Standard Test Nucleic Acid Unit
Name_______________________________
Date: ____________ Period: ___________
1. _________Who discovered the structure of DNA?
a. Watson & Crick
b. Rosalind Franklin
c. Gregor Mendel
d. Maurice Wilkins
2. __________What is the name of the scientist who took this picture of DNA?
a. Watson & Crick
b. Rosalind Franklin
c. Gregor Mendel
d. Maurice Wilkins
3. _________This picture led scientists to make conclusions about the
a. double helix structure of DNA
b. arrangement of the complimentary nitrogenous bases
c. the function of DNA in heredity
d. the size of the DNA molecule
4. _________When DNA is coiled very tightly into distinct structures, these are called
a. chromosomes
c. centrioles
b. chromatin
d. spindle fibers
5. One chromosome contains ___________ gene(s).
a. 1
b. 3
c. many
6. _________The following strand most likely represents which of the following?
AUGACCGUAACAUAGAGUUAA
a. DNA
b. mRNA
c. tRNA
d. amino acid
7. _________How many codons are on the above strand?
a. 7
b. 4
c. 8
d. 5
8. _________What is a gene?
a. a region of DNA that codes for an amino acid
b. a group of 5 codons
c. region of RNA that codes for a
d. a region of DNA that codes for a protein
9. Transcription takes place at one _______________ at a time
a. chromosome
b. gene
c. DNA strand
d. genome
10. Which of the following is not a true statement about the difference between DNA &
RNA?
a. DNA has deoxyribose sugar and RNA has ribose sugar in its backbone
b. mRNA is single stranded and DNA is double stranded
c. DNA contains uracil and RNA contains thymine
11. Choose the correct nitrogenous base pairs.
a. A-G and T-C
b. A-T and G-C
c. A-C and G-T
Structure of DNA & RNA
12-15. Choose the correct structure
a. Nitrogenous base
b. Deoxyribose sugar
c. Phosphate
d. Nucleotide (ONE OF EACH OF THE ABOVE 3)
Nucleic Acid Function
Label the following diagram & answer the following questions with the correct term.
Each is used once. Word bank is for questions 16-22.
****This word bank is used for all questions on the next two pages. There is one
choice for each question.******
a. tRNA19
b. codon
21
c. anti-codon 20
d. ribosome 18
e. Amino acid 17
a. protein16
b. mRNA22
16.
17.
19.
20.
21.
22.
18.
23. What is the name of this process?
a. replication
b. transcription
c. translation
24. The main purpose of this process is to make a
a. mRNA strand
b. DNA strand
c. amino acid
d. protein
e. codon
Choices for 25-26.
a. protein
b. ribosome
c. DNA25
d. mRNA26
e. tRNA
25.
26.
27. This process is called
a. replication
b. transcription
c. translation
28. This process is called
a. replication
b. transcription
c. translation
29. Both of the replication and transcription take place in the ______________ of the
cell.
a. ribosome
b. cytoplasm
c. nucleus
30. _________Which of the following processes are necessary for cell division, or
mitosis?
a. replication
b. transcription
c. translation
d. a & b
e. b & c
31. _________Is the code of the two DNA strands produced in replication
a. similar but not the same as the original strand
b. the opposite of the original strand
c. the same as the original strand
d. the same as half of the original strand
32. Choose the complimentary mRNA code for the DNA code below.
TTGAACCGATCA
a. AACTTGGCTAGT
b. AACUUGGCUAGU
c. UUCAACCGAUCA
What amino acids do the following codons code for?
33. _________AUG
a. Methionine
b. Cystine
c. Proline
d. Leucine
34. _________CAU
a. Methionine
b. Histine
c. Proline
d. Leucine
Mutations
35. _________A karyotype gives us information about _______________ mutations.
a. chromosomal
b. point
c. frameshift
d. silent
36. _________Do mutations
a. have a beneficial effect
b. have a detrimental effect
c. have no effect
d. any of the above
37. _________What is a mutation?
a. a change in the DNA that has a negative effect
b. a change in one nitrogenous base
c. a change in the DNA that affects a protein
d. any change in the DNA sequence
38. _________Only mutations which occur in ___________ cells will be passed on to
offspring.
a. body
b. skin
c. retinal
d. reproductive
39. _________What is a mutagen?
a. something that fixes mistakes in the DNA code
b. a mutated organism
c. a result of a mutation
d. something that causes a mutation
40. _________Down’s syndrome is the result of a ______________ mutation.
a. chromosomal
b. point
c. frameshift
d. silent
41. _________Does the following sentence represent a point mutation or a frameshift
mutation?
a. point
b frameshift
THE DOG BIT THE CAT
THE DOG BIT THE CAR
--represents original DNA sequence
--represents copied DNA sequence
42. _________The following frameshift mutation was caused by a:
THE DOG BIT THE CAT --represents original DNA sequence
THE DOG ITT HEC AT
--represents copied DNA sequence
a. insertion
b. deletion
c. replacement
d. inversion
43. _________The following mutation would be considered a
Original chromosome
Mutation happening
Mutated chromosome
a. point mutation
b. frameshift mutation
c. chromosome mutation
44. _________The above mutation would be an example of a
a. deletion
b. insertion
c. translocation
d. inversion
45. _________Which of the following mutations is least likely to be serious, and most
likely to have NO effect?
a. point mutation
b. frameshift mutation
c. chromosome mutation
46. _________Which of the following is NOT a type of chromosome mutation?
a. deletion
b. duplication
c. frameshift
d. inversion
47. _________What structures are produced based on the DNA code & control cellular
functions?
a. carbohydrates
b. proteins
c. amino acids
d. lipids
48-50. Short Answer: *******CHOOSE ONE. ******DO NOT try & fit your
answer in between these lines, write below or on a separate sheet. ******
A. Name one application of DNA technology, and describe how it has changed our society. Write in
complete sentences.
B. Describe the 2 types of RNA, what their names stand for, AND what they do.
C. Describe how the term double helix relates to the structure of DNA.
D. Diagnose the below patient based on his or her karyotype AND state whether the individual is a male or
a female.
Bonus:
1. What did scientists believe controlled inheritance before scientists discovered it was
DNA?
2. What is a genome?
3. What percentage of the DNA of humans is the same?
4. What types of bonds hold together the two strands of DNA?
5. What Linus Pauling get right about the structure of DNA? What did he get wrong?
6. The karyotype below would belong to a male or female? What is the diagnosis of this
individual?
7. Using the chart, find the amino acid sequence that will be coded for by the following
DNA strand. (You will need to FIRST convert the DNA code to RNA). Show clearly the
mRNA code. 2 points.
ATGCCAACATTGGAGTCATAA