full
speed
-Place the spin column in an Eppendorf tube
-Add 35µl RNase free water and centrifuge for 1 min. at 10000rpm
2.3.2 Purification of total RNA from rat ES cells
RNA purification was performed using the RNeasy® Mini Kit (Qiagen), following
the protocol for ‘purification of total RNA from animal cells using spin technology’ in
the RNeasy® Mini Handbook (Fourth edition, april 2006, Qiagen) as described
below:
-Pellet the cells:
-Aspirate media off from well
-Add 200µl CDB to the well
-Aspirate the CDB off
-Add 200µl CDB to the well
-Incubate for ± 5 min. at 37°C
-Dissociate the cells by pipetting
-Transfer the content of the well to an Eppendorf tube
-Add 1ml PBS to the Eppendorf tube
-Centrifuge for 3 min. at 10000rpm
-Aspirate the PBS off (leave a little bit at the bottom)
-Loosen the cell pellet by flicking the tube
-Add ß-Mercaptoethanol (ß-ME) to Buffer RLT in a fume hood. Add 10µl ß-ME per
1ml Buffer RLT.
-Add 350µl Buffer RLT to the cells and mix by pipetting
-Pipet the lysate directly into a Qiashredder spin column placed in a 2ml collection
tube and centrifuge for 2 min. at full speed
-Add 1 volume of 70% ethanol to the homogenized lysate and mix by pipetting
Research Internship: Leonie Bekhuis
18
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
-Transfer 700µl of the sample to an RNeasy spin column placed in a 2ml collection
tube and centrifuge for 15sec. at 10000rpm
-Discard the flow-through
-Transfer the remaining sample to the spin column and centrifuge again for 15 sec. at
10000rpm
-Discard the flow-through
-Add 350µl Buffer RW1 to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 10µl DNase 1 stock solution to 70µl Buffer RDD and mix by pipetting
-Add 80µl of the DNase 1 incubation mix directly to the spin column membrane and
incubate for ± 30 min.
-Add 350µl Buffer RW1 to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 700µl Buffer RW1 to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 4 volumes of ethanol (96-100%) to Buffer RPE
-Add 500µl Buffer RPE to the spin column and centrifuge for 15 sec. at 10000rpm
-Discard the flow-through
-Add 500µl Buffer RPE to the spin column and centrifuge for 2 min. at 10000rpm
-Place the spin column in a new 2ml collection tube and centrifuge for 1 min. at full
speed
-Place the spin column in an Eppendorf tube
-Add 35µl RNase free water and centrifuge for 1 min. at 10000rpm
-Store at -80°C
2.3.3 cDNA synthesis from purified total RNA
cDNA synthesis was performed using SuperScript™ First-Strand Synthesis System
for RT-PCR (Invitrogen), following the protocol ‘First-Strand synthesis using
oligo(dT)’ from the included guide (March 2007, Invitrogen) as described below:
-Add 8µl RNA to an Eppendorf tube
-Add 1µl 10mM dNTP mix to the Eppendorf tube
-Add 1µl 0.5 µg/µl oligo(dT) to the Eppendorf tube
-Incubate the RNA/primer mixture for 5 min. at 65°C, then place on ice for 1 min. and
centrifuge briefly to get rid of the condensation
-Prepare the following reaction mix in a separate tube:
For 1 reaction:
-2µl 10x RT buffer
-4µl 25 mM MgCl2
-2µl 0.1 M DTT
-1µl RNaseOUT™ (40 U/µl)
-Add 9µl reaction mix to the RNA/primer mixture, mix by pipetting and collect by
brief centrifugation
-Incubate for 2 min. at 42°C
-Add 1µl of SuperScript™ ІІ RT to the tube
In the case of a minus RT control: Add 1µl DEPC-treated water instead of RT
-Incubate for 50 min. at 42°C
-Incubate for 15 min. at 70°C, then place on ice
-Centrifuge briefly and add 1µl RNase H to the tube
-Incubate for 20 min. at 37°C
-Store at -20°C
Research Internship: Leonie Bekhuis
19
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
After the cDNA sythesis was completed, the concentration of the cDNA was
measured with a spectrophotometer (NanoDrop). The cDNA samples were diluted
with water to a concentration of 200ng/µl.
2.4 RT-PCR
The primers used for this project are listed in Appendix 1, along with the primer
sequences, size, percentage of G and C oligonucleotides, melting temperature and the
product size. Primers were designed by Stephen Meek.
RT-PCR was performed using a reaction volume of 50µl. Under ‘standard’
conditions, the reaction mixture contained:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.2µM forward primer
-0.2µM reverse primer
-200ng/µl cDNA
-5 units/µl Taq polymerase
RT-PCR amplifications were run in a DNA Engine Dyad Peltier thermal cycler. The
reaction mixture was exposed to a temperature of 94ºC for 2 min., followed by
amplification during 30 or 32 cycles (each cycle consisted of denaturation at 94ºC for
30 sec., annealing at a temperature ranging from 50ºC to 63 ºC for 40 sec. and
elongation at 72ºC for 40 sec.) and final extension at 72ºC for 10 min. The specific
RT-PCR conditions for each primer pair are included in Appendix 2.
The presence of amplified products was detected by gel electrophoresis, using a 2%
agarose gel (1g. agarose in 50ml TBE Buffer) on 50V. 12µl 5x TBE loading buffer
(40% sucrose, x5 TBE Buffer, ddH2O, bromophenol blue) was added to each 50µl
reaction mixture, before loading the gel. 15µl of each sample was loaded on the gel.
In order to be able to estimate the size of the amplified products, 5µl 1Kb DNA ladder
(TrackIt, Invitrogen, Cat. no. 10488-085) was loaded in adjacent lanes. Gels were
stained for ± 15min. in an ethidium bromide bath. An image of the gel was taken
utilizing UV-light (Kodak Gel Logic 200 Imaging System).
2.5 Rat ES cell lines
For this project, four different rat ES cell lines were used:
-Roslin Institute Dark Agouti (RIDA) 27
-Roslin Institute Brown Norway (RIBN) 1
-Roslin Institute Fisher (RIF) 4.1
-Roslin Institute Dark Agouti (RIDA) 6.8
The and cell lines were used during the first part of the project, whereas the two
RIRIF4.1 and RIDA6.8 cell lines were used through the last part.
2.5.1 Culture of rat ES cells
RIDA27 and RIBN1 cell lines were cultured in 4-well plates on DIA-M
(Differentiation Inhibiting Activity-Matrix bound) feeders, which are mouse
fibroblasts that express LIF. The RIDA27 cell line was cultured in 1i medium and the
RIBN1 cell line was cultured in 2i medium.
Every 1-2 days a half media change was performed. Media was partly aspirated from
the wells, whereupon fresh media was added. RIDA27 and RIBN1 cell lines were
passaged according to their confluence, with an average of every 3-4 days. A cell
Research Internship: Leonie Bekhuis
20
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
passage was performed as follows:
-Aspirate medium off from the well
-Add 200µl Cell Dissociation Buffer (CDB) to the well
-Aspirate the CDB off
-Add 200µl CDB to the well
-Incubate the well at 37°C for ± 5 min.
-Dissociate the cells by pipetting
-Transfer the content of the well into a 15ml tube containing 5ml N2B27
-Centrifuge the tube for 3 min. at 1000 rcf
-Aspirate N2B27 off from the tube and resuspend the pellet in 200µl N2B27 + 1i/2i
-Count the cells with the use of a haemocytometer
-Plate the cells in the desired density on DIA-M feeders in 500µl N2B27 + 1i/2i
-Incubate the cells at 37°C
The RIF4.1 and RIDA6.8 cell lines were cultured feeder-free and were plated on
laminin. The cell lines were derived in 2i medium.
2.6 Neural differentiation
Neural differentiation was performed using the following protocols.
Laminin coating of wells:
Laminin is stored at a concentration of 1mg/ml.
-Dilute laminin 1:50 in phosphate buffered saline (PBS) to 20µg/ml
-Add 500µl 20µg/ml laminin to each well
-Incubate the wells for at least 2 hours
-Wash the wells 3x with 500µl PBS before use
Gelatin coating of wells:
-Add 500µl gelatin to each well
-Aspirate gelatine off after a few minutes
Setting up neural differentiation:
-Aspirate media off from wells
-Add 200µl CDB to the wells
-Aspirate the CDB off
-Add 200µl CDB to the wells
-Incubate the well at 37°C for ± 5 min.
-Dissociate the cells by pipetting
-Transfer the content of the well into a 15ml tube containing 5ml N2B27
-Centrifuge the tube for 3 min. at 1000 rcf
-Aspirate N2B27 off from the tube and resuspend the pellet in the desired amount of
N2B27
-Add 1ml of the content of the tube to each gelatin coated well
-Incubate the wells at 37°C for 10-15 min.
-Transfer the upper part of the content of the wells to a 15ml tube containing 5ml
N2B27
-Centrifuge the tube for 3 min. at 1000 rcf
-Aspirate N2B27 off from the tube and resuspend the pellet in 200µl N2B27
-Count the cells with the use of a haemocytometer
Research Internship: Leonie Bekhuis
21
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
-Plate the cells in the desired density on laminin coated wells in 500µl of the desired
medium
-Incubate the wells at 37°C
2.7 Immunohistochemistry
Undifferentiated rat ES cells were fixed and immuno-stained for the pluripotency
markers Oct4 and Nanog. The cells were stained for the DNA-marker DAPI as well.
Staining and fixation of the cells was carried out according to the protocol described
below.
Antibodies used:
Primary antibodies:
Oct4 antibody – Santa Cruz (C10) mouse monoclonal IgG2b.
Nanog antibody – Abcam ab80892 rabbit polyclonal IgG.
Secondary antibodies:
Secondary for Oct4 – Goat anti-mouse IgG2b Alexa 488
Secondary for Nanog – Goat anti-rabbit IgG Alexa 568.
Fixation of cells:
-Wash the well with 500µl PBS
-Fix in 500µl 4% paraformaldehyde (PFA) for 15 minutes at room temperature.
-Wash the well twice with 500µl PBS.
-If storing, leave the second PBS wash on the cells, wrap the plate with parafilm and
store at 4oC.
Staining of cells:
-Wash the fixed well 4 x 10 minutes with 500µl PBST (PBS + 0.3% TritonX100)
-Make blocking solution (PBST + 1% BSA + 10% serum – serum from same species
as secondary antibody was raised in)
-Add 500µl blocking solution to the well and block for 1 hour at room temperature
-Dilute primary antibodies 1:200 in blocking solution
-Aspirate the blocking solution of from the well
-Add 500µl primary antibody solution to the well
-Wrap the plate with parafilm and leave the plate overnight at 4oC
-Wash the well 4 x 10 minutes with 500µl PBST
-Dilute secondary antibodies 1:1000 in blocking solution
-Add 500µl secondary antibody solution to the well
-Incubate 1 hour at room temperature in the dark
-Wash the well 3 x 10 minutes with 500µl PBST
-Dilute DAPI 1:10000 in PBST
-Add 500µl DAPI solution to the well and incubate 5 minutes at room temperature
-Wash the well twice with PBS and leave the second wash on the cells
-Take images and/or wrap the plate in parafilm and foil and store at 4oC
Images of the cells were taken, using fluorescence microscopy.
Research Internship: Leonie Bekhuis
22
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
3. Results
3.1 Optimization of RT-PCR conditions for primers of mDA neuronal markers
3.1.1 RT-PCR analysis of adult rat brain and day 10.5 rat embryo cDNA samples
for several markers of midbrain specification
RT-PCR was performed on adult rat brain and day 10.5 rat embryo (rE10.5) cDNA
samples, for several markers of midbrain specification, using ‘standard’ RT-PCR
conditions (ddH2O, x1 Buffer, 1.5mM MgCl2, 0.4mM dNTPs, 0.2µM forward primer,
0.2µM reverse primer, 200ng/µl cDNA, 5 units/µl Taq polymerase). ßactin2 served as
a loading control. The results are displayed in figure 13. Under these conditions, PCR
products of the expected size were obtained for En2, Foxa2 and Nurr1. However, no
PCR products were observed for Lmxb1, Otx2 or Msx1. Therefore, PCR conditions
were further optimised for these markers.
Figure 13: RT-PCR of adult rat brain and day 10.5 rat embryo
for mDA neuronal markers; (1) ddH2O, (2) adult rat brain,
no reverse transcriptase, (3) adult rat brain, + reverse transcriptase,
(4) day 10.5 rat embryo, no reverse transcriptase,
(5) day 10.5 rat embryo, +reverse transcriptase
3.1.2 Optimization of RT-PCR conditions
Optimization of RT-PCR conditions for the primer pairs of mDA neuronal markers,
consisted of one or more of the following points:
-Optimize primer concentration: A primer concentration that is too high, might result
in the creation of primer-dimers and non-specific PCR products. However, if the
primer concentration is too low, the yield of product might be too low to detect. In
Research Internship: Leonie Bekhuis
23
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
order to find the optimal primer concentration for a specific primer pair, four different
primer concentrations (0,1 µM; 0,2 µM; 0,4 µM and 0,8 µM) were applied.
-Optimize MgCl2 concentration: Magnesium functions as a necessary co-factor for
thermostable DNA polymerases. If the MgCl2 concentration is too low, the yield of
PCR product will be low. Excess magnesium increases the yield of non-specific PCR
products. Therefore, four different MgCl2 concentrations (1,0 mM; 1,5 mM; 2,0 mM
and 2,5 mM) were used to find the optimum concentration for a specific primer pair.
-Optimize annealing temperature: When the annealing temperature is too high little or
no product will be obtained due to reduced primer binding. Similarly, if the annealing
temperature is too low, non-specific PCR products will be formed and the yield of
product will decrease. To facilitate a higher yield of PCR product and to diminish the
formation of non-specific products, an annealing temperature gradient was applied to
find the most favourable annealing temperature.
RT-PCR was performed on adult rat brain and rE10.5 cDNA. Optimization of RTPCR conditions was performed for Msx1, Lmx1b and Otx2 primers in addition to two
other mDA neuronal markers, Pitx3 and TH. Two different primer pairs were
designed for both Pitx3 and TH, i.e. Pitx3a and Pitx3b, THa and THb. Optimization
of primer concentration was applied to each of these primer pairs and the RT-PCR
conditions for the primer pairs which showed the highest level of band expression, i.e.
Pitxb and THb, were further optimized. The results of the optimization of the RT-PCR
conditions for the primers of Msx1, Lmx1b, Otx2, Pitx3 and TH are shown in figure
14. The RT-PCR conditions that were determined as being optimal are defined by a
red square. These conditions were used for further optimization and final application.
The RT-PCR conditions used for final application can also be found in Appendix 2.
Research Internship: Leonie Bekhuis
24
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Figure 14: Optimization of RT-PCR conditions for the primer pairs of Msx1, Otx2,
Lmx1b, TH and Pitx3, a red square indicates the determined ‘optimal’ conditions; (1)
ddH2O, (2) adult rat brain, no reverse transcriptase, (3) adult rat brain, + reverse
Research Internship: Leonie Bekhuis
25
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
transcriptase, (4) day 10.5 rat embryo, no reverse transcriptase, (5) day 10.5 rat
embryo, +reverse transcriptase
3.2 RT-PCR analysis of PD0325901 titration samples
Prior to this project, the Burdon team found that neural differentiation of rat ES cells
can be induced by adjusting the level of MEK/ERK inhibition. Rat ES cells were
exposed to 1.5 µM CHIR99021, which is half the concentration used in 2i media, and
several concentrations of PD0325901 (2,0 µM; 1,5 µM; 1,0 µM; 0,75 µM; 0,5 µM;
0,25 µM and 0 µM) were applied. RNA and cDNA samples were prepared from these
cells.
Samples were evaluated for midbrain marker expression by RT-PCR analysis, to
determine whether there is evidence of mDA neurons present in the samples. RT-PCR
analysis was performed twice, with different cDNA samples.
The PD0325901 titration samples were derived from a Fisher 4.4 rat ES cell line.
Therefore, undifferentiated Fisher ES cells on DIA-M feeders were used as a control.
DIA-M feeders were used as a control to determine whether any expression in the
sample containing undifferentiated ES cells was due to the ES cells or to the feeder
cells present in that sample. ddH2O was used as a negative control. r.E10.5 and adult
rat brain were used as positive controls. To rule out amplification from potential
genomic DNA contamination, primers were designed to span introns, and a no RT
control was also performed as a negative control. The first RT-PCR analysis was
carried out for the midbrain markers Otx2, En2, Foxa2, Nurr1, the pan neuronal
marker Pax6 and for βactin2, which served as a positive control. The results are
displayed in figure 15. Five PD0325901 titration samples were used for this analysis,
namely the samples that were exposed to a PD0325901 concentration of 2,0 µM, 1,5
µM, 1,0 µM, 0,5 µM or 0 µM. The negative controls that were synthesized without
RT were negative (not shown in the figure).
Figure 15: First RT-PCR analysis of PD0325901 titration samples for some
midbrain neuronal markers; (1) ddH2O, (2) DIA-M feeders, (3) day 10.5 rat embryo,
(4) adult rat brain, (5) Fisher 4.6 ES cells on DIA-M feeders, (6) Fisher 4.4, 2,0 µM
PD0325901, (7) Fisher 4.4, 1,5 µM PD0325901, (8) Fisher 4.4, 1,0 µM PD0325901,
(9) Fisher 4.4, 0,5 µM PD0325901, (10) Fisher 4.4, 0 µM PD0325901
Research Internship: Leonie Bekhuis
26
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
The second and final RT-PCR analysis was executed on a different batch of cDNA
samples. Again, five PD0325901 titration samples were analysed, but compared to the
previous RT-PCR analysis, with a slight difference in the PD0325901 titration
samples that were used. This time, the analysis was performed on the samples that
were exposed to a PD0325901 concentration of 2,0 µM, 1,0 µM, 0,5 µM, 0,25 µM, or
0 µM. The PD0325901 titration samples were analysed for the midbrain markers
Otx2, Lmx1b, En2, Msx1, Foxa2, Nurr1, Pitx3 and TH, the pan-neuronal marker
Pax6, the pluripotency markers Oct4, Nanog, Rex1 and Klf4, and for βactin2. The
results are demonstrated in figure 16. The negative controls that were synthesized
without RT were negative (not shown in the figure).
Figure 16:Second RT-PCR analysis of PD0325901 titration samples for midbrain
neuronal markers; (1) ddH2O, (2) DIA-M feeders, (3) day 10.5 rat embryo, (4) adult
rat brain, (5) Fisher 4.4 ES cells on DIA-M feeders, (6) Fisher 4.4, 2,0 µM
Research Internship: Leonie Bekhuis
27
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
PD0325901, (7) Fisher 4.4, 1,0 µM PD0325901, (8) Fisher 4.4 0,5 µM PD0325901,
(9) Fisher 4.4, 0,25 µM PD0325901, (10) Fisher 4.4, 0 µM PD0325901
3.3 Neural differentiation
Besides the RT-PCR analysis of PD0325901 titration samples for midbrain markers,
an attempt was made to differentiate rat ES cells into a neuronal and possibly even to
a mDA neuronal fate.
3.3.1 The undifferentiated rat ES cells
Altogether, four different rat ES cell lines were used in the neural differentiation
experiment. The cell lines that were used are, and two feeder-free lines RIRIF4.1 and
RIDA6.8. Figure 17 shows the typical morphology of undifferentiated rat ES cells in
culture, which appear as dense balls of cells.
Figure 17: Bright field microscopic picture of rat ES cell colonies (x100)
In order to confirm that the rat ES cells were in an undifferentiated state at the time
the differentiation experiments were started, the cells were immunostained for the
pluripotency markers Oct4 and Nanog. Cells of all four cell lines were fixed and
stained for the two markers of pluripotency and for DAPI, which stains DNA. For the
staining of RIRIF4.1 and RIDA6.8 cell lines, mouse ES cells of the HM1 cell line
were used as a positive control and DIA-M feeders as a negative control. Figure 18
shows that the nuclei of all four cell lines stained well for Oct4, Nanog and DAPI.
The positive controls were positive and the negative controls were negative (separate
controls are not shown in the figure).
Research Internship: Leonie Bekhuis
28
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Figure 18: Immunohistochemistry of RIDA27, RIBN1, RIF4.1 and RIDA6.8 cell lines
for Oct4 (green stain) and Nanog (red stain), in combination with DAPI staining
(blue stain).
3.3.2 Neural differentiation using RIDA27 and RIBN1
The first neural differentiation experiment was set up, using RIDA27 and RIBN1 cell
lines. The cells were plated on laminin coated wells (20µg/ml) of a 24-well plate.
Each cell line was plated in four different densities (5x103 cells/well, 1x104 cells/well,
2x104 cells/well and 3x104 cells/well) to determine the optimal density for neural
differentiation. RIDA27 was plated in N2B27 + 1i and RIBN1 was plated in N2B27 +
2i.
One day after plating, 500µl N2B27 was added to each of the 8 wells. Four days after
plating, a complete media change was performed. Media was removed and the cells
were washed with 500µl PBS, then 1ml N2B27 was added to each well.
During the experiment, bright-field pictures of the cells were taken every 1-2 days
(not shown). One day after plating, the cells seemed to have plated down well.
However, during the following days the cells started to die. Three days after plating,
Research Internship: Leonie Bekhuis
29
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
all cells from both cell lines plated at a density of 5x103 cells/well and 1x104
cells/well had died. Five days after plating, the cells at the higher densities had also
died.
3.3.3 Neural differentiation using RIDA27
For the second neural differentiation experiment, RIDA27 cell line was used. Because
of the cell death in the previous experiment, this experiment focused on enhancing
cell survival en finding the optimal conditions for neural differentiation. Neural
differentiation was set up, but instead of using CDB to dissociate the cells, trypsin
(TVP) was applied. 200µl TVP was added to the wells, the wells were incubated at
37°C for ± 2 min. and the cells were spun down in GMEM (Glasgow Minimal
Essential Medium). After counting, the cells were plated in a density of 1x104
cells/well on laminin coated wells (2cm2) in three different media:
-Well 1: N2B27
-Well 2: N2B27 + 2i
-Well 3: N2B27 + 1.5µM CHIR99021 and 0.25µM PD0325901 (N2CHPD)
These three media were applied to examine cell survival and possibly neural
differentiation in the different media. N2B27 + 2i was used, because the cells are
comfortable in this medium and the inhibitors enhance cell survival. However,
inducing neural differentiation in combination with the standard concentration of
inhibitors might not be likely. To see how the cells would survive without the
inhibitors, N2B27 alone was employed. Furthermore, the Burdon team has shown
before that the third medium, i.e. the combination of N2B27 with reduced inhibitor
concentrations (1.5µM CHIR99021 and 0.25µM PD0325901), is able to induce neural
differentiation.
In order to investigate whether the amount of available oxygen might be of influence
on the cell survival, one plate was kept at 37°C in 5% O2, the other plate was kept at
37°C in 21% O2.
During the experiment, a half media change was performed every 2-3 days. Brightfield pictures of the cells were taken every 1-2 days (not shown).
Within one day of plating cell death was observed in N2B27 and N2CHPD of both the
plate kept at low and the plate kept at normal oxygen, however, the cells in N2CHPD
seemed to survive a little bit better. The cells in N2B27 + 2i of the plates in both
oxygen conditions expanded, although a fast number of cell death was present as well.
The cell survival seemed to be a bit higher on the 5% O2 plate.
Six days after plating, all cells in N2B27 and N2CHPD had died. The cells in N2B27
+ 2i of the two plates had reached a high confluency and therefore, the cells in N2B27
+ 2i of each plate was passaged. Again CDB was replaced by TVP and the cells were
spun down in GMEM. The cells in N2B27 + 2i on the plate kept in 5% O2 were
passaged to three laminin coated wells on a 4-well plate, in a density of 2x104
cells/well. Cells were plated in the three different media (well 1: N2B27, well 2:
N2B27 + 2i, well 3: N2B27 + 1.5µM CHIR99021 and 0.25µM PD0325901) and the
plate was kept at 37°C in 5% O2. The cells in N2B27 + 2i on the plate kept in 21% O2
were passaged the exact same way to a plate which was kept at 37°C in 21% O2.
The cells plated down well after the passage. Nevertheless, the cells started to die off
during the next days. Again, the cells only seemed to expand in N2B27 + 2i. The cells
in N2CHPD appeared to survive better compared to the cells in N2B27. Cell survival
seemed higher on the 5% O2 plate.
After 5 days, the cells in N2B27 + 2i of each plate were passaged again.
Unfortunately, after this second passage the cells were dying as well. Overall, cell
Research Internship: Leonie Bekhuis
30
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
survival seemed to be best in N2B27 + 2i medium and at a low oxygen concentration.
No differentiation was observed.
3.3.4 Neural differentiation using RIF4.1 and RIDA6.8
Feeder-free cell lines were also tested. A neural differentiation experiment was set up,
using feeder-free cell lines RIF4.1 and RIDA6.8. The cells of each cell line were
plated in a density of 5x103 cells/well on three laminin coated wells on a 4-well plate
in the same three media applied in the previous experiment:
-Well 1: N2B27
-Well 2: N2B27 + 2i
-Well 3: N2B27 + 1.5µM CHIR99021 and 0.25µM PD0325901
Both plates were kept at 37°C in 5% O2, because the low oxygen concentration
seemed to enhance cell survival in the previous experiment.
The cells of RIF4.1 cell line in N2B27 and N2CHPD started to die off, after plating
down. The cells in N2B27 + 2i did expand. Cell survival was better in line RIDA6.8.
However, cells started to die off as well. Especially in N2B27 and N2CHPD, the cell
survival was low. No sign of differentiation was observed.
Because of time limits, the experiment could not be further continued.
Research Internship: Leonie Bekhuis
31
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
4. Discussion
4.1 Analysis of PD0325901 titration samples by RT-PCR
The aim of this project was to investigate whether established rat ES cell neural
differentiation induces midbrain specification and generation of mDA neurons. In
order to develop cell replacement therapy for PD, many researchers have attempted to
differentiate ES cells into mDA neurons. So far, dopaminergic neurons have been
generated from primate, human and mouse ES cells.15 Rat ES cells are a relatively
new source of stem cells, first derived in 2008.23, 27 The Burdon team is one of only a
few in the world working on the differentiation of rat ES cells. They established
neural differentiation of a Fisher 4.4 rat ES cell line, by adjusting the level of
MEK/ERK inhibition by means of using a reduced concentration of CHIR99021 and
applying different concentrations of PD0325901.(Unpublished data) During this
project these PD0325901 titration samples were analysed by RT-PCR for the presence
of midbrain marker expression.
The RT-PCR conditions for several markers of midbrain specification and mature
mDA neurons were optimized. The optimization process consisted of applying
different primer concentrations, different MgCl2 concentrations and different
annealing temperatures. This method to find the optimal RT-PCR conditions for each
marker is typically used in research.50
The optimal conditions were determined by visual differences between the PCR
products. This might, however, be a somewhat subjective manner to decide which
condition is optimal as the differences between conditions are sometimes unclear. In
the case of Lmx1b, non-specific PCR products were formed. During the first step of
the optimization step, with the appliance of different primer concentrations, nonspecific bands were visible. It is questionable whether the optimization should have
proceeded. It might have been more precise to design new primers.
The optimized RT-PCR conditions were used in evaluating the PD0325901 titration
samples for midbrain marker expression. The results of the RT-PCR analysis of the
PD0325901 titration samples demonstrate that indeed markers of mDA neuronal
specification were identified in rat ES cell derived neurons.
The expression of pluripotency markers Oct4, Nanog, Rex1 and Klf4 seemed to be
strongest in the 2,0 µM PD0325901 sample. This can be explained by the fact that
PD0325901 is required for self-renewal and pluripotency of ES cells. As the
concentration of PD0325901 lowered, the PCR bands of these four markers became
gradually less clear and for the sample without any PD0325901 there was no band
visible at all. This might be an indication for a higher level of cell differentiation,
hence less pluripotency of the cells, in the samples with a lower concentration of
PD0325901.
The expression of Pax6, a pan-neuronal marker, showed just the opposite pattern. The
visibility of the PCR bands gradually increased for the samples with lower
concentrations of PD0325901. A PCR band was most clearly visible in the 0.25 µM
PD0325901 sample, but no band was seen in the 0 µM PD0325901 sample. This
expression pattern was confirmed by RT-PCR analysis of a different batch of cDNA
samples during this project and researchers of the Burdon team have also observed
this pattern before. As mentioned in the introduction, a possibility is that neural
differentiation is enhanced by using low concentrations of PD0325901, and that in the
Research Internship: Leonie Bekhuis
32
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
absence of PD0325901 muscle differentiation is promoted, probably due to the effects
of CHIR99021. CHIR99021 is a selective inhibitor of GSK3. In principal, GSK3
negatively affects substrate-mediated downstream signalling.51 Therefore, the
inactivation of GSK3 usually results in the stimulation of certain cellular events.51
GSK3 is part of the Wnt signalling pathway.51 Wnts are secreted glycoproteins that
serve as important signalling molecules in development.51 Wnt signalling has been
associated with many processes, for instance bone development, angiogenesis, lipid
and glucose metabolism, stem cell renewal and differentiation, and myogenesis.51 It is
known that GSK3 activity is suppressed by Wnt.51 The inhibition of GSK3 by
CHIR99021 could be equivalent to Wnt signalling, which might explain muscle
differentiation of ES cells exposed only to CHIR99021 and not PD0325901.
The markers Otx2, Lmx1b and En2, which were employed in the RT-PCR analysis of
the PD0325901 titration samples, are early markers of midbrain specification. All of
these three markers were clearly identified in the PD0325901 titration samples. Otx2
and En2 both showed an expression pattern quite similar to the pattern of the
pluripotency markers. The PCR bands came up strongly in the samples with higher
concentrations of PD0325901, and then gradually decreased in visibility as the
PD0325901 concentrations were lower. This result was also confirmed by RT-PCR
analysis of a different batch of cDNA samples. The pattern might be explained by the
early expression of these markers in the differentiation process. The samples with
higher concentrations of PD0325901 showed a very clear expression of pluripotency
markers, which might indicate a low level of differentiation. Otx2 and En2, however,
are very early markers of midbrain specification and might already be expressed at
that stage, despite the high PD0325901 concentrations that inhibit cell differentiation.
Conversely, Lmx1b expression increased as the PD0325901 concentration was
lowered. A possible explanation for this observation might be that Lmx1b is a marker
that comes to expression slightly later than Otx2 and En2. It might be that this marker
is not present in the samples with high concentrations of PD0325901, where cell
differentiation is strongly inhibited, but comes to expression at a somewhat proceeded
stage in differentiation, which means in the presence of lower PD0325901
concentrations. Otx2 and Lmx1b both show expression in the 0 µM PD0325901
sample and Otx2 and En2 seem to be expressed in the sample with undifferentiated rat
ES cells. Expression of midbrain specification markers in these samples might seem
unexpected, as it is very unlikely that a significant level of neural differentiation has
occurred in undifferentiated ES cells or in an environment that does not promote
differentiation into a neural cell fate. Possibly the fact that these markers are not
specific only for midbrain development might offer a plausible explanation. For
example, Otx2 does not only come to expression in the fore- and hindbrain, but is
found to be expressed in the developing human retina as well.52 The expression of
En2 is not limited to the midbrain-hindbrain border, but En2 is for instance also
expressed in some other brain areas and the mandibular arch.53
In this RT-PCR analysis of PD0325901 titration samples mid-stage developmental
markers of midbrain specification are represented by Msx1, Foxa2 and Nurr1. Msx1
and Foxa2 are both clearly expressed in the PD0325901 titration samples. It should,
however, be taken into account that these markers are highly unspecific. Besides its
expression in the brain, Msx1 is also expressed in the skeleton, heart, teeth and
limbs.54-57 Foxa2 expression reaches from several brain structures and olfactory
epithelium, to liver, lung, pancreas, stomach, intestine, prostate, bladder, kidney,
vagina, uterus, seminal and coagulating glands.58 Nurr1 on the other hand seems
somewhat more specific to mDA neurons, but is also expressed in some other regions
Research Internship: Leonie Bekhuis
33
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
of the nervous system.59, 60 It is very encouraging to see that expression of this late
mid-marker of midbrain specification can be observed from the RT-PCR analysis of
the PD0325901 titration samples. Moreover, the expression of Foxa2 and Nurr1 was
confirmed by RT-PCR analysis of a different batch of cDNA samples.
The markers Otx2, En2 and Msx1 appear in the rat ES cell samples of the RT-PCR
analysis. As mentioned before, the inhibition of GSK3 by CHIR99021 seems to be
equivalent to Wnt signalling. It has been found that GSK3 inhibition is able to induce
mDA differentiation, by mimicking several effects of Wnts.61 Moreover, a link exists
between the expression of the markers Otx2, En2 and Msx1 and Wnt signalling.62-64
Therefore, it might be that the presence of these markers in rat ES cell samples is a
side-effect of GSK3 inhibition by CHIR99021 in a 2i culture.
Although Pitx3 expression level is low, the observation that both late markers of
midbrain specification, Pitx3 and TH, seem to be expressed in the PD0325901
titration samples is most encouraging. Besides the expression of Pitx3 in late midbrain
development, its expression in skeletal muscles has also been reported.65 TH, an
essential enzyme in the biosynthesis of dopamine, is highly specific to dopaminergic
neurons. The observation that TH seems to be expressed in the PD0325901 titration
samples is, therefore, a very promising result.
The results of the RT-PCR analysis of the PD0325901 titration samples show that
markers of midbrain specification and mDA neurons have been identified in the
samples. It must be strongly taken into account that the detection of the expression of
a single marker by RT-PCR, does not necessarily have to indicate midbrain
specification of cells in the sample. As has been mentioned before, most markers are
not specific for midbrain or mDA neurons, but come to expression in other regions
and cells of the body as well. For that reason, only the combination of expression
patterns of several midbrain or mDA neuronal markers might be an indication for cell
differentiation towards a midbrain or mDA neuronal fate.
RT-PCR is a semi-quantitative technique. Using this technique has its limitations, as
no valid quantitative measures can be made. A much more accurate method that gains
quantitative data is real-time PCR or real-time RT-PCR.66 This technique collects data
during the PCR process as it occurs.66 The amplification of PCR product and its
detection is combined into a single step, through the usage of several different
fluorescent chemistries that associate the concentration of PCR product to
fluorescence intensity.66 The use of real-time RT-PCR has some significant
advantages, since it produces quantitative data with a high accuracy and postamplification manipulation is not needed.66
4.2 Neural differentiation experiments
An attempt was made to differentiate rat ES cells into a neuronal and possibly even to
a mDA neuronal fate. Unfortunately, as the cells kept dying, no conclusions can be
drawn from this experiment.
Effort was put into enhancing the survival of the cells. Several cell densities and
different media were tried. Although the cells seemed to survive longer at a higher
density, in order to induce differentiation the cells must not be too confluent, and
therefore an intermediate cell density was chosen for the following experiments. The
survival of the cells in N2B27 + 2i medium seemed better than survival of the cells in
the other two media. This might be due to the fact that this medium promotes cell
survival and expansion. However, the use of N2B27 + 2i medium for a differentiation
experiment is not favourable, since this medium inhibits cell differentiation.
Research Internship: Leonie Bekhuis
34
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
The cells were also exposed to different concentrations of oxygen. Cell in vitro are
exposed to oxygen levels that are usually much higher than the in vivo situation. It has
already been found that exposing cells in vitro to low oxygen concentration can
enhance cell survival and even neural differentiation. Rodrigues et al. studied the
effect of low oxygen concentrations on mouse ES cell derived neural stem cells.67
They demonstrated that 2-5% O2 led to total cell numbers about twice as high
compared to the cell numbers observed under 20% O2.67 Stacpoole et al. investigated
whether an oxygen level of 3% permits the development of neural precursor cells
from human ES cells and whether these neural precursor cells are able to undergo
regional specification and functional maturation.68 They found that at 3% O2, the cells
exhibited a robust and efficient neural conversion.68 The neural precursor cells
derived under 3% O2 were differentiated and readily specified into spinal motor
neurons and mDA neurons.68
During this project, the cells seemed to survive better at low oxygen levels as well,
although this is purely based on observations. No real statements can be made, as no
cell counts were performed.
To rule out a possible negative influence from the feeder cells on the rat ES cells,
feeder-free cell lines were applied. But even these feeder-free cells did not survive
very well, suggesting that the cell death was not solely due to the indirect effect of a
sub-standard feeder cell layer.
The key to the answer of the question why the cells kept dying might be found in the
plates that were used for the differentiation experiments. Due to an unfortunate
mistake, ultra-low-attachments plates were used, which are normally applied for the
culture of embryoid bodies. This means that the cells could not properly attach to the
plates. A simple solution to a seemingly complicated mystery!
4.3 Future directions
The ultimate goal of the differentiation of rat ES cells into mDA neurons is to create a
pool of cells that can be utilised for the screening of new drugs or as cell replacement
therapy for PD. Such a cell replacement therapy requires a pure population of mDA
neurons. Therefore, the efficiency of TH expressing neuron generation needs to be
enhanced.
As has been described in the introduction, two main signals are important for the
induction of dopaminergic neurons, namely Fgf8 and Shh. Fgf8 induces anteriorposterior identity of the midbrain and plays a role in defining midbrain cell fate.33, 34
Shh is significant for dorsal-ventral patterning of the midbrain.33, 34 Several studies
have shown that application of Fgf8 and Shh increases the yield of ES cell derived TH
expressing neurons. Lee et al. demonstrated that the differentiation of mouse ES cells
into dopaminergic neurons can be promoted by applying Fgf8 and Shh.41 They found
that the appliance of Fgf8 and Shh during a certain stage in the differentiation process
of mouse ES cells leads to a more than twofold increase in the number of TH
expressing cells.41 Yan et al. showed that administration of Fgf8 and Shh leads to
efficient generation of dopaminergic neurons from human ES cells.69 They discovered
that the time window of Fgf8 and Shh application is important in determining the
specification of the human ES cells into midbrain or forebrain dopaminergic
neurons.69 Early exposure to Fgf8 throughout the process of neuroepithelial
specification leads the cells to a midbrain fate and mDA neuron differentiation.69
Exposure to Fgf8 and Shh after a certain time point promotes differentiation into
dopaminergic neurons, but mainly with a forebrain phenotype.69
Research Internship: Leonie Bekhuis
35
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Chang et al. reported the direct reprogramming of rat embryonic fibroblasts and rat
neural precursor cells into iPS cells.44 They demonstrated the efficient differentiation
of these rat iPS cells into midbrain-like dopaminergic neurons.44 In the presence of
Shh, Fgf8 and ascorbic acid, the differentiation of rat fibroblast derived iPS cells led
to high yields of neurons (about 82% of total cells) and dopaminergic neurons (about
9% of neurons).44 These TH expressing neurons also co-expressed the midbrain
markers Pitx3 and En1, which indicates a midbrain dopaminergic phenotype.44
A proposition for a future experiment, following this current project, could be to
investigate whether the generation of mDA neurons can be enhanced by the appliance
of Shh and Fgf8 in the differentiation protocol for rat ES cell derived mDA neurons.
For instance, rat ES cells could be plated in a medium that has been shown to promote
differentiation into a mDA neuronal fate, such as N2B27 + 1.5μM CHIR99021 +
0.25μM PD0325901. One group of rat ES cells would be kept in this medium without
any further application of other substances, and this group would represent the control
group. Shh and Fgf8 would be administered on different time points to other groups of
rat ES cells. The results of this experiment could be analysed by real-time RT-PCR
and immunohistochemistry. Real-time RT-PCR analysis could be performed for
several markers of midbrain specification and would give quantitative measurements.
Immunohistochemistry could be executed for a neuron marker, Tuj1, and a marker of
dopaminergic neurons, TH. Using these two markers would give the opportunity to
calculate the percentage of TH expressing neurons from the percentage of total
neurons.
The results of this possible experiment would provide the answer to two important
questions. First, does the appliance of Shh and Fgf8 enhance the generation of mDA
neurons from rat ES cells? And second, at which time point is the appliance of Shh
and Fgf8 most effective for the differentiation of rat ES cells into mDA neurons?
Overall, there is still a long way to go before researchers will be able to create a
homogeneous mDA neuron population that is ready for cell replacement therapy for
PD. A large amount of experiments needs to be performed in order to develop the
specific protocols required for the development of such a pure pool of differentiated
cells. Hopefully, one day the establishment of an infinite population of mDA neurons
will lead to the successful treatment of PD patients.
Research Internship: Leonie Bekhuis
36
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Acknowledgements
First, I would like to thank Bernard Roelen for giving me the opportunity to fulfil my
research internship abroad and for his guidance as supervisor from my home
institution, Utrecht University.
I would like to thank Tom Burdon for letting me perform my research internship as a
part of his research team at The Roslin Institute. It was a great honour to be part of his
team and his effort and involvement were always motivating. Thanks to him, I got the
chance to discover working in a science lab and Scotland at the same time (and I came
to know that I like both a lot!).
Many thanks to Stephen Meek for guiding me through my first real research
experience. Thank you, Stephen, for all your effort and time. For teaching me
everything I needed to know about rat ES cells en RT-PCR. Working with you was an
absolute pleasure and your sense of humor always made me smile. You kept
motivating me and made my internship very instructive, interesting and fun!
Furthermore, I would also like to thank all other lab members and in particular Linda
Sutherland for all her care.
And last but not least, I like to thank my fellow student Alexandra Bogerman. Thanks
to her I was and felt never alone during these months. Alexandra, thank you for being
there with me and making our time in Scotland a great adventure!
Research Internship: Leonie Bekhuis
37
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Appendices
Appendix 1: Primers
mRNA
Position
Sequence
Size
%
G+
C
Tm
Product
size
Rat
βactin2
Forward
Reverse
ACAACCTTCTTGCAGCTCCTC
CGATGGAGGGGAAGACGGCC
21
20
52
70
64
68
156bp
rNurr1
(Nr4a1)
Forward
Reverse
GAGGGTCTGTGCGCTGTTTG
TGTCCGTGCGAACCACTTCT
20
20
60
55
64
62
232bp
rLmx1b
Forward
Reverse
AGATCGTGGCCATGGAGCAG
GGAGCTCTGCATGGAGTAGAG
20
21
60
57
64
66
221bp
rMsx1
Forward
Reverse
GCCTCTCGGCCATTTCTCTG
CGGTTGGTCTTGTGCTTGCG
20
20
60
60
64
64
180bp
rOtx2
Forward
Reverse
TAAAGCAACCGCCTTACGCAG
TGTTGCTGACGGCACTTAGC
21
20
52
55
64
62
301bp
Forward
ATGGAAGGGCACGAGCCATCC
21
62
68
202bp
Reverse
TCATTCCAGCGCCCACATAGG
21
57
66
(single
exon
gene)
rEn2
Forward
Reverse
CTGCACACGTTACTCTGACC
CCCGCTTGTTCTGGAACCAG
20
20
55
60
62
64
237bp
Pax6
Forward
Reverse
GAGACTGGCTCCATCAGACC
CTAGCCAGGTTGCGAAGAAC
20
20
60
55
64
62
212bp
TH(a)
Forward
Reverse
CGTGGCCGGTCTACTGTCC
AGCTGCTGTGTCTGGGTCAAAG
19
22
68
55
64
68
388bp
TH(b)
Forward
Reverse
TCCGCCATGCCTCCTCACCTAT
GAGCTTGTCCTTGGCGTCATTG
22
22
59
55
70
68
392bp
Pitx3a
Forward
Reverse
GCAAGGGGCAGGAGCACAGT
AGGCCCCACGTTGACCGAGTT
20
21
60
62
66
68
446bp
Pitx3b
Forward
Reverse
CGCCGCTCGCCGCCAAGACC
GACACTGCCCCGGAGGACACG
20
21
80
71
72
72
220bp
rFoxa2
Research Internship: Leonie Bekhuis
38
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Nanog
Forward
Reverse
GCCCTGAGAAGAAAGAAGAG
CTGACTGCCCCATACTGGAA
20
20
Oct4
Forward
Reverse
GGGATGGCATACTGTGGAC
CTTCCTCCACCCACTTCTC
19
19
Rex1
Forward
Reverse
TTCTTGCCAGGTTCTGGAAGC
TTTCCCACACTCTGCACACAC
21
21
Klf4
Forward
Reverse
CAGTCGCAAGTCCCCTCTCTC
CCTGTCGCACTTCTGGCACTG
21
21
50
55
60
62
356bp
60
60
412bp
52
52
61
61
277bp
62
62
70
70
321bp
58
58
Appendix 2: RT-PCR conditions for primers
βactin2:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.4µM forward primer
-0.4µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
Otx2:
50μl reaction volume:
-ddH2O
-x1 Buffer
-2.0mM MgCl2
-0.4mM dNTPs
-0.8µM forward primer
-0.8µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
TH:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.2µM forward primer
-0.2µM reverse primer
-2μl cDNA (200ng/µl)
Research Internship: Leonie Bekhuis
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-58°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
30 cycles
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-63°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-52°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
39
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
-0.5µl Taq polymerase (5 units/µl)
Pitx3:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.2µM forward primer
-0.2µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
En2, Pax6, Nurr1, Foxa2:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.2µM forward primer
-0.2µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
Lmx1b:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.8µM forward primer
-0.8µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
Msx1:
50μl reaction volume:
-ddH2O
-x1 Buffer
-2.0mM MgCl2
-0.4mM dNTPs
-0.8µM forward primer
-0.8µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
Research Internship: Leonie Bekhuis
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-61°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-50°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-61°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-61°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
40
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
Rex1, Oct4, Nanog, Klf4:
50μl reaction volume:
-ddH2O
-x1 Buffer
-1.5mM MgCl2
-0.4mM dNTPs
-0.2µM forward primer
-0.2µM reverse primer
-2μl cDNA (200ng/µl)
-0.5µl Taq polymerase (5 units/µl)
Research Internship: Leonie Bekhuis
PCR amplification:
-94°C for 2 min.
-94°C for 30 sec.
-50°C for 40 sec.
-72°C for 40 sec.
-72°C for 10 min.
-4°C forever
32 cycles
41
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
References
1. Savitt, J. M., Dawson, V. L. & Dawson, T. M. Diagnosis and treatment of
Parkinson disease: molecules to medicine. J. Clin. Invest. 116, 1744-1754 (2006).
2. Arenas, E. Towards stem cell replacement therapies for Parkinson's disease.
Biochem. Biophys. Res. Commun. 396, 152-156 (2010).
3. Silver, D. Impact of functional age on the use of dopamine agonists in patients with
Parkinson disease. Neurologist 12, 214-223 (2006).
4. Missale, C., Russel Nash, S., Robinson, S. W., Jaber, M. & Caron, M. G.
Dopamine receptors: From structure to function. Physiol. Rev. 78, 189-225 (1998).
5. Factor, S. A. & Weiner, W. J. in Parkinson's disease: diagnosis and clinical
management (Demos Medical Publishing, 2008).
6. http://www.med.upenn.edu/udall/learn.shtml.
7. Aschenbrenner, D. S. & Venable, S. J. in Drug therapy in nursing 1311 (Wolters
Kluwer Health/ Lippincott Williams & Wilkins, 2009).
8. http://yassermetwally.wordpress.com/2008/09/17/medical-management-ofparkinson-disease/.
9. Wijeyekoon, R. & Barker, R. A. Cell replacement therapy for Parkinson's disease.
Biochim. Biophys. Acta 1792, 688-702 (2009).
10. Freed, C. R. et al. Transplantation of embryonic dopamine neurons for severe
Parkinson's disease. N. Engl. J. Med. 344, 710-719 (2001).
11. Rippon, H. J. & Bishop, A. E. Embryonic Stem Cells. Cell Proliferation 37, 23-34
(2004).
12. de Wert, G. & Mummery, C. Human embryonic stem cells: research, ethics and
policy. Hum. Reprod. 18, 672-682 (2003).
13. Luo, Y., Kuang, S. Y. & Hoffer, B. How useful are stem cells in PD therapy?
Parkinsonism Relat. Disord. 15 Suppl 3, S171-5 (2009).
14. Lévesque, M. F., Neuman, T. & Rezak, M.
Therapeutic microinjection of autologous adult human neural stem cells and
differentiated neurons for Parkinson's disease: five-year post-operative outcome.
Open Stem Cell Journal, 20-29 (2009).
15. Meyer, A. K., Maisel, M., Hermann, A., Stirl, K. & Storch, A. Restorative
approaches in Parkinson's Disease: which cell type wins the race? J. Neurol. Sci. 289,
93-103 (2010).
Research Internship: Leonie Bekhuis
42
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
16. Evans, M. J. & Kaufman, M. H. Establishment in culture of pluripotential cells
from mouse embryos. Nature 292, 154-156 (1981).
17. Martin, G. R. Isolation of a pluripotent cell line from early mouse embryos
cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci.
U. S. A. 78, 7634-7638 (1981).
18. http://www.openbiosystems.com/GeneTargeting/MEScells/.
19. Takahashi, K. & Yamanaka, S. Induction of Pluripotent Stem Cells from Mouse
Embryonic and Adult Fibroblast Cultures by Defined Factors. Cell 126, 663-676
(2006).
20. Takahashi, K. et al. Induction of Pluripotent Stem Cells from Adult Human
Fibroblasts by Defined Factors. Cell 131, 861-872 (2007).
21. Xu, L., Tan, Y. -., Ding, J. -. & Chen, S. -. The iPS Technique Provides Hope for
Parkinson's Disease Treatment. Stem Cell Reviews and Reports 6, 398-404 (2010).
22. Wernig, M. et al. Neurons derived from reprogrammed fibroblasts functionally
integrate into the fetal brain and improve symptoms of rats with Parkinson's disease.
Proc. Natl. Acad. Sci. U. S. A. 105, 5856-5861 (2008).
23. Buehr, M. et al. Capture of authentic embryonic stem cells from rat blastocysts.
Cell 135, 1287-1298 (2008).
24. Bavister, B. D., Wolf, D. P. & Brenner, C. A. Challenges of primate embryonic
stem cell research. Cloning Stem Cells 7, 82-94 (2005).
25. Jacob, H. J. Functional genomics and rat models. Genome Research 9, 1013-1016
(1999).
26. Na, S. J. et al. Molecular profiling of a 6-hydroxydopamine model of Parkinson's
disease. Neurochem. Res. 35, 761-772 (2010).
27. Li, P. et al. Germline compentent embryonic stem cells derived from rat
blastocysts. Cell 135, 1-12 (2008).
28. Ying, Q. L., Nichols, J., Chambers, I. & Smith, A. BMP induction of Id proteins
suppresses differentiation and sustains embryonic stem cell self-renewal in
collaboration with STAT3. Cell 115, 281-292 (2003).
29. Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature
453, 519-523 (2008).
30. Gearhart, J. et al. in Essentials of stem cell biology (ed Lanza, R.) 39-61 (Elsevier,
2009).
31. http://www.brc.riken.go.jp/lab/dna/en/GENESETBANK/302mapk_ras.html.
Research Internship: Leonie Bekhuis
43
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
32. Seger, R. & Krebs, E. G. The MAPK signaling cascade. FASEB Journal 9, 726735 (1995).
33. Gale, E. & Li, M. Midbrain dopaminergic neuron fate specification: Of mice and
embryonic stem cells. Mol. Brain 1, 8 (2008).
34. Castelo-Branco, G. & Arenas, E. Function of Wnts in dopaminergic neuron
development. Neurodegenerative Diseases 3, 5-11 (2006).
35. Maxwell, S. L. & Li, M. Midbrain dopaminergic development in vivo and in vitro
from embryonic stem cells. J. Anat. 207, 209-218 (2005).
36. Ang, S. -. Transcriptional control of midbrain dopaminergic neuron development.
Development 133, 3499-3506 (2006).
37. Matsunaga, E., Katahira, T. & Nakamura, H. Role of Lmx1b and Wnt1 in
mesencephalon and metencephalon development. Development 129, 5269-5277
(2002).
38. Guo, C. et al. Lmx1b is essential for Fgf8 and Wnt1 expression in the isthmic
organizer during tectum and cerebellum development in mice. Development 134, 317325 (2007).
39. Ferri, A. L. M. et al. Foxa1 and Foxa2 regulate multiple phases of midbrain
dopaminergic neuron development in a dosage-dependent manner. Development 134,
2761-2769 (2007).
40. Kawasaki, H. et al. Induction of midbrain dopaminergic neurons from ES cells by
stromal cell-derived inducing activity. Neuron 28, 31-40 (2000).
41. Lee, S. -., Lumelsky, N., Studer, L., Auerbach, J. M. & McKay, R. D. Efficient
generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat.
Biotechnol. 18, 675-679 (2000).
42. Höpfl, G., Gassmann, M. & Desbaillets, I. Differentiating embryonic stem cells
into embryoid bodies. Methods Mol. Biol. 254, 79-98 (2004).
43. Ying, Q. -., Stavridis, M., Griffiths, D., Li, M. & Smith, A. Conversion of
embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat.
Biotechnol. 21, 183-186 (2003).
44. Chang, M. Y. et al. Direct reprogramming of rat neural precursor cells and
fibroblasts into pluripotent stem cells. PLoS One 5, e9838 (2010).
45. Thellin, O. et al. Housekeeping genes as internal standards: Use and limits. J.
Biotechnol. 75, 291-295 (1999).
46. Niwa, H., Miyazaki, J. & Smith, A. G.
Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or selfrenewal of ES cells. Nature Genetics 24, 372-376 (2000).
Research Internship: Leonie Bekhuis
44
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
47. Zimmerman, L. et al. Independent regulatory elements in the nestin gene direct
transgene expression to neural stem cells or muscle precursors. Neuron 12, 11-24
(1994).
48. Sakurai, K. & Osumi, N. The neurogenesis-controlling factor, Pax6, inhibits
proliferation and promotes maturation in murine astrocytes. Journal of Neuroscience
28, 4604-4612 (2008).
49. Otto, F. J. Chapter 14 High-Resolution Analysis of Nuclear DNA Employing the
Fluorochrome DAPI. Methods in Cell Biology 41, 211-217 (1994).
50. Marone, M., Mozzetti, S., De Ritis, D., Pierelli, L. & Scambia, G.
Semiquantitative RT-PCR analysis to assess the expression levels of multiple
transcripts from the same sample. Biol. Proced. Online 3, 19-25 (2001).
51. Wu, D. & Pan, W. GSK3: a multifaceted kinase in Wnt signaling. Trends
Biochem. Sci. 35, 161-168 (2010).
52. Glubrecht, D. D., Kim, J. -., Russell, L., Bamforth, J. S. & Godbout, R.
Differential CRX and OTX2 expression in human retina and retinoblastoma. J.
Neurochem. 111, 250-263 (2009).
53. Degenhardt, K., Rentschler, S., Fishman, G. & Sassoon, D. A. Cellular and cisregulation of En-2 expression in the mandibular arch. Mech. Dev. 111, 125-136
(2002).
54. Olguin, H. & Brandan, E. Postnatal Msx1 expression pattern in craniofacial, axial,
and appendicular skeleton of transgenic mice from the first week until the second
year. Developmental Dynamics 221, 1-13 (2001).
55. Chen, Y. -., Ishii, M., Sucov, H. M. & Maxson Jr., R. E. Msx1 and Msx2 are
required for endothelial-mesenchymal transformation of the atrioventricular cushions
and patterning of the atrioventricular myocardium. BMC Developmental Biology 8
(2008).
56. Zhang, Z., Lan, Y., Chai, Y. & Jiang, R. Antagonistic actions of Msx1 and Osr2
pattern mammalian teeth into a single row. Science 323, 1232-1234 (2009).
57. Koshiba, K., Kuroiwa, A., Yamamoto, H., Tamura, K. & Ide, H. Expression of
Msx genes in regenerating and developing limbs of axolotl. J. Exp. Zool. 282, 703714 (1998).
58. Besnard, V., Wert, S. E., Hull, W. M. & Whitsett, J. A. Immunohistochemical
localization of Foxa1 and Foxa2 in mouse embryos and adult tissues. Gene
Expression Patterns 5, 193-208 (2004).
59. Hermanson, E. et al. Nurr1 regulates dopamine synthesis and storage in MN9D
dopamine cells. Exp. Cell Res. 288, 324-334 (2003).
Research Internship: Leonie Bekhuis
45
Evaluation of Midbrain Dopaminergic Neuron Specification in Rat ES Cell Derived Neurons
60. Nsegbe, E. et al. Congenital hypoventilation and impaired hypoxic response in
Nurr1 mutant mice. J. Physiol. (Lond. ) 556, 43-59 (2004).
61. Castelo-Branco, G., Rawal, N. & Arenas, E. GSK-3beta inhibition/beta-catenin
stabilization in ventral midbrain precursors increases differentiation into dopamine
neurons. J. Cell. Sci. 117, 5731-5737 (2004).
62. Bally-Cuif, L., Alvarado-Mallarti, R. -., Darnell, D. K. & Wassef, M. Relationship
between Wnt-1 and En-2 expression domains during early development of normal and
ectopic met-mesencephalon. Development 115, 999-1009 (1992).
63. Kimura-Yoshida, C. et al. Canonical Wnt signaling and its antagonist regulate
anterior-posterior axis polarization by guiding cell migration in mouse visceral
endoderm. Developmental Cell 9, 639-650 (2005).
64. Monsoro-Burq, A. -., Wang, E. & Harland, R. Msx1 and Pax3 cooperate to
mediate FGF8 and WNT signals during Xenopus neural crest induction.
Developmental Cell 8, 167-178 (2005).
65. Coulon, V. et al. A muscle-specific promoter directs Pitx3 gene expression in
skeletal muscle cells. J. Biol. Chem. 282, 33192-33200 (2007).
66. Wong, M. L. & Medrano, J. F. Real-time PCR for mRNA quantitation.
BioTechniques 39, 75-85 (2005).
67. Rodrigues, C. A. V., Diogo, M. M., Da Silva, C. L. & Cabral, J. M. S. Hypoxia
enhances proliferation of mouse embryonic stem cell-derived neural stem cells.
Biotechnol. Bioeng. 106, 260-270 (2010).
68. Stacpoole, S. R. L. et al. Derivation of neural precursor cells from human ES cells
at 3% O2 is efficient, enhances survival and presents no barrier to regional
specification and functional differentiation. Cell Death Differ. (2011).
69. Yan, Y. et al. Directed differentiation of dopaminergic neuronal subtypes from
human embryonic stem cells. Stem Cells 23, 781-790 (2005).
Research Internship: Leonie Bekhuis
46