ANALYSIS OF SEUNG YEO MOON PRIMERS (Moon et al LO 2000) By Jan Wuyts and Rupert De Wachter, Universiteit Antwerpen, Belgium We tried to determine how large a fraction of the known SSU rRNA gene sequences would be amplified by the primer set used in the work by Moon et al.. This proved to be more complicated than it looks at first sight, as explained below. 1. Our database presently contains 5260 eukaryotic SSU rRNA sequences. We only collect and align sequences that are at least 70% complete. However, most incomplete sequences are incomplete at the termini, probably because they were amplified by means of primers further inward than those used in the work by Moon et al.. As a result, only 866 sequences contain both PCR primer binding sites used in the manuscript by Moon et al. So only for these sequences can it be examined which fraction of them would be amplified by the chosen primer set. 2. Although the primers are situated in conserved areas, a considerable fraction of the 866 sequences shows a difference of one or more nucleotides with the primer sequences. Therefore one cannot predict exactly how many sequences would be amplified by the primers, because a difference of a limited number of bases with the primer sequence does not necessarily impair amplification. However one cannot predict exactly how many differences are tolerable. Sometimes a primer does not work although its sequence exactly matches that of the gene, sometimes it works although several nucleotides are different. We assumed that a mismatch of the sequence with the 3’-terminal nucleotide is prohibitive for amplification. Our calculations were performed as follows: For each primer, we counted: the number of sequences with zero mismatches the number of sequences with 1, 2, 3, 4 mismatches, but not in the 3'-terminal nucleotide of the primer. For each primer a list of the distribution of bases at each primer position in the 866 avaiable complete sequences. Number of mismatches with primer 0 1, not in 3’- nucleotide 2, not in 3’- nucleotide 3, not in 3’- nucleotide 4, not in 3’- nucleotide >4 or mismatch in 3’- nucleotide Total Forward primer 593 188 27 47 5 6 866 Number of sequences Reverse primer 654 106 39 23 10 34 866 What you wanted to have, I think, is an estimate of the fraction of eukaryotic species whose SSU rRNA genes would not be amplified by your primers. There is no exact reply to this question, but we have made lists of the species that have the most mismatches with the primers and therefore are least likely to be detectable. Document Primers3.doc contains 4 lists of species with their taxonmy : 1. species with >4 mismatches or a terminal mismatch with the forward primer 2. species with >3 mismatches or a terminal mismatch with the forward primer 3. species with >4 mismatches or a terminal mismatch with the reverse primer 4. species with >3 mismatches or a terminal mismatch with the reverse primer Note that list 2 includes the species of list 1 and list 4 includes those of list 3. You should print these lists in landscape otherwise the lists look too scrambled. Document Primers2.doc contains 2 Tables where you can see for each position of each primer how many times each of the 4 bases occurs. These tables could be useful if you want to develop other primers or primers with more ambiguities. Total number of sequences examined: 866 forward primer: 5'-ACCTGGTTGATCCTGCCAG reverse primer: 5'-TGATCCTTCYGCAGGTTCAC complement: GUGAACCUGCRGAAGGAUCA forward primer, species with > 0 mismatches: total = 273 pr A C G U gap other A 223 16 4 26 0 4 C 9 161 0 100 0 3 C 1 250 3 18 0 1 U 33 11 3 224 0 2 0 0 1 1 271 0 G 1 0 267 4 1 0 G 9 2 260 2 0 0 U 0 0 0 273 0 0 U 0 5 2 261 4 1 0 1 0 0 272 0 G 2 0 270 1 0 0 A 270 0 1 1 1 0 U 2 2 0 268 1 0 C 1 192 0 79 0 1 C 0 244 0 29 0 0 U 0 0 0 273 0 0 G 5 1 266 0 0 1 C 2 261 1 9 0 0 C 0 272 0 1 0 0 A 227 1 9 36 0 0 G 3 1 266 1 0 2 reverse primer, species with > 0 mismatches: total = 211 pr A C G U gap other G 13 1 194 2 1 0 U 32 2 4 172 0 1 G 1 0 208 2 0 0 A 208 0 0 2 0 1 A 210 1 0 0 0 0 1 3 0 0 207 0 C 1 178 4 13 15 0 C 1 204 3 2 1 0 U 35 0 0 175 0 1 0 0 2 0 209 0 G 2 1 185 21 1 1 C 1 178 5 24 2 1 G 138 19 46 3 3 2 G 13 3 186 3 5 1 A 139 58 7 5 2 0 A 125 4 23 58 1 0 G 5 1 202 1 1 1 G 7 1 194 1 8 0 A 199 2 4 3 2 1 U 17 8 2 182 0 2 C 7 190 1 12 0 1 A 157 41 6 7 0 0 List of species with most mismatches Forward primer: Species with more than 4 mismatches or mismatch in last nucleotide: Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 Eukaryota Fungi Ascomycota {Ascomycota incertae sedis} Pleomassariaceae {anamorphic Pleomassariaceae} Dendryphiopsis : Dendryphiopsis atra :AF053731 Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Archosauria Aves Palaeognathae Tinamiformes Tinamidae Nothoprocta : Nothoprocta ornata : AJ002921 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma binucleatum : Z96946 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma neoprocyonis : Z96947 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma turgidum : Z96948 Species with more than 3 mismatches or mismatch in last nucleotide: Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 Eukaryota Diplomonadida Hexamitidae Giardiinae Giardia : Giardia intestinalis : M54878 Eukaryota Diplomonadida Hexamitidae Giardiinae Giardia : Giardia intestinalis : U09491 Eukaryota Diplomonadida Hexamitidae Giardiinae Giardia : Giardia intestinalis : U09492 Eukaryota Diplomonadida Hexamitidae Giardiinae Giardia : Giardia intestinalis : X52949 Eukaryota Fungi Ascomycota {Ascomycota incertae sedis} Pleomassariaceae {anamorphic Pleomassariaceae} Dendryphiopsis : Dendryphiopsis atra :AF053731 Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Archosauria Aves Palaeognathae Tinamiformes Tinamidae Nothoprocta : Nothoprocta ornata : AJ002921 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma binucleatum : Z96946 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma neoprocyonis : Z96947 Eukaryota Metazoa Nematoda Chromadorea Spirurida Gnathostomatoidea Gnathostomatidae Gnathostoma : Gnathostoma turgidum : Z96948 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : AJ005581 Reverse primer: Species with more than 4 mismatches or mismatch in last nucleotide: Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium vivax (malaria parasite P. vivax) : U93095 Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Archosauria Aves Palaeognathae Tinamiformes Tinamidae Nothoprocta : Nothoprocta ornata : AJ002921 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha lymantriae : AF033315 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha necatrix : Y00266 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha sp. : D85502 Eukaryota Microsporidia : Microsporidium 57864 : U90885 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U26534 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U26534 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U97150 Eukaryota Microsporidia Nosematidae Nosema : Nosema bombycis : D85503 Eukaryota Microsporidia Nosematidae Nosema : Nosema ceranae : U26533 Eukaryota Microsporidia Nosematidae Nosema : Nosema furnacalis : U26532 Eukaryota Microsporidia Nosematidae Nosema : Nosema necatrix : U11051 Eukaryota Microsporidia Nosematidae Nosema : Nosema oulemae : U27359 Eukaryota Microsporidia Nosematidae Nosema : Nosema portugal : AF033316 Eukaryota Microsporidia Nosematidae Nosema : Nosema sp. : D85501 Eukaryota Microsporidia Nosematidae Nosema : Nosema sp. : D85501 Eukaryota Microsporidia Nosematidae Nosema : Nosema trichoplusiae : U09282 Eukaryota Microsporidia : Pleistophoridae : D85500 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98467 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98469 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98470 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon hellem : AF118142 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon hellem : AF118143 Eukaryota Microsporidia Visvesvaria : Visvesvaria acridophagus : AF024658 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acetabularia : Acetabularia acetabulum : Z33461 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acetabularia : Acetabularia major : Z33462 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acicularia : Acicularia schenkii : Z33470 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Cymopolia : Cymopolia van bosseae : Z33467 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Neomeris : Neomeris dumentosa : Z33469 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Polyphysa : Polyphysa peniculus : Z33472 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Polyphysa : Polyphysa peniculus : Z33473 Species with more than 3 mismatches or mismatch in last nucleotide: Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium vivax (malaria parasite P. vivax) : U93095 Eukaryota Fungi Basidiomycota Hymenomycetes Ceratobasidiales Ceratobasidiaceae {anamorphic Ceratobasidiaceae} Rhizoctonia : Rhizoctonia praticola : M92990 Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Archosauria Aves Palaeognathae Tinamiformes Tinamidae Nothoprocta : Nothoprocta ornata : AJ002921 Eukaryota Metazoa Cnidaria Epiactis : Epiactis japonica : Z92904 Eukaryota Metazoa Cnidaria Hydrozoa Hydroida Sertulariidae Selaginopsis: Selaginopsis cornigera : Z92899 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha lymantriae : AF033315 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha necatrix: Y00266 Eukaryota Microsporidia Burenellidae Vairimorpha : Vairimorpha sp. : D85502 Eukaryota Microsporidia : Microsporidium 57864 : U90885 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U26534 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U26534 Eukaryota Microsporidia Nosematidae Nosema : Nosema apis : U97150 Eukaryota Microsporidia Nosematidae Nosema : Nosema bombycis : D85503 Eukaryota Microsporidia Nosematidae Nosema : Nosema ceranae : U26533 Eukaryota Microsporidia Nosematidae Nosema : Nosema furnacalis : U26532 Eukaryota Microsporidia Nosematidae Nosema : Nosema necatrix : U11051 Eukaryota Microsporidia Nosematidae Nosema : Nosema oulemae : U27359 Eukaryota Microsporidia Nosematidae Nosema : Nosema portugal : AF033316 Eukaryota Microsporidia Nosematidae Nosema : Nosema sp. : D85501 Eukaryota Microsporidia Nosematidae Nosema : Nosema sp. : D85501 Eukaryota Microsporidia Nosematidae Nosema : Nosema trichoplusiae :U09282 Eukaryota Microsporidia : Pleistophoridae : D85500 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98467 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98469 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon cuniculi : X98470 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon hellem : AF118142 Eukaryota Microsporidia Unikaryonidae Encephalitozoon : Encephalitozoon hellem : AF118143 Eukaryota Microsporidia Visvesvaria : Visvesvaria acridophagus :AF024658 Eukaryota stramenopiles Chrysophyceae Synurales Synura : Synura uvella : U73222 Eukaryota stramenopiles Labyrinthulida Thraustochytriidae Labyrinthuloides : Labyrinthuloides haliotidis : U21338 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acetabularia : Acetabularia acetabulum : Z33461 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acetabularia : Acetabularia major : Z33462 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Acicularia : Acicularia schenkii : Z33470 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Batophora : Batophora occidentalis : Z33465 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Batophora : Batophora oerstedii : Z33463 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Bornetella : Bornetella nitida : Z33464 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Cymopolia : Cymopolia van bosseae : Z33467 Eukaryota Viridiplantae Chlorophyta Ulvophyceae DasycladalesDasycladaceae Neomeris : Neomeris dumentosa : Z33469 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Polyphysa : Polyphysa parvula : Z33471 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Polyphysa : Polyphysa peniculus : Z33472 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae Polyphysa : Polyphysa peniculus : Z33473 ANALYSIS OF MEDLIN PRIMERS Dear Daniel, My collaborator Jan Wuyts has done the calculations on the Medlin primers and I am attaching his results. We have simply made the required changes in the 3 files and they are now called Medlin1.doc to Medlin3.doc. As you will see, the addition of extra nucleotides results in more species possessing differences, especially at the 3'-terminus of the forward primer. So if you want to amplify the 18S genes of the maximum possible diversity of species I think Mooon's primers are better. Best wishes, Rupert We tried to determine how large a fraction of the known SSU rRNA gene sequences would be amplified by the primer set used by Medlin. This proved to be more complicated than it looks at first sight, as explained below. 3. Our database presently contains 5260 eukaryotic SSU rRNA sequences. We only collect and align sequences that are at least 70% complete. However, most incomplete sequences are incomplete at the termini, probably because they were amplified by means of primers further inward than those used by Medlin. As a result, only 1033 sequences contain the PCR primer binding sites at the 5' terminus of the molecule and only 795 sequences contain the PCR primer binding sites at the 3' terminus. So only for these sequences can it be examined which fraction of them would be amplified by the chosen primer set. 4. Although the primers are situated in conserved areas, a considerable fraction of the sequences shows a difference of one or more nucleotides with the primer sequences. Therefore one cannot predict exactly how many sequences would be amplified by the primers, because a difference of a limited number of bases with the primer sequence does not necessarily impair amplification. However one cannot predict exactly how many differences are tolerable. Sometimes a primer does not work although its sequence exactly matches that of the gene, sometimes it works although several nucleotides are different. We assumed that a mismatch of the sequence with the 3’-terminal nucleotide is prohibitive for amplification. Our calculations were performed as follows: For each primer, we counted: the number of sequences with zero mismatches the number of sequences with 1, 2, 3, 4 mismatches, but not in the 3'-terminal nucleotide of the primer. For each primer a list of the distribution of bases at each primer position in the 1033 and 795 avaiable sequences with complete termini. Number of mismatches with primer 0 1, not in 3’- nucleotide 2, not in 3’- nucleotide 3, not in 3’- nucleotide 4, not in 3’- nucleotide >4 or mismatch in 3’- nucleotide Total Forward primer 421 278 134 69 61 70 1033 Number of sequences Reverse primer 162 437 96 34 18 48 795 What you wanted to have, I think, is an estimate of the fraction of eukaryotic species whose SSU rRNA genes would not be amplified by your primers. There is no exact reply to this question, but we have made lists of the species that have the most mismatches with the primers and therefore are least likely to be detectable. Document Medlin2.doc contains 2 Tables where you can see for each position of each primer how many times each of the 4 bases occurs. These tables could be useful if you want to develop other primers or primers with more ambiguities. Document Medlin3.doc contains 2 lists of species with their taxonmy : 5. species with >4 mismatches or a terminal mismatch with the forward primer 6. species with >4 mismatches or a terminal mismatch with the reverse primer forward primer: 5'- AACCTGGTTGATCCTGCCAGTA Total number of sequences examined: 1033 species with > 0 mismatches: total = 612 pr A A C C U G G U U G A U C C U G C C A G U A | | | | | | | | | | | | | | | | | | | | | | | | | | | | A 145 501 10 1 39 0 1 22 1 0 1 0 2 609 3 2 0 0 5 0 0 1 559 8 0 50 509 C 101 19 432 551 17 0 0 1 1 9 0 0 0 0 1 520 575 1 2 1 600 610 0 1 0 16 39 G 18 3 0 3 2 1 599 586 0 4 0 0 606 1 0 0 0 0 602 0 2 0 11 601 1 9 52 U 255 10 123 28 549 1 4 3 609 590 0 1 1 1 606 89 37 609 1 0 10 1 42 0 19 517 8 gap 0 0 1 0 0 610 1 0 1 4 611 611 1 1 1 0 0 0 0 611 0 0 0 0 592 0 0 other 94 80 47 30 6 1 8 1 1 6 1 1 3 1 2 2 1 3 3 1 1 1 1 3 1 21 5 reverse primer: 5'- GATCCTTCTGCAGGTTCACCTAC complement: GUAGGUGAACCUGCAGAAGGAUC Total number of sequences examined: 795 species with > 0 mismatches: total = 633 pr G U A G G U G A A C C U G C A G A A G G A U C | | | | | | | | | | | | | | | | | | | | | | | | | | | | A 4 1 1 603 0 16 28 2 630 631 1 1 0 33 0 2 3 80 0 18 563 509 4 7 617 4 10 C 2 1 0 3 2 0 2 0 0 1 4 595 626 0 0 1 599 21 0 4 56 7 2 3 1 9 611 G 621 2 0 0 624 578 4 630 0 1 0 3 2 0 2 608 6 505 2 605 8 61 624 613 4 5 3 U 5 629 1 26 0 3 599 1 2 0 0 16 2 600 0 19 20 3 0 3 4 52 1 2 10 615 9 gap 0 0 631 0 2 36 0 0 0 0 628 18 2 0 631 1 2 1 631 2 1 2 1 8 1 0 0 other 2 1 1 2 6 1 1 1 2 1 1 1 2 1 1 3 4 24 1 2 2 3 2 1 1 1 1 List of species with most mismatches Forward primer: Species with more than 4 mismatches or mismatch in last nucleotide: 1 Eukaryota Metazoa Arthropoda Crustacea Malacostraca Eumalacostraca Eucarida Decapoda Dendrobranchiata Penaeoidea Penaeidae Penaeus Farfantepenaeus : Penaeus (Farfantepenaeus) aztecus (brown shrimp) : M34362 1 Eukaryota Metazoa Arthropoda Crustacea Malacostraca Eumalacostraca Eucarida Decapoda Pleocyemata Stenopodidea Stenopodidae Stenopus : Stenopus hispidus (banded coral shrimp) : M34361 1 Eukaryota Metazoa Chordata Craniata Hyperotreti Myxiniformes Myxinidae Eptatretinae Eptatretus : Eptatretus stouti (Pacific hagfish) : M97572 1 Eukaryota Metazoa Chordata Craniata Hyperotreti Myxiniformes Myxinidae Myxininae Myxine : Myxine glutinosa (Atlantic hagfish) : M97574 1 Eukaryota Metazoa Chordata Craniata Vertebrata Euteleostomi Amphibia Gymnophiona Caeciliidae Caeciliinae Grandisonia : Grandisonia alternans : M59391 1 Eukaryota Metazoa Gastrotricha Chaetonotida Paucitubulatina Chaetonotidae Chaetonotus : Chaetonotus sp. : AJ001735 8 Eukaryota Metazoa Nematoda Chromadorea : X03680;Z96946;Z96947;Z96948;L04153;L04154;L04152;U01230 1 Eukaryota Metazoa Arthropoda Pentastomida Porocephalida Porocephaloidea Porocephalidae Porocephalus : Porocephalus crotali : M29931 1 Eukaryota Fungi Ascomycota Saccharomycetes Saccharomycetales {anamorphic Saccharomycetales} Candida : Candida tropicalis : M60308 1 Eukaryota Fungi Basidiomycota Hymenomycetes Auriculariales Auriculariaceae Auricularia : Auricularia polytricha : L22255 4 Eukaryota Viridiplantae Embryophyta Tracheophyta Spermatophyta Magnoliophyta eudicotyledons : X16604;X16603;L24408;L24415 1 Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 1 Eukaryota Cryptophyta Cryptomonadaceae Geminigera : Geminigera cryophila : U53123 33 Eukaryota Microsporidia : U68473;U68474;AF027685;AF024655;AF027683;AF027684;Z19563;X98467;X98470;X98469;AJ005581;L07123;AF023245;AF024657;U26534;U97150;D 85503;D85504;U26533;U26532;U11051;U27359;D85501;U09282;AF027682;U10342;D85500;AF033197;AJ002605;Y00266;D85502;AF024658;AF024656 ; 1 Eukaryota Cercozoa Cercomonadidae Cercomonas : Cercomonas ATCC50319 : U42451 6 Eukaryota Diplomonadida Hexamitidae Giardiinae Giardia : M54878;X52949;U09491;U09492;AF006676;AF006677 Reverse primer: Species with more than 4 mismatches or mismatch in last nucleotide: 1 Eukaryota Metazoa Arthropoda Crustacea Maxillopoda Cirripedia Thoracica Sessilia Balanomorpha Chthamaloidea Chthamalidae Chthamalus : Chthamalus fragilis : L26515 1 Eukaryota Metazoa Cnidaria Hydrozoa Hydroida Sertulariidae Selaginopsis : Selaginopsis cornigera : Z92899 1 Eukaryota Fungi Ascomycota Taphrinales Taphrinaceae Taphrina : Taphrina deformans (peach leaf curl fungus) : X69852 1 Eukaryota Fungi Ascomycota Pezizales Helvellaceae Helvella : Helvella lacunosa : U53378 1 Eukaryota Fungi Basidiomycota Hymenomycetes Ceratobasidiales Ceratobasidiaceae {anamorphic Ceratobasidiaceae} Rhizoctonia : Rhizoctonia praticola : M92990 1 Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium falciparum (malaria parasite P. falciparum) : X57167 1 Eukaryota Alveolata Apicomplexa Haemosporida Plasmodium : Plasmodium vivax (malaria parasite P. vivax) : U93095 13 Eukaryota Viridiplantae Chlorophyta Ulvophyceae Dasycladales Dasycladaceae : Z33461;Z33460;Z33468;Z33462;Z33470;Z33465;Z33463;Z33464;Z33467;Z33469;Z33471;Z33472;Z33473; 1 Eukaryota stramenopiles Chrysophyceae Synurales Synura : Synura uvella : U73222 1 Eukaryota stramenopiles Labyrinthulida Thraustochytriidae Labyrinthuloides : Labyrinthuloides haliotidis : U21338 17 Eukaryota Microsporidia : L15741;X98467;X98470;X98469;U26534;U97150;D85503;U26533;U26532;U11051;U27359;D85501;U09282;D85500;Y00266;D85502;AF024658