Fescue Chloroplast Genome Project - Part V
DNA Sequencing
Goal – sequence portions of our inserts.
Materials
 Template DNA (the cloned pieces of DNA in plasmid vectors)
 Primers (T7 and/or SP6)
 Sequencing Reaction mix (BIGDYE)
 Applied Biosystems Genetic Analyzer automated DNA sequencer.
Introduction
The dideoxy termination method for sequencing DNA was developed in the
1970’s. It takes advantage of the natural process of DNA replication coupled with
modified nucleotides that halt synthesis at specific places on a DNA template. In this
process each piece of DNA that is produced is permanently stopped at a specific
nucleotide. Over the course of multiple reactions a complete set of nested products is
produced. Each product differs in length from its counterparts by as little as a single
nucleotide. The products are distinguished and visualized through separation by
electrophoresis and visualization by either radioactive isotopes or fluorescent tags.
The original method was simple enough to be performed in most molecular biology labs
but was labor intensive. It wasn’t until the advent of automated DNA sequencing that
large genome sequencing was realized. We will use an automated DNA sequencer that
uses dideoxy termination chemistry and modified termination nucleotides with attached
fluorescent dyes. The dyes allow a spectrophotometer within the sequencer to identify
each base.
The sequencing reaction
If we want to use DNA replication
for sequencing we have to satisfy all
of the criteria needed for that process.
1. Double stranded DNA must be
denatured to allow a primer to anneal
2. DNA synthesis can only begin
after a primer is in place.
One of the purposes for putting our unknown piece of DNA into a cloning vector was to
give us known flanking regions where the first primers can anneal. WE KNOW THE
SEQUENCE OF OUR VECTOR BUT NOT OUR INSERT.
attatgctgagtgatatccc
taagatatcacagtggattta
Our insert
T7 primer
SP6 primer
Cloning vector
We will use the T7 and SP6 primers today because they represent known sequences on
the cloning vector. Each one will prime a reaction that will sequence into our insert of
unknown DNA.
3. Once a primer is in place the
sequencing reaction can begin.
DNA Polymerase will add bases
according to the template. Most
of the nucleotides provided for the
polymerase are normal bases
(represented as A, T, G, and C in
the figure) that allow typical
polymerization.
Normal
Base is
Added
Another
Normal
Base is
Added
4. This will continue until one of the
modified “terminator” bases (represented
as A**, G**, T**, C**) is added.
This stops synthesis of the strand and
the base which was added carries a
fluorescent marker which allows us
to determine exactly which base it is.
The figure shows one incidence of this type
of reaction. We have to imagine now that
this reaction is taking place thousands of times on multiple templates. Each reaction
results in a product that ends at a different base. If enough reactions are run then every
single base should be represented in our products.
5. Our reaction products are now separated by gel electrophoresis which can distinguish
fragments that differ by a single nucleotide.
Within the sequencer a spectrophotometer
uses a laser to excite a fluorescent tag found
on the end of each fragment. There are
four tags (one for each nucleotide) which
emit four different fluorescent patterns.
A computer program reads the wavelength
patterns and scores each fragment as
A, T, G, or C and gives it to us as a
sequence.
Procedure
1. Mix the following in a 0.2ml thin-walled PCR tube.
4 ul BigDye sequencing mix
Contains – nucleotide mix (both normal and terminator), reaction buffer,
and thermostable DNA polymerase.
1 ul primer
Either T7 or SP6
5 ul template DNA
The piece of DNA we with to sequence in a cloning vector.
2. The reaction mix will be incubated in a thermal cycler to run it through the proper
temperature cycles to produce multiple products from multiple templates.